ID: 966830439

View in Genome Browser
Species Human (GRCh38)
Location 3:184003364-184003386
Sequence CTGGGGAGTAAGGATGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 311}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966830439 Original CRISPR CTGGGGAGTAAGGATGTGGT GGG (reversed) Intronic
900033276 1:386584-386606 GTGGGGAGAAGGGATGTGGGGGG - Intergenic
900054114 1:616473-616495 GTGGGGAGAAGGGATGTGGGGGG - Intergenic
900639786 1:3683100-3683122 CGGGGGAATAATGAGGTGGTGGG + Exonic
901214845 1:7549423-7549445 CGGGGGAATAAGGATGAGGGAGG - Intronic
902435727 1:16397198-16397220 CTGTGGATTGAGGATGTGGCAGG + Exonic
902654784 1:17859723-17859745 CTGGGGAGTGGGGATTTGGAGGG - Intergenic
902706516 1:18209023-18209045 CTGGGGAGGAAGGAGAAGGTGGG + Intronic
903966802 1:27095851-27095873 ATGGGGAGTGTGGATGTGGAAGG - Intergenic
904333039 1:29777724-29777746 CAGGTGAGAAAGGATGTGCTGGG + Intergenic
906122514 1:43403796-43403818 GTGGGAAGAAAGGATGGGGTGGG + Intronic
907797104 1:57728646-57728668 TTGGGGTGTGAGGAGGTGGTGGG + Intronic
908168451 1:61481797-61481819 CGGGGGAGGAAGAGTGTGGTGGG + Intergenic
910015681 1:82520393-82520415 CTGGAGAGAAAGGCTGTGGAGGG + Intergenic
911218254 1:95218906-95218928 GTGGGGAGTGACGATGTTGTAGG + Intronic
912067108 1:105757612-105757634 TTGGGGAAGAAGTATGTGGTTGG + Intergenic
912176117 1:107159511-107159533 CTGGTGAGTAAGGATAAGATAGG - Intronic
912469222 1:109895192-109895214 CTGGGGAGTGAGTAGGAGGTAGG - Intergenic
915368068 1:155326438-155326460 GAGAGGAGGAAGGATGTGGTGGG - Intronic
915864194 1:159480614-159480636 CAGGAGAGTCAGGAAGTGGTGGG + Intergenic
916652079 1:166842094-166842116 ATTGGGAAGAAGGATGTGGTGGG - Intronic
917567762 1:176230210-176230232 CTGGGGAGTCAGTAGGTGTTGGG - Intergenic
917711527 1:177689776-177689798 GTGGGGACAAAGGATGTTGTGGG - Intergenic
918437536 1:184531874-184531896 ATTGGGAGTAACCATGTGGTCGG - Intronic
919861265 1:201740567-201740589 CTGGGGTGAAAGGAGGTGGTGGG + Intronic
920055116 1:203185668-203185690 CTGGGGAATAAGGATGAAATGGG + Intronic
921159600 1:212463696-212463718 CTGGGGAGGAAGGAGGTGTGAGG + Intergenic
922255635 1:223890738-223890760 GTGGGGAGAAGGGATGTGGGGGG - Intergenic
922900146 1:229130247-229130269 CAGAGGACTCAGGATGTGGTTGG + Intergenic
922980485 1:229822106-229822128 ATTGGTAGTATGGATGTGGTTGG + Intergenic
923122793 1:231009112-231009134 CTGGGAAGTTAGAAGGTGGTGGG + Intergenic
923334915 1:232959906-232959928 TGGGGAAGTAAGGATGTGGCTGG + Intronic
924118885 1:240776439-240776461 GTGGGGAGGAAGGATTTGGGAGG - Intronic
924840684 1:247707178-247707200 CTGGGGAGGAGGCATGTGGGTGG - Intergenic
924909891 1:248498576-248498598 CTGAGAAACAAGGATGTGGTGGG + Intergenic
924914210 1:248549483-248549505 CTGAGAAACAAGGATGTGGTGGG - Intergenic
1065276573 10:24092188-24092210 CAGGGAAGCAGGGATGTGGTTGG - Intronic
1070676610 10:78416130-78416152 CTGGGGAGTAAGGTTGGGAGGGG - Intergenic
1071412834 10:85413645-85413667 GTGGAGAGTGAGGAGGTGGTTGG - Intergenic
1072530433 10:96313759-96313781 CTGGGGAGTACAGATGGGATGGG - Intronic
1073338391 10:102727621-102727643 CAGGGGAGGAAGGAAGAGGTAGG - Intronic
1073974535 10:109085949-109085971 CTGTGGATTGAGGATGTGGCAGG + Intergenic
1074456955 10:113603612-113603634 CTGCGGAGTAAGGACGAGGGTGG - Intronic
1074496021 10:113980791-113980813 CTGGAGAGAAAGGATCTGGAGGG - Intergenic
1075615131 10:123885201-123885223 CTGGGGACTCAGGGTGGGGTTGG + Intronic
1075736302 10:124666632-124666654 CTGGGGAGATGGGAGGTGGTGGG - Intronic
1075889186 10:125930865-125930887 CTTGGGGGTAAGGGTGTGGAGGG - Intronic
1076747934 10:132523674-132523696 CTAGTGAGAAAGGATGTGATGGG - Intergenic
1076824838 10:132961667-132961689 CAGGGGAGCCAGCATGTGGTAGG - Intergenic
1076893849 10:133299112-133299134 ATGGGGAGTCAGGATTGGGTAGG + Intronic
1077282034 11:1750192-1750214 CGTGAGAGTGAGGATGTGGTGGG - Intronic
1077517594 11:3011110-3011132 CTGAGGACTTAGGATGTGCTGGG - Intronic
1078551743 11:12285948-12285970 CTGGAGAGAAAGGATGGGGACGG - Intronic
1078699825 11:13669213-13669235 CTGGGGAGGAAGAAAGTGGTGGG + Intronic
1079441588 11:20520271-20520293 CTGGGGAGGGAGGATGCGGTGGG + Intergenic
1079573001 11:21967878-21967900 CTGGCCAGTAAGGATGTGTGGGG - Intergenic
1080783794 11:35455932-35455954 CTGGGGAATAAGTAAGTGGAAGG - Intronic
1080958937 11:37135197-37135219 CTGGGGGTTAAGAGTGTGGTTGG - Intergenic
1081718838 11:45271502-45271524 CTGGAGAGGAAGGCTGGGGTTGG + Intronic
1083213896 11:61206645-61206667 CTGGGGAGTGAGAGTGGGGTAGG - Intronic
1083216780 11:61225474-61225496 CTGGGGAGTGAGAGTGGGGTAGG - Intronic
1083219662 11:61244300-61244322 CTGGGGAGTGAGAGTGGGGTAGG - Intronic
1084572238 11:69966639-69966661 CTGGCAGGTAAGGATGGGGTTGG + Intergenic
1089460159 11:118648340-118648362 GTGGGTTGTAAGGATGTGGCAGG + Intronic
1090487705 11:127128882-127128904 CTGGGGGCTCAGGATCTGGTTGG - Intergenic
1090665794 11:128914255-128914277 CTGGGGAGTGAGGATGGCCTTGG - Intronic
1091774735 12:3177026-3177048 CGGGGGAGTGGGGAGGTGGTGGG + Intronic
1092046557 12:5435010-5435032 CTGGGGAGGAAGGAGGGGGGAGG - Intronic
1095240271 12:39850111-39850133 CTGAGGAGAAAGGAGTTGGTTGG - Intronic
1095624830 12:44302394-44302416 CTGGGGAATAAGTATGCTGTGGG - Intronic
1096107237 12:49003516-49003538 CTGGGAGGTAGGGAAGTGGTGGG - Intronic
1096504603 12:52084823-52084845 CTTGGGGGTAAGTCTGTGGTGGG + Intergenic
1097058019 12:56261973-56261995 ATGAGGAGTAAGGATCTGGTTGG - Intergenic
1097335843 12:58382519-58382541 CTGGTGAGAAATGATGGGGTAGG + Intergenic
1102010792 12:109617203-109617225 CTGGGAAGAAGGGCTGTGGTAGG - Intergenic
1102237671 12:111304308-111304330 CAGTGGGGTAAGGATGGGGTTGG + Exonic
1102617094 12:114164183-114164205 CTGGGCACTAAGGTGGTGGTAGG - Intergenic
1103299511 12:119917461-119917483 CTGGAGAGAAAGGATCTGCTAGG - Intergenic
1106650016 13:31680072-31680094 TTTGGGAGTGGGGATGTGGTAGG - Intergenic
1107461700 13:40610136-40610158 CTGAGGAGTGAGGGTGTGGCAGG - Intronic
1108264766 13:48695584-48695606 CCGGGGATTAAGAATGTGGTGGG - Intronic
1110832564 13:80047926-80047948 CAGAGGTGTAAGGATGTGGTAGG + Intergenic
1112901725 13:104365180-104365202 CAGGGGAGATAGGATGTGGCTGG - Intergenic
1112901999 13:104368284-104368306 GTGTGTAGTAAGGTTGTGGTGGG - Intergenic
1113317618 13:109199681-109199703 CTGGGGATTAAGGATGCTGCTGG - Intronic
1113346744 13:109485623-109485645 CTGAGCAGTTAGGATGTGCTGGG - Intergenic
1113775066 13:112939503-112939525 CTGGAGAGTATGTTTGTGGTTGG - Intronic
1115846642 14:37542995-37543017 CTGGGGAGTATGTGTGTGGGGGG - Intronic
1117423632 14:55573265-55573287 CTGGGGGGTTGGGGTGTGGTTGG - Intronic
1118134677 14:63010379-63010401 CTAGGGAGTGAGGCTGGGGTGGG - Intronic
1118385585 14:65253139-65253161 ATGTGGAATAAGAATGTGGTGGG + Intergenic
1119145900 14:72313752-72313774 CTGGGGAGTAAGGATGGAGAAGG + Intronic
1119481681 14:74962039-74962061 CCGGGAACTAAGGATGTGGTGGG - Intergenic
1120049683 14:79850664-79850686 CTGGGTACTAAGAATGTGTTTGG - Intronic
1120070700 14:80099181-80099203 CTGGGGTGTGCAGATGTGGTCGG - Intergenic
1120379293 14:83753884-83753906 CTCCAGAGTAAGCATGTGGTGGG - Intergenic
1121328176 14:93033937-93033959 CTGGGGACTGAGGATGGGGCAGG + Intronic
1121523122 14:94599838-94599860 GTGGAGAGTAGGGATGTGGAGGG + Intronic
1122284162 14:100640941-100640963 CTCTGGAGTCAGGATGTGGTGGG + Intergenic
1122976385 14:105172582-105172604 CTCAGGAGTTAGGATGGGGTGGG - Intergenic
1124231859 15:27952788-27952810 CTGGGGAGGGAGGCTGAGGTAGG - Intronic
1126195426 15:45925522-45925544 CTGGGGAGGGAGGATGATGTAGG - Intergenic
1126319335 15:47405297-47405319 CTGGTGGGGAAGGATTTGGTTGG + Intronic
1128280143 15:66387421-66387443 CTGCGGAGTAAGTATGGGGCGGG + Exonic
1129169958 15:73801600-73801622 TTGGGGAGTATGGAAGTGGTGGG + Intergenic
1129595756 15:76962861-76962883 CTGGGGAGTCAGTATGTGGGTGG - Intergenic
1129770652 15:78201343-78201365 CTGGGGGGCAAGGGTGAGGTGGG - Intronic
1130084833 15:80769024-80769046 CTGGGAAGTAGGCAGGTGGTAGG + Intergenic
1130088303 15:80797013-80797035 CTGGGGTGTAAGGATGAAGCTGG + Intronic
1132348298 15:101121665-101121687 CTGGGGAATAAAGATGTTCTTGG - Intergenic
1132351729 15:101143501-101143523 CTGGGGAGCAAGTGTGTGGATGG + Intergenic
1132829991 16:1923271-1923293 CTGGGGAGCAAGGCCGTGCTAGG + Intergenic
1136186247 16:28590557-28590579 TTGGGGAGTGAGGATGGGGGAGG - Intronic
1136296702 16:29308054-29308076 CTGGGGAGGACAGAGGTGGTGGG + Intergenic
1138657356 16:58499160-58499182 CTGGGCAGCAAGGATCTGGGTGG - Intronic
1139675021 16:68517659-68517681 CTGGGGAGGAAGGCGGTGGGTGG + Intergenic
1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139880000 16:70174572-70174594 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1140372514 16:74420955-74420977 CTGGGGAGGAAGGAGGAGGAAGG - Intronic
1141343810 16:83227420-83227442 CTGGGGAATAATGTTGTGATGGG + Intronic
1142058325 16:88014365-88014387 CTGGGGAGGACGGAGGTGGTGGG + Intronic
1142915369 17:3132175-3132197 AGAGGGAATAAGGATGTGGTGGG + Intergenic
1143482443 17:7235449-7235471 GTGGGGAGGAAGGATAGGGTGGG + Exonic
1145104785 17:20105870-20105892 CTGGGGATGGAGGCTGTGGTGGG + Intronic
1146639791 17:34531573-34531595 CTGGGGAGTAGGGCTGTGTAAGG - Intergenic
1146656187 17:34636565-34636587 CTGGGGAGTGAGGAGGTGACAGG + Intronic
1148856358 17:50581132-50581154 CAGGGGAGAAAGGATATGGAGGG + Intronic
1149644640 17:58231197-58231219 TTGAGGAGCAAGGATGTAGTGGG + Intronic
1151436846 17:74102957-74102979 GTGGGCAGGAAGGAGGTGGTAGG - Intergenic
1151686962 17:75653093-75653115 CTGCGGATTGAGGATGTGGCAGG - Intronic
1153606688 18:6840720-6840742 ATGGGGACTAAGGAAGTGGGTGG + Intronic
1154299962 18:13184341-13184363 CTGGGGAGAAAGGCTGTGGCTGG + Intergenic
1155085475 18:22453911-22453933 CTGGGGAGTCAGGATTTAGGGGG + Intergenic
1155271754 18:24148502-24148524 GTGGGGAGGGAGGATGTGTTGGG + Intronic
1156814380 18:41291948-41291970 GTGGGGAGTTAGGACGGGGTCGG + Intergenic
1157282789 18:46357213-46357235 CTGGGTAGCAAGGGTGAGGTGGG - Intronic
1157493298 18:48138577-48138599 CTGGGCAGCCAGGATGTGGTGGG + Intronic
1157530774 18:48418812-48418834 CTGGGGTGGAAGGAGGTGGATGG - Intergenic
1157684560 18:49631870-49631892 GTGGGGATTATGGATGAGGTGGG - Intergenic
1159794945 18:72830596-72830618 GTGTGGAGGTAGGATGTGGTGGG + Intronic
1163035770 19:14567974-14567996 CTGGGGAGGAGGGATGTGGGAGG - Intronic
1163518668 19:17779522-17779544 CGGAGGAGTAAGGATGGGGAAGG + Intronic
1164061486 19:21679301-21679323 CGGGGGAGTGAGGATGAGCTGGG - Intergenic
1164064780 19:21706470-21706492 CAGGGGAGTGAGGATGAGCTGGG + Intergenic
1165098238 19:33422064-33422086 CAGGGGAGTAAGGGGGAGGTGGG - Intronic
1165788759 19:38478215-38478237 GTGGGGAGTCAGGATGGGGGTGG - Intronic
1166523278 19:43495418-43495440 CTGGGGTGCAGGGAGGTGGTGGG + Intronic
1167791760 19:51687938-51687960 CTGGGGAGAGAGGAAGGGGTGGG - Intergenic
1168277924 19:55287323-55287345 CTGGAGAGGGAGGATGGGGTAGG - Intronic
1168539242 19:57196773-57196795 CTGGGGAAGAGGGATGTGGATGG - Intronic
925746603 2:7048984-7049006 CCGGGGGCTCAGGATGTGGTGGG + Intronic
925771327 2:7285449-7285471 CTGGGTAGAAAGGATGTTGATGG + Intergenic
925889854 2:8424938-8424960 GTGGGGAGGAAGGAAGTGGAGGG - Intergenic
928731085 2:34233695-34233717 CTGGGGATTAAGGGAGTGTTTGG - Intergenic
929314832 2:40464670-40464692 CTGAGAAGTGGGGATGTGGTGGG + Intronic
931401244 2:61933386-61933408 GTGGGGGGTAAGGACGTGGCAGG + Intronic
932084373 2:68745328-68745350 CTGGGCACATAGGATGTGGTGGG - Intronic
932091225 2:68808093-68808115 GTGGGGAGGAAGGGGGTGGTGGG - Intronic
932631092 2:73344122-73344144 CTGGGGAGTGAGGATGAGGTGGG + Intergenic
933429436 2:82156777-82156799 ATGGGGAGCAGGGATGGGGTGGG - Intergenic
935544531 2:104386880-104386902 CTGGGCAGTGAGGAGGTGGCTGG - Intergenic
935648120 2:105358541-105358563 CTGGGGAGTGGGGATGGGATAGG + Intronic
936147171 2:109987680-109987702 CTGGGAAGGAAGGAGGTGCTTGG + Intergenic
936197521 2:110383803-110383825 CTGGGAAGGAAGGAGGTGCTTGG - Intergenic
937887221 2:126908150-126908172 ATGGGGAGGACGAATGTGGTGGG + Intergenic
938984514 2:136561156-136561178 CTGTGGGGTAAGGATGGGGAGGG - Intergenic
940227048 2:151410572-151410594 GTGGGGAGAAAGAAGGTGGTTGG + Intronic
940416840 2:153432712-153432734 CTGGGGGGTGGGGAGGTGGTTGG + Intergenic
940655924 2:156487730-156487752 CTGGAGAGTAAGTCTGAGGTTGG - Intronic
944542752 2:200769184-200769206 CGTGGGAGTAAGGATGGGGATGG - Intergenic
944566643 2:200998183-200998205 CTGGAGAGGAAGGATGAGGGTGG - Intronic
946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG + Intronic
946348027 2:219126959-219126981 GTGGAGAGTATGGATGGGGTTGG + Intronic
1168925269 20:1574159-1574181 CTGAGGAGTGAGGATTTGCTGGG + Intronic
1168929147 20:1607187-1607209 CTGAGGAGTGAGGATTTGCTGGG + Intronic
1168936959 20:1673844-1673866 CTGAGGAGTGAGGATTTGCTGGG + Intergenic
1169469550 20:5871975-5871997 CTGTGGAGTAGGGGAGTGGTTGG - Intergenic
1169659430 20:7961967-7961989 CTGGGCAGTGGGCATGTGGTGGG - Intergenic
1170387884 20:15840288-15840310 ATGGGAAGTGAAGATGTGGTGGG - Intronic
1170786126 20:19469185-19469207 CTGGGGATGAAGGATGTGCATGG + Intronic
1171035689 20:21710682-21710704 CTGGGGAGTGGGGGTGGGGTGGG + Intronic
1171167409 20:22984177-22984199 CTGAGGAGGAAGGATGTAGGGGG - Intergenic
1171459568 20:25291124-25291146 GTGAGGAGCAAGGATGTGGGCGG - Intronic
1171484578 20:25477641-25477663 AAGGGGAGCAAGGAAGTGGTTGG + Intronic
1173328586 20:42055539-42055561 CTGGGGGCAAGGGATGTGGTTGG + Intergenic
1173790934 20:45827357-45827379 CTGGGGAGCAGGGAGGTGGGAGG - Intronic
1175834513 20:61984970-61984992 AGGGGGAGGACGGATGTGGTGGG + Intronic
1178050805 21:28745315-28745337 CTGGGGAGTAAGTATGTGAAAGG - Intergenic
1178633206 21:34280454-34280476 TTGGGGAGTAAGGCTGGGGTGGG + Intergenic
1179551449 21:42146435-42146457 CTGGGGAGGAAGGCTGTGGTGGG + Intergenic
1179551464 21:42146489-42146511 TTGGGGAGGAGGGCTGTGGTGGG + Intergenic
1179551479 21:42146543-42146565 TTGGGGAGGAGGGCTGTGGTGGG + Intergenic
1179551495 21:42146597-42146619 CTGGGGAGGAGGGCTGAGGTTGG + Intergenic
1179551530 21:42146705-42146727 CTGGGGAGGAGGGCTGTGGTGGG + Intergenic
1179712021 21:43268925-43268947 CTGGGCAGGATGGATGTGGGTGG - Intergenic
1180015837 21:45083065-45083087 GTGGGGAGGAAGGTAGTGGTGGG - Intronic
1181035596 22:20168452-20168474 CTGGGGCTTAGGGAAGTGGTGGG - Intergenic
1181258769 22:21582321-21582343 CTGGGTGGTATGAATGTGGTGGG + Intronic
1182320490 22:29475758-29475780 CTGGGGGTTAAGGCTGTGGGTGG + Intergenic
1182511313 22:30822378-30822400 CTGGGGCGGGAGGAAGTGGTAGG + Intronic
1182667483 22:31970449-31970471 CTGGGGATTAAGAGGGTGGTGGG + Intergenic
1183694562 22:39414313-39414335 CTGGGAGGGAAGGATGTGGCAGG + Intronic
1183718722 22:39549784-39549806 GTGGGGAGTAAGGATGGGGTAGG - Intergenic
1184691406 22:46119048-46119070 CTGGGGGGTCTGGGTGTGGTGGG + Intergenic
1184821943 22:46915955-46915977 CTTGGAAAGAAGGATGTGGTGGG + Intronic
1184876041 22:47276241-47276263 CTGGGCACTGAGGGTGTGGTTGG - Intergenic
950892002 3:16412536-16412558 GTGGGGAGTGAGGTGGTGGTGGG + Intronic
951449265 3:22818490-22818512 CTGGGGTGGAATGATATGGTTGG - Intergenic
951816005 3:26755655-26755677 TTGGGGAATTAGGATGAGGTGGG + Intergenic
952333930 3:32388921-32388943 GTGGGGAGTGAGGGTGGGGTTGG + Intergenic
952341860 3:32454004-32454026 CTGAGGAGTAAGACTGAGGTCGG + Intronic
953473148 3:43183787-43183809 CTGGGAAGAAAGGATCTGCTTGG - Intergenic
954458032 3:50610583-50610605 CTGGGGTGGAAGGCAGTGGTGGG + Intronic
956037213 3:65107064-65107086 CTGGGGAGAAGGGTAGTGGTAGG + Intergenic
956046091 3:65197471-65197493 CTGGGGAGTCAGGTTGGGGGTGG + Intergenic
956127768 3:66027413-66027435 CTAGGGAGGGAGGCTGTGGTGGG - Intronic
956803429 3:72785030-72785052 CAGGGGAGGAAGAATGTGATTGG - Intronic
959817539 3:110692575-110692597 CTGGGGGTTGAGGTTGTGGTGGG - Intergenic
960506372 3:118499795-118499817 CTGGGGAGGAAGGCTGGGGAAGG - Intergenic
960854160 3:122085947-122085969 CTGTGGAGGAAGGATTAGGTCGG - Intronic
961137634 3:124526624-124526646 AGGAGGAGTAAGGATGTGGAGGG + Intronic
961733775 3:128987420-128987442 TAGGGGAGTGAGGGTGTGGTGGG - Intronic
962074970 3:132072026-132072048 TTGGGGAGTAAGGATGAAGACGG - Intronic
962611593 3:137081748-137081770 CTGGGGAATGAGAATGTGGTGGG + Intergenic
963038085 3:141049741-141049763 GTGGGGGTTATGGATGTGGTTGG - Intergenic
964040803 3:152259229-152259251 CATGGGAGTAAGTATGTGGGTGG + Intronic
965614386 3:170578083-170578105 CTGAACAGTAAAGATGTGGTGGG + Intronic
966338838 3:178902624-178902646 CTGGGCAGTAAGCCTGTGGAGGG - Intergenic
966830439 3:184003364-184003386 CTGGGGAGTAAGGATGTGGTGGG - Intronic
967385465 3:188906595-188906617 CTGTGAACTACGGATGTGGTGGG - Intergenic
968335074 3:197906759-197906781 CTGGGGTGTGAGGGTGTGGGGGG - Intronic
968440952 4:624155-624177 CGGGGGAGTGGGGATGTGGGTGG - Intergenic
968530029 4:1086724-1086746 TTGGGGAGAGAGGATGGGGTAGG + Intronic
970484182 4:16507775-16507797 CTGGGGAGTTAGGAGATGGGAGG + Intronic
971581891 4:28352106-28352128 ATGGGCACTAAGGATGAGGTTGG - Intergenic
971774218 4:30940066-30940088 TTGAAGAGTAATGATGTGGTAGG + Intronic
972369950 4:38413746-38413768 CTGGGGAGGAAGGAGGAAGTTGG - Intergenic
972806004 4:42529959-42529981 CTGGGGAAGAAGTATGTGGATGG + Intronic
975461807 4:74662256-74662278 CTGGGAAGTTAGGATAGGGTGGG - Intergenic
975475873 4:74822744-74822766 CTGGGGAGAGAGAGTGTGGTTGG + Intergenic
978257268 4:106707908-106707930 ATGATGAGGAAGGATGTGGTGGG + Intergenic
979240293 4:118441701-118441723 GTGGGGAGAAGGGATGTGGGGGG + Intergenic
980213851 4:129825421-129825443 CTGAGGAGTTAGGATCTGGAGGG + Intergenic
981514066 4:145588072-145588094 CTGGGGATTGAGGCTGTTGTTGG - Intergenic
982840434 4:160177510-160177532 CTGTGGTCTAAGAATGTGGTTGG - Intergenic
982856724 4:160392173-160392195 CTGGGAGATAAGGATGTGGAAGG + Intergenic
983053916 4:163080007-163080029 CTGGAGAGTAAGGATAGGGAAGG - Intergenic
986781968 5:11074953-11074975 CTGGGGGTTAAGGAGGTGGGGGG - Intronic
987293974 5:16533947-16533969 CTGGTGAGAATGCATGTGGTTGG + Intronic
987367087 5:17158504-17158526 CTGGCTAGGAAGGATGTGGAGGG - Intronic
989170396 5:38467037-38467059 CTAGGGAGGAAGGATGGAGTGGG + Intergenic
990048637 5:51467080-51467102 CTGGGGATTAAAGAAGAGGTGGG + Intergenic
990122476 5:52471919-52471941 CTGGGGAGTAAGGAGGGGTCAGG - Intergenic
990994698 5:61719853-61719875 CTGGGGAGTCTGGGTGTGATGGG + Intronic
991618090 5:68517609-68517631 TTGAGGAGAAAGGATGGGGTGGG + Intergenic
994182490 5:96782818-96782840 CTGGGGAGTTAGGATGGTATGGG - Intronic
995060341 5:107806387-107806409 TTGGGGAGGAGGGATGAGGTGGG - Intergenic
997629312 5:135354686-135354708 CTGGGGAGTAGGGGTGTGGGTGG + Intronic
998393001 5:141799702-141799724 TTGTGGAGTAGGGCTGTGGTTGG - Intergenic
1001236505 5:170034342-170034364 CTGGGGAGAAAGACTGTGCTGGG - Intronic
1001552170 5:172610994-172611016 TTGGGGAGAAAGGATGGGTTTGG + Intergenic
1002740544 5:181432284-181432306 GTGGGGAGAAGGGATGTGGGGGG + Intergenic
1002910748 6:1489276-1489298 CTGGGGAGTAAGGATGAGAGGGG - Intergenic
1003269154 6:4591976-4591998 CTGGGGAGTGGGGATGAAGTTGG - Intergenic
1003576100 6:7296741-7296763 GAGGGAAATAAGGATGTGGTAGG + Intronic
1004095184 6:12547206-12547228 CTGGAGAGGAAGCATATGGTGGG + Intergenic
1004956129 6:20729977-20729999 CTCTGGAGGAAGGAGGTGGTTGG + Intronic
1005413115 6:25571884-25571906 GTGGGGAGGGAGGATGTGCTAGG + Intronic
1005512264 6:26521676-26521698 ACGGGGAGTAAGGATGAGGTGGG - Intergenic
1006581263 6:35079072-35079094 CTGGGGAGCCAGGAGCTGGTGGG + Intronic
1006913131 6:37577198-37577220 CTGTGGAGTCAGGCTGAGGTTGG - Intergenic
1007736465 6:43985220-43985242 ATGGGGAGCAAGCATGGGGTGGG - Intergenic
1008502867 6:52200770-52200792 GTGGGAAGTCAGGATGTTGTGGG - Intergenic
1010866642 6:80983742-80983764 TTAGGGAGTATGTATGTGGTTGG - Intergenic
1013091963 6:106908260-106908282 TTGGGGAGGAGGGATGGGGTAGG - Intergenic
1013391100 6:109687272-109687294 CTGGGGAAGAAGCATGTGATTGG + Intronic
1015206773 6:130649531-130649553 CTGAGGAGTAGGGTTATGGTGGG - Intergenic
1016914076 6:149228494-149228516 CTGGGGAGCCAGGAGATGGTGGG - Intronic
1017033979 6:150250822-150250844 GTGGGGAGGAAGTGTGTGGTGGG - Intergenic
1017515798 6:155154736-155154758 CTGGGGAGGGAGGAGGTGGTTGG + Intronic
1018972006 6:168536412-168536434 CTGGCGGATAAGGAGGTGGTTGG + Intronic
1019056004 6:169223994-169224016 GTGGGGAGTGGGGATGAGGTGGG + Intronic
1019245653 6:170707881-170707903 GTGGGGAGAAGGGATGTGGGGGG + Intergenic
1019774289 7:2903216-2903238 CTAGGGACCAAGGAAGTGGTTGG - Intergenic
1020787116 7:12587348-12587370 GTGGGGAGTGAGGATGAGGATGG + Intronic
1021187795 7:17585649-17585671 CTGGAGAGTGGGAATGTGGTTGG + Intergenic
1022331427 7:29382940-29382962 CTGAGGGGTGAGGATGTCGTGGG + Intronic
1022503740 7:30897845-30897867 CTGGGGAGTCTGGGGGTGGTGGG + Intergenic
1022797304 7:33742393-33742415 CTGGAGAGTAAGGGGGAGGTGGG + Intergenic
1023257539 7:38326923-38326945 CTGGGGGTTAAGGATGGGTTAGG + Intergenic
1024149657 7:46558079-46558101 CAGGAGAGTGAGGATGTAGTTGG + Intergenic
1024528156 7:50366981-50367003 ATGGAGAGTAAGGATTTGCTAGG + Intronic
1024832032 7:53472321-53472343 CTGGTGAGAAAGGATGTGGACGG - Intergenic
1025944029 7:66092745-66092767 CTGGGGAGAGAGGAAGAGGTGGG - Intronic
1026914501 7:74111864-74111886 CTGGGGAGCCAGGATGGGCTGGG + Intronic
1027435381 7:78159037-78159059 ATGGGGAGTGCTGATGTGGTTGG - Intronic
1027532778 7:79355250-79355272 CTGGGGAGCAAGGCTATGATGGG + Intronic
1028161642 7:87492592-87492614 CTGTGGAGTAAGCATGAGGCCGG - Intergenic
1028651683 7:93156993-93157015 CTGGAGTGTAGGGATGGGGTGGG + Intergenic
1029550345 7:101234117-101234139 CTGGGGAGTACAGATGAGGCAGG + Intronic
1030740715 7:113106267-113106289 GTGGGGAGAAGGGATGTGGATGG - Intergenic
1032435708 7:131898664-131898686 CTGGGAAGTGAGGATCTGGGAGG - Intergenic
1032699132 7:134363471-134363493 GTGAGGAGAAAGGAAGTGGTAGG + Intergenic
1033074294 7:138234149-138234171 CTTGGGAGGAAGGCTGAGGTGGG + Intergenic
1034890161 7:154832616-154832638 CTGGGGTGTGCGGATGTGGGAGG - Intronic
1035268320 7:157704578-157704600 GTGGGGAGCCAGGAGGTGGTAGG - Intronic
1035502470 8:100317-100339 GTGGGGAGAAGGGATGTGGGGGG - Intergenic
1037454210 8:19047494-19047516 CTGGGAGGTAAGAATGTGGAGGG + Intronic
1037881312 8:22574803-22574825 CTGGGGAAGGAGGATGTGGGCGG - Exonic
1038647162 8:29371498-29371520 CAGGAGGGGAAGGATGTGGTGGG + Intergenic
1040744901 8:50630426-50630448 CTGTGGAGAAAAGATTTGGTTGG - Intronic
1040859434 8:51984009-51984031 CTGGAGAGAAAGGAAGTTGTGGG - Intergenic
1043372267 8:79609133-79609155 CTGAGGGGAAAGGGTGTGGTGGG + Intergenic
1043524460 8:81081584-81081606 CTAGGAGTTAAGGATGTGGTAGG - Intronic
1044666683 8:94640245-94640267 CTGGGGAGTGACTAGGTGGTTGG + Intergenic
1044694976 8:94913748-94913770 CTGGAGTGCAAGGATGTGATGGG - Intronic
1044872682 8:96635145-96635167 CTTGGGAGAAAGGCTGAGGTAGG - Intergenic
1045536665 8:103035579-103035601 CTTGGGAGGTAGGATGGGGTGGG + Intronic
1048360053 8:133689884-133689906 CTGGGAAGAAAGAATGTGCTTGG + Intergenic
1050686998 9:8182955-8182977 CAGGTGAGTTAGGAGGTGGTGGG - Intergenic
1052417904 9:28201759-28201781 GAGGGGAGAAAGGATGTGGGGGG - Intronic
1055238801 9:74158541-74158563 CTGAGGAGTGAGGACGTGGAGGG + Intergenic
1055318837 9:75061999-75062021 CTGTGTAATAAGAATGTGGTAGG - Intronic
1056093935 9:83231974-83231996 CTGGGGAGTAAGATTATGGGTGG + Intergenic
1057192865 9:93096988-93097010 CTGGGGAGGAAGGCTGGGCTGGG - Intronic
1057530696 9:95843076-95843098 CCAGGGACTAAGGATGGGGTTGG - Intergenic
1058402067 9:104630943-104630965 CTGGGGAATATGGAGGTGCTTGG + Intergenic
1061243690 9:129390071-129390093 CCAGGGAGTAGGGATGAGGTGGG - Intergenic
1061708119 9:132468509-132468531 ATGGAGAGTAAGGAAGTGCTGGG - Intronic
1203605853 Un_KI270748v1:57092-57114 GTGGGGAGAAGGGATGTGGGGGG + Intergenic
1186420752 X:9424039-9424061 CTGGTGTGTAAGTATGTGTTTGG + Intergenic
1187864934 X:23715371-23715393 CTGGGGAATAGGGATGGGGGAGG - Intronic
1188123655 X:26339952-26339974 CTGGGGTGGGAGGATGGGGTAGG + Intergenic
1188654864 X:32680770-32680792 CTGGGGAGAAAGGTTGGGGTGGG - Intronic
1188852034 X:35143930-35143952 CTGGGGAAGAAGCATGTGGATGG - Intergenic
1192288066 X:69759806-69759828 CTGGGGAATAAGGATAAGGAAGG + Intronic
1193108877 X:77707219-77707241 TTGGGGAGTTAGTATGTGATGGG + Intronic
1197862848 X:130988453-130988475 CTGGGGAGTTGGGGTGTGGGAGG + Intergenic
1197890068 X:131261409-131261431 CTGGAGATTAAGACTGTGGTGGG + Intergenic
1198530548 X:137547018-137547040 CTGGGGACAGAGGAGGTGGTAGG + Intergenic
1199712044 X:150476565-150476587 ATGGGGAGGAGGGATGTGGATGG + Intronic