ID: 966830732

View in Genome Browser
Species Human (GRCh38)
Location 3:184006119-184006141
Sequence GCCCAGGTGGCTCTCATGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 205}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966830732_966830737 13 Left 966830732 3:184006119-184006141 CCAAGCATGAGAGCCACCTGGGC 0: 1
1: 0
2: 1
3: 13
4: 205
Right 966830737 3:184006155-184006177 CACACTGTTGTTACCTCAGCCGG 0: 1
1: 0
2: 1
3: 9
4: 146
966830732_966830739 24 Left 966830732 3:184006119-184006141 CCAAGCATGAGAGCCACCTGGGC 0: 1
1: 0
2: 1
3: 13
4: 205
Right 966830739 3:184006166-184006188 TACCTCAGCCGGAGATCTCTGGG 0: 1
1: 0
2: 0
3: 7
4: 99
966830732_966830738 23 Left 966830732 3:184006119-184006141 CCAAGCATGAGAGCCACCTGGGC 0: 1
1: 0
2: 1
3: 13
4: 205
Right 966830738 3:184006165-184006187 TTACCTCAGCCGGAGATCTCTGG 0: 1
1: 0
2: 0
3: 6
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966830732 Original CRISPR GCCCAGGTGGCTCTCATGCT TGG (reversed) Intronic
900146852 1:1162304-1162326 GCCCAGGTGGGTCTCAGGATCGG - Intergenic
900198156 1:1387915-1387937 GCCCAGGTGGCTGTCAGGGTTGG - Intronic
900985229 1:6069296-6069318 GCCCAGGTGGCTCCAATGAAAGG + Intronic
901323152 1:8351441-8351463 CCCCAGGTGGCTCTCAGTCCAGG - Intergenic
902219085 1:14953296-14953318 GCCCAGGTGGCAACCAGGCTTGG - Intronic
902743905 1:18460200-18460222 TCCCAGGGGGCTATGATGCTAGG - Intergenic
904364153 1:29999823-29999845 GCCCAGGTGGGCCTCATTCCTGG - Intergenic
904379651 1:30102141-30102163 CCCCTGGTCCCTCTCATGCTGGG + Intergenic
904598491 1:31661294-31661316 CCCCAGGAGGCTCTGATGCTGGG + Intronic
905404965 1:37726449-37726471 GCCCAGATGGGTCCCAGGCTGGG - Intronic
907648128 1:56264678-56264700 GCCCAGATGGCCCACAAGCTGGG - Intergenic
909399436 1:75210266-75210288 GCCCAGGCTGGTCTCAAGCTGGG + Intronic
913046837 1:115080814-115080836 ATCCAGCTGGCTCTCATCCTAGG + Intronic
914012450 1:143790246-143790268 GCCCCGACGGCTCTCATGGTAGG + Intergenic
914165382 1:145170937-145170959 GCCCCGACGGCTCTCATGGTAGG - Intergenic
914651079 1:149698856-149698878 GCCCCGACGGCTCTCATGGTAGG + Intergenic
914801164 1:150963707-150963729 GCCCAGGTTGCCTTCAAGCTTGG - Exonic
916358806 1:163943977-163943999 CCCCAGGTGGCTATCATGCATGG - Intergenic
916691685 1:167195842-167195864 GCCCAGGTGTCACTCCTTCTTGG + Intergenic
920796955 1:209148002-209148024 ACCCAGGGAGCTCTCATGCCAGG - Intergenic
923356090 1:233157237-233157259 ACCCATGTTGCTCTCATTCTGGG - Intronic
1062843999 10:690484-690506 GCCGAGGTGGCACTGAGGCTGGG - Intergenic
1066281242 10:33920195-33920217 GCCCAGGTGGCTCTTTATCTAGG - Intergenic
1068662114 10:59633212-59633234 GCCCAGGTTGCACTTTTGCTTGG - Intergenic
1069606007 10:69739170-69739192 GCCAGGGAGGATCTCATGCTAGG + Intergenic
1070001706 10:72383032-72383054 GCCCAGGCTGGTCTCATTCTTGG - Intronic
1070978198 10:80622620-80622642 GCCCTGGAGGGTCTCATGGTGGG + Intronic
1071312248 10:84353773-84353795 GCCCATGTTGATCTCATGGTGGG + Intronic
1072800318 10:98388294-98388316 GCCCAGTTGGGTCGCATGCCCGG + Intronic
1072968451 10:99995257-99995279 GCCCAGGTTGGTCTCTTCCTGGG + Intronic
1075162135 10:120033724-120033746 GCGGAGGTGGCTCTCATCTTGGG - Intergenic
1075954661 10:126512239-126512261 GCCCCTTTCGCTCTCATGCTTGG - Intronic
1075989838 10:126826192-126826214 GCTCAGGGGCCTCTCCTGCTTGG - Intergenic
1076902863 10:133348254-133348276 CCCCAGCTGGTTCTGATGCTGGG - Intronic
1077170477 11:1163800-1163822 GCCCTGGGGGCTCTGCTGCTCGG + Intronic
1077720724 11:4625895-4625917 ACCCAGGTGGCTCTAGTCCTGGG + Intergenic
1077756715 11:5037734-5037756 GCACATGTGGCTCTCATGTTGGG + Intergenic
1079291097 11:19188392-19188414 GCTCAGGGGCCCCTCATGCTGGG - Intronic
1080693444 11:34579776-34579798 GCTCAGGTGGCTATTCTGCTTGG + Intergenic
1081533777 11:43982916-43982938 GCCCAGGTCACTCTGAGGCTGGG + Intergenic
1083179417 11:60974595-60974617 GCCCAGGTGGCCCGGGTGCTGGG + Intronic
1083265957 11:61546924-61546946 GCCGAGGGGGCTCTCCTGCAAGG + Intronic
1083357753 11:62079786-62079808 GGCCAGGTTGCTGTCATCCTGGG - Intergenic
1083735488 11:64677889-64677911 GGCCAGCTGGCTATCAGGCTGGG + Intronic
1083757036 11:64797258-64797280 CCCCAGGTGAGTCTCAGGCTTGG - Exonic
1083788999 11:64971882-64971904 CCCCAGGTGGTTCCCAGGCTCGG + Exonic
1084563039 11:69914778-69914800 TCCCAGGTGGGTCTGATGCCAGG + Intergenic
1084760905 11:71270294-71270316 GCCCAGGTGGCCCACAGGGTAGG - Intergenic
1084904303 11:72334320-72334342 GCCCAGGAGGCTCTCAGGTCAGG + Intronic
1086451735 11:86924017-86924039 GCCCCGGTGCTTCTCAAGCTTGG + Intronic
1087777263 11:102268081-102268103 GCCCAGGTGGATGTCCTGGTCGG + Intergenic
1089631001 11:119784145-119784167 TCCCAGGTGGCTCACTTGCATGG - Intergenic
1090024283 11:123154377-123154399 GCCTAGGTGGCCTCCATGCTGGG - Intronic
1090364396 11:126193460-126193482 GCTCGGGTAGCTCTGATGCTGGG + Intergenic
1090747510 11:129719202-129719224 TCCCAGTTGGCTCTCATGAGTGG + Intergenic
1090972879 11:131657990-131658012 GGCCAGGTGGCACTTAAGCTGGG + Intronic
1091823771 12:3494218-3494240 GACCAGGTGGTCCTCATGTTTGG - Intronic
1093519374 12:20030264-20030286 GCCCAGGCTGGTCTCAAGCTGGG + Intergenic
1094061536 12:26319658-26319680 GCCCAGGAGGCTCTCCGGCCTGG + Intergenic
1101877720 12:108606648-108606670 GCCCATCTGGCTTCCATGCTGGG - Intergenic
1101988448 12:109465549-109465571 CACCAGGTGGATCTCAAGCTTGG - Intronic
1102230146 12:111256668-111256690 GCCCAGGTGCCTCTCACTCCAGG - Intronic
1104638526 12:130452605-130452627 GCCCAGGTGACTCTCGTGGCTGG - Intronic
1105213849 13:18273314-18273336 GTGCAGGGGGCTGTCATGCTAGG - Intergenic
1105363557 13:19743684-19743706 GCCCAGGTAGTTCTCATAATAGG + Intronic
1105804827 13:23946766-23946788 CCCCAGGTGGGTCCCATCCTGGG - Intergenic
1107636982 13:42402240-42402262 CTCCAGGTGACTCTCATGATGGG - Intergenic
1110561615 13:76915990-76916012 GCCCAGGCTGCTCTCAAACTAGG + Intergenic
1114255667 14:20999486-20999508 GCCCTGTTGGCTCTCACTCTGGG + Exonic
1117033916 14:51706667-51706689 GCCCAGGTGTCGCTCCTTCTGGG + Intronic
1117222638 14:53621104-53621126 GCCCAGCTGGCTGTGAGGCTGGG + Intergenic
1117829053 14:59732610-59732632 GCCCTGGTGGCCCTCATGAGGGG - Intronic
1119626215 14:76178647-76178669 ACCTAGGTCCCTCTCATGCTCGG + Intronic
1119758580 14:77135693-77135715 GCAAAGGTGGCCCTCAAGCTGGG + Intronic
1121566363 14:94912953-94912975 CCCCAGCTGACTCTCAGGCTGGG + Intergenic
1122713243 14:103676236-103676258 GTCCAGGTGGCTCACCTGTTTGG + Intronic
1122826847 14:104374698-104374720 GCCCAGGGGCCTCTCCTCCTGGG - Intergenic
1122931424 14:104934352-104934374 GCCCAGGTGGCTCCCAGGATAGG - Exonic
1125517290 15:40329107-40329129 GACCAGGTGGCTCCCATGCTGGG - Intergenic
1125882992 15:43209560-43209582 TACCAGGTGGCTCTAATGCTGGG - Intronic
1127007125 15:54583154-54583176 CTACAGGTGGCTCTCATGATAGG - Intronic
1129172781 15:73818074-73818096 GGCCAGGTGGCCTTCATCCTAGG + Intergenic
1131059237 15:89394389-89394411 GCTCAGGTGGCCCTCAAGGTGGG + Intergenic
1131494291 15:92891707-92891729 CCCCAGGTGGATCTGATGTTTGG - Intronic
1132590910 16:726109-726131 CCCCAGGTGGGTCCCAGGCTGGG + Intronic
1132854096 16:2037137-2037159 GCCCCTGTGGGTCTCATCCTGGG + Intronic
1132994212 16:2814668-2814690 GCCCAAGTGACTCTCCTTCTGGG - Intergenic
1133232431 16:4372938-4372960 GCCCTGGAGGCTCTCAGCCTGGG - Intronic
1139697047 16:68682447-68682469 GCCCTGGTTGCTCTCAGGGTGGG - Exonic
1139728156 16:68919184-68919206 GGGCTGGTGGCTGTCATGCTAGG + Exonic
1140690721 16:77480846-77480868 CCCCAGCTTGCTCTCATGGTTGG + Intergenic
1141154670 16:81588907-81588929 GCCCAACTGGCTCTCTAGCTGGG + Intronic
1143981748 17:10876079-10876101 GCCCAGGTGAGTCTTCTGCTTGG - Intergenic
1145823359 17:27857638-27857660 GCCCAGGTCACTCTGATGCCAGG + Intronic
1148525409 17:48328128-48328150 TCCCAGATGAATCTCATGCTCGG + Intronic
1148836709 17:50469393-50469415 GCCGGGGCGGCTCTCACGCTCGG - Intronic
1148862043 17:50609546-50609568 GCCCAGCTGGCTCCCCTTCTGGG + Intronic
1149713979 17:58769385-58769407 GCCCAGGTTGGTCTCAAACTTGG - Intronic
1151325448 17:73377118-73377140 GTCCAGTTGACTCTCATTCTTGG - Intronic
1151462023 17:74260135-74260157 AGGTAGGTGGCTCTCATGCTGGG - Exonic
1152608140 17:81303223-81303245 CCCGTGGTGGCTCCCATGCTAGG + Intergenic
1155154569 18:23147853-23147875 GCCCACGTGGGGCACATGCTGGG + Intronic
1158523113 18:58188321-58188343 TCCCAGGTGACGCTAATGCTGGG - Intronic
1159936410 18:74371632-74371654 AACCAGGTGGCTGTCATGGTGGG + Intergenic
1160430051 18:78804762-78804784 TCTCAGGGGGCTCCCATGCTGGG - Intergenic
1160828587 19:1092002-1092024 ACACAGGTGTCTCTCCTGCTCGG + Intronic
1160847119 19:1171539-1171561 TCCCAGGGGGCCCCCATGCTGGG - Intronic
1160952450 19:1674260-1674282 GCCCAGGAGGCTCTGATGTGAGG + Intergenic
1163366109 19:16876932-16876954 GCCCAGGTGGCTCCTCTGCTGGG - Intronic
1163844293 19:19629716-19629738 GCCCGAGTGGCCCTGATGCTTGG + Exonic
1164752247 19:30665620-30665642 GCCCAGGAGGGTCTGGTGCTGGG + Intronic
1165078102 19:33291843-33291865 GCCTGGGTGGCTCTCCTGCAGGG + Intergenic
1165094715 19:33403817-33403839 CCTCAGGTGACTCTCAGGCTGGG + Intronic
1165490427 19:36120240-36120262 GCCCAGCTGGGCCTCATGCTGGG - Intronic
1165733884 19:38163783-38163805 GCCCATGGGGCTTTGATGCTTGG - Intronic
1166694374 19:44844527-44844549 GCCTAGGTGGTCCTCTTGCTAGG + Intergenic
1166861412 19:45813749-45813771 ACCCAGGATGCTCTCATTCTAGG - Intronic
1168313799 19:55474967-55474989 GCCCAGCTGGCTGCCAGGCTAGG - Intergenic
1168642844 19:58041284-58041306 GCCCATGTGGCTGTCAGGCCGGG + Intronic
925904056 2:8528803-8528825 GCCCAGGTGGCTGTCATCCCAGG - Intergenic
934300477 2:91773435-91773457 GTGCAGGGGGCTGTCATGCTAGG + Intergenic
934873273 2:97887523-97887545 GCCCGGGGGTCTCTCCTGCTTGG + Intronic
934976743 2:98808287-98808309 GCCCAGGTGGTTCTAATGTGTGG - Intronic
935805708 2:106745710-106745732 GCCCAGGTTGCTGGCAGGCTAGG + Intergenic
935868573 2:107419541-107419563 GAGCAGGGGGCTCTCATGATGGG - Intergenic
936035799 2:109110197-109110219 GCCCCGGTGTCTATCCTGCTGGG + Intergenic
936484868 2:112917243-112917265 GCCCAGGTGACTCTCAGTTTTGG + Exonic
937201355 2:120206360-120206382 GCCCAGCTGACACTCAGGCTCGG + Intergenic
939425827 2:142035331-142035353 GCACAGGTGGTTCTCAAACTTGG + Intronic
940237162 2:151524273-151524295 GCACTGGTGGCTCTCATGTGAGG - Intronic
942858485 2:180581399-180581421 CCTCAGGTGGCTCTCATGCCAGG + Intergenic
943913016 2:193592517-193592539 GCTCAGCTGGCACTCATGCATGG + Intergenic
944856755 2:203775514-203775536 CCCCAGGTGGCTCTCCTGTATGG + Intergenic
947026856 2:225745750-225745772 CCCCAGGTGAATCTAATGCTGGG - Intergenic
947181144 2:227412408-227412430 GCTCAGGGGGCTCACATTCTAGG - Intergenic
948321626 2:237074283-237074305 GAACAGGTGTCTCTCATGGTGGG - Intergenic
948950713 2:241249490-241249512 TCCCAGGTGGTTCTCATGTAAGG - Intronic
1169598270 20:7226116-7226138 CCCCAGGTGGCACTTATGGTGGG + Intergenic
1175409665 20:58758559-58758581 GCCCAACTGGCTCCCATACTTGG + Intergenic
1176220506 20:63967343-63967365 GCCATGGTGGGGCTCATGCTGGG - Intronic
1178409762 21:32353414-32353436 GGCCAGGTGGCTCTTCTGGTTGG - Intronic
1179933262 21:44586071-44586093 GCCCAGGAGGCTCCCAGCCTGGG - Intronic
1180951216 22:19721443-19721465 GCCCATGTGGCTCACATTCCAGG - Intronic
1180967816 22:19799680-19799702 GCCCACGTGGCTCTCAGCCAAGG + Intronic
1181698833 22:24608568-24608590 GTGCAGGGGGCTGTCATGCTAGG + Intronic
1183293769 22:37018466-37018488 GCCCAGGCGGCCCACATACTCGG + Exonic
1183467942 22:37989470-37989492 GACCAGGTGGCATTCCTGCTTGG + Intronic
1184267344 22:43356107-43356129 GCCCAGGTGGGTAGCATCCTTGG - Intergenic
1184530391 22:45051676-45051698 GCCCAGGTGAGTCACGTGCTGGG - Intergenic
1185094261 22:48797659-48797681 GCCCAAGTGTGTCTCATCCTGGG - Intronic
952258353 3:31714729-31714751 GGCCAGGTGGCTCTCTAGATGGG - Intronic
952776508 3:37051776-37051798 GCCCAGGTGGGGCACAGGCTGGG + Intergenic
955372378 3:58364074-58364096 GACCAAGTGGGTCTCATTCTAGG - Intronic
956772412 3:72537723-72537745 CTCCAGGTGACTCTGATGCTTGG - Intergenic
956958540 3:74370880-74370902 GCTCAGAAGGGTCTCATGCTTGG + Intronic
959110316 3:102115179-102115201 GTCCATGTTGCTCTCATGCCTGG - Intronic
960517260 3:118616142-118616164 CACCAGGCAGCTCTCATGCTGGG - Intergenic
961371449 3:126434237-126434259 GCCCAGGTTGGCCTCCTGCTGGG - Exonic
966055895 3:175688825-175688847 GCCCAGGTGCCTCCCTTTCTAGG - Intronic
966830732 3:184006119-184006141 GCCCAGGTGGCTCTCATGCTTGG - Intronic
967989187 3:195118728-195118750 GCCCAGGTCTCTCTAATTCTGGG - Intronic
969670921 4:8589862-8589884 GCCCATGTGGCTCCCACACTGGG + Intronic
971052383 4:22875787-22875809 GCCCAGTTGGCCCTTATGGTTGG + Intergenic
975498041 4:75055994-75056016 TCCCAGGTGGTGCTAATGCTGGG + Intergenic
976261946 4:83154215-83154237 GCCCAGGCTGCTCTCAAACTCGG - Intergenic
978410152 4:108417021-108417043 GGCCAGGAGGCACTAATGCTGGG + Intergenic
980169603 4:129273301-129273323 CTCCAGGTGTCTCTCATTCTGGG + Intergenic
982726645 4:158913429-158913451 GCCCAGGCTGCTCTCAAACTTGG + Intronic
984698189 4:182799909-182799931 GCCCAGGTCGCTCTCGGGCGTGG - Exonic
990275104 5:54187256-54187278 ACCTTGCTGGCTCTCATGCTGGG + Intronic
992695129 5:79278541-79278563 GCCCAGGCTGGTCTCAAGCTCGG - Intronic
993786210 5:92140605-92140627 TCCTAGGAAGCTCTCATGCTTGG - Intergenic
999398237 5:151244435-151244457 GCCCACGTGGCTCTGGTCCTTGG - Intronic
1000054000 5:157587722-157587744 GCCCAGGTTGGTCTCAAACTTGG + Intergenic
1001532934 5:172477454-172477476 ACCTTGGTGGCTGTCATGCTTGG - Intergenic
1004099482 6:12594206-12594228 GCCCACGTGGCCCTCTTGCAAGG - Intergenic
1004375380 6:15086548-15086570 GCCCAAGTGGCTCAAAGGCTGGG + Intergenic
1008845953 6:55964341-55964363 GCGCAGGTGGCTCTCAGCATGGG + Intergenic
1010157468 6:72811698-72811720 TTCCAGGTGTCTCTCATTCTTGG + Intronic
1010927658 6:81763433-81763455 ACCCAGGTTGCTCTCCTTCTAGG + Intergenic
1015633314 6:135252502-135252524 GTCCAGGTGGCTCTGATGTGTGG - Intergenic
1018895410 6:168013201-168013223 GCTCAGGTGCCTCTCCTGCTTGG + Intronic
1019106083 6:169668057-169668079 GCCCAGGTGGCCCTGCAGCTCGG + Exonic
1019330506 7:458428-458450 GCCCAGGGGACCCCCATGCTCGG - Intergenic
1019736678 7:2653301-2653323 GCCCAGGTGGGTCTCAGGGCTGG + Intronic
1020697032 7:11425176-11425198 GCCCAGGGTGCTCACATGTTAGG + Intronic
1022567453 7:31417326-31417348 CCCCAGGTGGCTGTGATGCCGGG - Intergenic
1023481153 7:40636197-40636219 GCTGAGGTGGCTCTAAAGCTGGG + Intronic
1027536575 7:79410539-79410561 GAGCAGGTGGCTCTCCTCCTTGG - Intronic
1029384464 7:100234401-100234423 GTCCAGGCCGCTCTCAGGCTGGG + Intronic
1029515756 7:101022020-101022042 GCCTTGGTGGCCCTCATGCTGGG - Intronic
1032477694 7:132223625-132223647 GCCCAGGTGCCTGTCCTGCGTGG - Exonic
1034458979 7:151187605-151187627 GCCGAGGGGGCTCCCAGGCTGGG + Intronic
1037170575 8:15886915-15886937 TCCAAGGTTGCTTTCATGCTTGG + Intergenic
1039350454 8:36758373-36758395 GCCTAGATGGCTTTCAAGCTTGG + Intergenic
1040532100 8:48274424-48274446 GGCAAGGGGGCTCACATGCTTGG + Intergenic
1041118179 8:54560816-54560838 GGCCATGTGGGTCTCCTGCTTGG - Intergenic
1046985576 8:120384306-120384328 TCCCATGTGGCTCTGTTGCTGGG + Intronic
1047387972 8:124426998-124427020 GCTCAGGAGGATCCCATGCTCGG - Intergenic
1048499084 8:134959755-134959777 GCTCAGGTGGCTGCCATGCCAGG + Intergenic
1048981520 8:139705304-139705326 GCCCAGGGGTCTCTGAGGCTTGG - Intergenic
1049139631 8:140941097-140941119 GCCCAGGTGGCAGTCATTCATGG - Intronic
1049467543 8:142758824-142758846 GGCCTGGTCGCTCTCCTGCTTGG + Intergenic
1049592160 8:143467668-143467690 GCCAAGGTGGGTCCCCTGCTGGG - Intronic
1051269753 9:15343971-15343993 GCAAAGGTGGCTCCCATTCTTGG - Intergenic
1052990972 9:34519264-34519286 GCCCAGGGAGCTCCCATGATGGG + Intronic
1053478484 9:38398931-38398953 GTCAAGGTGGCCCCCATGCTAGG - Intergenic
1053498877 9:38568828-38568850 GCCCAGTTGGGCCTCATCCTGGG - Intronic
1056532889 9:87502553-87502575 GCCCAGGAGGCTCACAGGTTAGG - Intronic
1057161922 9:92895126-92895148 GCCCAGCTGGGCCTCATCCTGGG - Intergenic
1057973537 9:99580008-99580030 GCTCACGTGGCTGTAATGCTTGG - Intergenic
1059378830 9:113907655-113907677 CCCCAGGGGCCTCTCATGCGGGG - Intronic
1060057071 9:120423921-120423943 GCCCAGGTGGCTGGCCTGGTGGG - Intronic
1060895956 9:127217599-127217621 GCCCTGGTGGCTCTGCTGTTAGG - Intronic
1061884913 9:133586554-133586576 CCCCAGGGGGCTCTCCAGCTGGG - Intergenic
1187697820 X:21939223-21939245 GCACAGGTGGCCCTCGGGCTCGG - Intergenic
1190370831 X:49739276-49739298 GCCCAGGAGGCACACAGGCTGGG + Intergenic
1192081700 X:68053878-68053900 GCCCAGGTAACTCTCATATTGGG - Intronic
1200855030 Y:7928498-7928520 GGTTAGGTGGCTCTCCTGCTTGG - Intergenic
1200904585 Y:8468794-8468816 GGCAATGTGGCTCTCCTGCTTGG + Intergenic