ID: 966830733

View in Genome Browser
Species Human (GRCh38)
Location 3:184006132-184006154
Sequence CGATTGGTGTGGAGCCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 121}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966830733_966830738 10 Left 966830733 3:184006132-184006154 CCACCTGGGCTCCACACCAATCG 0: 1
1: 0
2: 0
3: 7
4: 121
Right 966830738 3:184006165-184006187 TTACCTCAGCCGGAGATCTCTGG 0: 1
1: 0
2: 0
3: 6
4: 44
966830733_966830742 21 Left 966830733 3:184006132-184006154 CCACCTGGGCTCCACACCAATCG 0: 1
1: 0
2: 0
3: 7
4: 121
Right 966830742 3:184006176-184006198 GGAGATCTCTGGGCTGCTATTGG 0: 1
1: 0
2: 2
3: 12
4: 136
966830733_966830739 11 Left 966830733 3:184006132-184006154 CCACCTGGGCTCCACACCAATCG 0: 1
1: 0
2: 0
3: 7
4: 121
Right 966830739 3:184006166-184006188 TACCTCAGCCGGAGATCTCTGGG 0: 1
1: 0
2: 0
3: 7
4: 99
966830733_966830737 0 Left 966830733 3:184006132-184006154 CCACCTGGGCTCCACACCAATCG 0: 1
1: 0
2: 0
3: 7
4: 121
Right 966830737 3:184006155-184006177 CACACTGTTGTTACCTCAGCCGG 0: 1
1: 0
2: 1
3: 9
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966830733 Original CRISPR CGATTGGTGTGGAGCCCAGG TGG (reversed) Intronic
900522575 1:3112846-3112868 TGATGGGGCTGGAGCCCAGGCGG - Intronic
900651525 1:3732390-3732412 TGCTTGGTGTGGTGCCCAGAGGG + Intronic
901215213 1:7551137-7551159 AGACTGGGGTGGAGACCAGGAGG - Intronic
901740990 1:11341789-11341811 TGGTTGGATTGGAGCCCAGGTGG + Intergenic
901847590 1:11993644-11993666 AGAATGGTGTGAACCCCAGGGGG + Intronic
912576372 1:110675349-110675371 CTAGGGGTGTGGAGGCCAGGGGG - Intergenic
913211982 1:116589674-116589696 GGAAGGGTATGGAGCCCAGGGGG - Intronic
917567627 1:176229499-176229521 CCATTGGTGTGGAGCACAGAGGG + Intergenic
922766829 1:228160356-228160378 AGAGGGGTGTGCAGCCCAGGAGG - Intergenic
924451923 1:244186556-244186578 TGAGTGGGGTGGAGGCCAGGAGG - Intergenic
1064259693 10:13775337-13775359 CCATTGTTGGGGAGCCCAAGGGG + Intronic
1065935183 10:30514973-30514995 TGTTTGGTCTGGAGGCCAGGAGG - Intergenic
1069523908 10:69150484-69150506 AGAATGGTGTGAAACCCAGGAGG - Intronic
1069845086 10:71365444-71365466 CAGTTAGTGTGGAGCACAGGGGG + Intergenic
1071040870 10:81308047-81308069 AGAATGGTGTGAACCCCAGGGGG - Intergenic
1071353561 10:84770314-84770336 CTATTGATGTGGCACCCAGGGGG - Intergenic
1074445377 10:113517336-113517358 CGATGGGTGGGGAACCCAGCTGG - Intergenic
1075431343 10:122384517-122384539 AGAATGGTGTGAACCCCAGGGGG + Intronic
1076827667 10:132977495-132977517 CAATCGGAGTGGAGCCCATGGGG + Intergenic
1077439431 11:2561111-2561133 AGAATGGTGTGAACCCCAGGGGG + Intronic
1082005004 11:47414532-47414554 GCATGGGTGTGGAGCTCAGGAGG + Intronic
1083854452 11:65385882-65385904 AGAATGGTGTGAACCCCAGGGGG - Intergenic
1083862312 11:65427999-65428021 GGATTGGAGTGGAGGCAAGGAGG - Intergenic
1087868930 11:103267004-103267026 CAGCTGATGTGGAGCCCAGGGGG - Intronic
1087946835 11:104172295-104172317 CCCTTGGTGTGGAGCCCAGTTGG + Intergenic
1088806622 11:113358679-113358701 CAGTTGATGTGGAGCCCAGAGGG - Intronic
1090640686 11:128726554-128726576 CCATTGGTATGGAGCTTAGGCGG - Intronic
1090684434 11:129100122-129100144 CAGTTGATGTGGAGCCCAGAAGG + Intronic
1090888149 11:130897620-130897642 GGATTGGTGTGGAGTCCTGATGG - Intronic
1103312772 12:120025137-120025159 AGAATGGTGTGAACCCCAGGGGG - Intronic
1103465301 12:121137765-121137787 GGACTGGTGTGGACCACAGGTGG + Intronic
1103709512 12:122901305-122901327 AGAATGGTGTGAACCCCAGGGGG - Intergenic
1104325729 12:127795479-127795501 GGATTTGTGTGGTGACCAGGCGG - Intergenic
1105215228 13:18280300-18280322 GGAAGGGTATGGAGCCCAGGGGG - Intergenic
1107895302 13:44956052-44956074 AGAATGGTGTGAACCCCAGGGGG + Intronic
1113683229 13:112259707-112259729 AGATTAGTGTGGAGCACAGGAGG - Intergenic
1115883373 14:37945421-37945443 CAACTGATGTGGAGCCCAGATGG + Intronic
1117553489 14:56859997-56860019 GGATTTGTGGGGAGCACAGGAGG - Intergenic
1123830288 15:24129033-24129055 AGAATGGTGTGAACCCCAGGGGG + Intergenic
1124616371 15:31245251-31245273 CTATTGGTCTGGTGCTCAGGAGG - Intergenic
1136850916 16:33611706-33611728 CGGATGATGTGGAGTCCAGGAGG - Intergenic
1142978844 17:3660066-3660088 GGATTGGCTTGGATCCCAGGTGG - Intronic
1143561288 17:7696784-7696806 GCACTGGTGTGGAGTCCAGGAGG + Intronic
1148225644 17:45896366-45896388 GGATGGGTGGGGAGCCCTGGCGG + Intronic
1151523209 17:74645898-74645920 AGAATGGTGTGAACCCCAGGGGG + Intergenic
1154470367 18:14694146-14694168 GAATTGGTGTGGATCCCAGCGGG - Intergenic
1155433994 18:25792244-25792266 CTATTAGTGCGGAGCGCAGGGGG + Intergenic
1157153677 18:45244134-45244156 AGATTGGTGGGCTGCCCAGGGGG - Intronic
1162217324 19:9147427-9147449 AGAATGGTGTGAAACCCAGGAGG - Intronic
1163257031 19:16162334-16162356 GGATTGCTCTTGAGCCCAGGAGG + Intronic
1163443564 19:17333879-17333901 GGAGTGGTGAGGAGCCCTGGCGG - Intronic
926351448 2:11998935-11998957 TGGTTGGTGTGCAGGCCAGGGGG + Intergenic
929520599 2:42647065-42647087 AGAATGGCGTGGAACCCAGGAGG + Intronic
933839723 2:86276619-86276641 AGATTGGTGTGCAGTCCTGGAGG + Intronic
933881302 2:86672739-86672761 GGAATGGTGTGGATTCCAGGTGG + Intronic
934299092 2:91766437-91766459 GGAAGGGTATGGAGCCCAGGGGG + Intergenic
935221620 2:101019981-101020003 AGAATGGTGTGGAACCCGGGAGG + Intronic
935996382 2:108778814-108778836 GGATTGCTTTAGAGCCCAGGAGG - Intronic
936407022 2:112214033-112214055 AGAATGGTGTGAACCCCAGGGGG - Exonic
938413699 2:131086974-131086996 AGAATGGTGTGAACCCCAGGGGG + Intronic
938902819 2:135812471-135812493 GGATTCGTGTGGTGCCCTGGGGG - Exonic
940846025 2:158643176-158643198 AGATTGGTGAGGAACACAGGTGG + Intronic
940907389 2:159181383-159181405 AGAATGGTGTGAACCCCAGGGGG - Intronic
943153125 2:184138781-184138803 CAGCTGGTGTGGAGCCCAGAGGG - Intergenic
946085924 2:217171450-217171472 GGAGTGGGGAGGAGCCCAGGTGG - Intergenic
1170669219 20:18415323-18415345 CGGCTGGTGTGGAGCCATGGTGG - Exonic
1172443407 20:34980742-34980764 CGGTTGGGGAGGAGTCCAGGCGG - Intronic
1172776966 20:37413524-37413546 TGATGGGTGTGGGGCCCAGGAGG - Intergenic
1173877455 20:46383271-46383293 TGTCTGGTCTGGAGCCCAGGAGG - Intronic
1176804124 21:13463720-13463742 GAACTGGTGTGGATCCCAGGGGG + Intergenic
1184244743 22:43230301-43230323 CCACTTGTGTGGAGCCCAAGGGG + Intronic
953925547 3:46980639-46980661 AGATGGGTGGGGAGCTCAGGAGG - Intronic
954522706 3:51243232-51243254 CAGATGATGTGGAGCCCAGGGGG - Intronic
957866436 3:86029919-86029941 AGTTTGGTGTGGAGCCCTTGAGG + Intronic
958464589 3:94442520-94442542 CTACTGATGTGGAGCCCAGAGGG + Intergenic
961378112 3:126480448-126480470 GGCTTGGTATGGAGCCCAGAGGG + Intergenic
966824731 3:183954033-183954055 CTATTTGTGTGGAACACAGGAGG - Intronic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
967723241 3:192837422-192837444 TGCTTGGTGGGAAGCCCAGGTGG - Intronic
968505230 4:968278-968300 CGAGTGGTGCGGGGTCCAGGTGG - Exonic
968669366 4:1840576-1840598 AGAATGGTGTGGACCCCGGGGGG + Intronic
968879467 4:3291924-3291946 TGATTAGTTTGGATCCCAGGAGG - Intergenic
975165584 4:71174917-71174939 TGATTTGAATGGAGCCCAGGTGG + Intergenic
982584850 4:157222829-157222851 GGATTGGTGTGGAGGCCAGAGGG + Intronic
985569993 5:639624-639646 TGGTTGGTGTGGGACCCAGGAGG + Intronic
986125245 5:4878337-4878359 TGAGTGGAGTGGAGACCAGGAGG - Intergenic
986296828 5:6446350-6446372 CGCTGGGTGTGGACCCCAGCTGG + Intergenic
986741292 5:10707664-10707686 CGATCAGTGTGGTGCACAGGCGG + Intronic
993132405 5:83915205-83915227 AGATTGGGCTTGAGCCCAGGTGG + Intergenic
996507852 5:124288111-124288133 CGAATGGTGGGGAGCCAAGAAGG - Intergenic
996663075 5:126027117-126027139 CAGCTGGTGTGGAGCCCAGAGGG + Intergenic
996954325 5:129164674-129164696 CAGCTGATGTGGAGCCCAGGGGG - Intergenic
997258047 5:132444252-132444274 CTACTGGTGTGAAGCCCAGCCGG - Intronic
999019931 5:148154162-148154184 CATTTGGTGTAGAGCCCAGAGGG + Intergenic
1001068261 5:168558247-168558269 AGAATGGTGTGAACCCCAGGGGG - Intronic
1004669196 6:17779827-17779849 AGAATGGTGTGAACCCCAGGGGG - Intronic
1006597517 6:35204150-35204172 AGAATGGTGTGAACCCCAGGAGG - Intergenic
1007098634 6:39229543-39229565 CGACCGGGGAGGAGCCCAGGCGG + Intergenic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1008985928 6:57543026-57543048 AGAATGGCGTGAAGCCCAGGGGG - Intronic
1009782006 6:68283869-68283891 ACATTGGTGTGGAGCCAAGATGG + Intergenic
1011281600 6:85683564-85683586 GAAGTGGAGTGGAGCCCAGGTGG + Intergenic
1012647225 6:101700839-101700861 GGACTGGTATAGAGCCCAGGGGG + Intronic
1012868571 6:104646319-104646341 TGTTTGGTGTGTTGCCCAGGTGG - Intergenic
1017156410 6:151325968-151325990 CGTTTGGTGGGGAGCCCGGGAGG + Intronic
1020590889 7:10135579-10135601 TGATTGGTGTGGAGAGCAGGAGG - Intergenic
1022693453 7:32681233-32681255 GAATTGGGGTTGAGCCCAGGAGG - Intergenic
1026665220 7:72336014-72336036 GGATGGGTCTGGCGCCCAGGTGG - Intronic
1029519590 7:101051716-101051738 GGAGAGGTGGGGAGCCCAGGAGG + Intronic
1032225773 7:130030755-130030777 AGAATGGTGTGAACCCCAGGAGG - Intronic
1036287185 8:7453390-7453412 CAATTGTTATGAAGCCCAGGGGG - Intronic
1036334296 8:7858133-7858155 CAATTGTTATGAAGCCCAGGGGG + Intronic
1037712336 8:21364803-21364825 CCTTTGGAGTGGAGCCCAGCAGG - Intergenic
1039856797 8:41422016-41422038 AGAATGGCGTGAAGCCCAGGGGG + Intergenic
1043338425 8:79206773-79206795 AGAATGGTGTGAACCCCAGGGGG - Intergenic
1043656483 8:82674204-82674226 CAACTGATGTGGAGCCCAGAGGG + Intergenic
1047161165 8:122381591-122381613 TGATTCCTGTGGAGCCCAAGAGG + Intergenic
1049471620 8:142777383-142777405 GGCTTGGTGAGTAGCCCAGGAGG - Intronic
1057108567 9:92445089-92445111 CAGCTGGTGTGGAGCCCAGAGGG - Intronic
1057214621 9:93220954-93220976 GGATGGGTGGGCAGCCCAGGAGG - Intronic
1186381098 X:9060070-9060092 CGATAGGAGTGGATCACAGGTGG - Intronic
1187930410 X:24288531-24288553 CAAAGGGTGTGGATCCCAGGAGG + Intergenic
1188492997 X:30755821-30755843 CAGCTGGTGTGGAGCCCAGAGGG + Intergenic
1191155302 X:57266808-57266830 CAGATGATGTGGAGCCCAGGGGG + Intergenic
1193580711 X:83259740-83259762 CAGTTGATGTGGAGCCCAGAGGG + Intergenic
1195548307 X:106138392-106138414 CAGTTGATGTGGAGCCCAGAGGG + Intergenic
1199110554 X:143928846-143928868 AGAATGGTGTGGAACCCGGGAGG + Intergenic
1200138815 X:153887220-153887242 CAAGTGGTGTGGGGCCCTGGAGG + Intronic
1201159608 Y:11157158-11157180 CCCTTGGTGAGGATCCCAGGAGG + Intergenic