ID: 966830734

View in Genome Browser
Species Human (GRCh38)
Location 3:184006135-184006157
Sequence GTGCGATTGGTGTGGAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 104}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966830734_966830738 7 Left 966830734 3:184006135-184006157 CCTGGGCTCCACACCAATCGCAC 0: 1
1: 0
2: 0
3: 8
4: 104
Right 966830738 3:184006165-184006187 TTACCTCAGCCGGAGATCTCTGG 0: 1
1: 0
2: 0
3: 6
4: 44
966830734_966830742 18 Left 966830734 3:184006135-184006157 CCTGGGCTCCACACCAATCGCAC 0: 1
1: 0
2: 0
3: 8
4: 104
Right 966830742 3:184006176-184006198 GGAGATCTCTGGGCTGCTATTGG 0: 1
1: 0
2: 2
3: 12
4: 136
966830734_966830737 -3 Left 966830734 3:184006135-184006157 CCTGGGCTCCACACCAATCGCAC 0: 1
1: 0
2: 0
3: 8
4: 104
Right 966830737 3:184006155-184006177 CACACTGTTGTTACCTCAGCCGG 0: 1
1: 0
2: 1
3: 9
4: 146
966830734_966830739 8 Left 966830734 3:184006135-184006157 CCTGGGCTCCACACCAATCGCAC 0: 1
1: 0
2: 0
3: 8
4: 104
Right 966830739 3:184006166-184006188 TACCTCAGCCGGAGATCTCTGGG 0: 1
1: 0
2: 0
3: 7
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966830734 Original CRISPR GTGCGATTGGTGTGGAGCCC AGG (reversed) Intronic
900420577 1:2554341-2554363 GAGCGCTGGGTGGGGAGCCCAGG + Intergenic
901740989 1:11341786-11341808 GTGTGGTTGGATTGGAGCCCAGG + Intergenic
904974062 1:34442528-34442550 GTGCGTGTGGAGTGGGGCCCAGG + Intergenic
905391797 1:37640662-37640684 GTGGGATTGGTCTTGAGGCCAGG - Intergenic
905404312 1:37722888-37722910 GTGGGCTTGGTGTGGAGGCAGGG + Intronic
906732373 1:48094002-48094024 GTGGGTTTGGTGTGGCGGCCTGG + Intergenic
916748746 1:167704848-167704870 GAACGTTTGGTGTGGAGGCCAGG - Exonic
917217446 1:172692599-172692621 GTCTGATTTGTGTGGAGCTCTGG - Intergenic
917482639 1:175425149-175425171 GTGCCATAGGTGTGGAGCTTGGG + Intronic
917896265 1:179490943-179490965 GTGAGTTTGCTGTGGAGCCCTGG + Intronic
918961241 1:191280783-191280805 GTGCGATTTGAGTGGAGACACGG + Intergenic
919674127 1:200364906-200364928 GTGGGTTTGGGGTAGAGCCCAGG + Intergenic
1070626575 10:78055141-78055163 GTGAGAGAGATGTGGAGCCCTGG - Exonic
1071353564 10:84770317-84770339 GTGCTATTGATGTGGCACCCAGG - Intergenic
1071943010 10:90609466-90609488 GTCTGATTGGTGTAGAGCTCTGG - Intergenic
1073572413 10:104591720-104591742 GTGAGTCTGGTCTGGAGCCCAGG + Intergenic
1077195909 11:1279889-1279911 GTGCGAGACGTCTGGAGCCCAGG - Intronic
1077408977 11:2394814-2394836 GAGCGGCTTGTGTGGAGCCCTGG - Intronic
1081667516 11:44925241-44925263 GTGGGTCTGGTGTGGAGCCCAGG - Intronic
1082081830 11:48018403-48018425 CTGTGAGTGGTGTGAAGCCCCGG + Intronic
1082759342 11:57111827-57111849 CTGGGATTGGAGTGGAGCCAAGG + Intergenic
1090800228 11:130166344-130166366 GTCTGCTGGGTGTGGAGCCCTGG + Intronic
1091206498 11:133824795-133824817 GGGCGAGTGGTGTGGAGAGCAGG - Intergenic
1095421041 12:42023852-42023874 GAGAGATTGCTGGGGAGCCCTGG + Intergenic
1098030273 12:66246522-66246544 GTGAGAGTTGTGTGGAGCCAAGG + Intronic
1101510935 12:105391664-105391686 GTGCGATGGGTCTTGAACCCAGG + Intronic
1102481663 12:113227902-113227924 GTGAGTGTGGTGGGGAGCCCTGG + Intronic
1103619716 12:122179587-122179609 GTGGAAGTCGTGTGGAGCCCTGG + Intronic
1109994826 13:70109003-70109025 GTGCATTTGGTGTGTAGCCTCGG + Intergenic
1120536383 14:85701162-85701184 GTGGAATTGGTGTGGAACCGGGG - Intergenic
1122262921 14:100533374-100533396 GTGGGTTTTCTGTGGAGCCCTGG - Intergenic
1126848414 15:52783525-52783547 GGCCGACTGGTCTGGAGCCCTGG - Intronic
1128454144 15:67823287-67823309 GGGCGGTGGGTGTGGCGCCCCGG + Intronic
1128581753 15:68815610-68815632 CTGTGATTGGGGTGGAGCCCAGG + Intronic
1129275349 15:74441795-74441817 GTGAGCTTGGTCTGGGGCCCAGG + Intergenic
1129664501 15:77572022-77572044 GTTGGAGTGGTGTGGGGCCCAGG + Intergenic
1130027819 15:80285073-80285095 GTGGGATTGGTCTTGAGACCAGG - Intergenic
1130867180 15:87942996-87943018 GTGGGATTGGGGTGGAGTCTGGG - Intronic
1136707584 16:32202176-32202198 TTGAGACTGGTGTGGAGCCTGGG + Intergenic
1136760326 16:32727234-32727256 TTGAGACTGGTGTGGAGCCTGGG - Intergenic
1136807778 16:33143152-33143174 TTGAGACTGGTGTGGAGCCTGGG + Intergenic
1142249061 16:88982872-88982894 GTGCAGGGGGTGTGGAGCCCAGG - Intergenic
1203062480 16_KI270728v1_random:987556-987578 TTGAGACTGGTGTGGAGCCTGGG - Intergenic
1145269839 17:21398988-21399010 GTGCCTTAGGGGTGGAGCCCTGG + Intronic
1146571966 17:33960784-33960806 GTGGAACTGCTGTGGAGCCCTGG - Intronic
1147312126 17:39601598-39601620 GGGCGACTGGTGTGGATGCCGGG + Intergenic
1147863283 17:43536499-43536521 GTGAGTTTGGGGCGGAGCCCTGG + Intronic
1150176845 17:63066314-63066336 GTGAGATAGGTCTGGAGCCCTGG + Intronic
1150651018 17:67010205-67010227 GTCCCAGTGGTGTGGGGCCCTGG + Intronic
1152091936 17:78252004-78252026 GTTGGGTTGGTGGGGAGCCCTGG - Intergenic
1152555493 17:81051040-81051062 GTGAGATAGGTCTGGCGCCCAGG - Intronic
1156409988 18:36818436-36818458 TTGTGCTTGGTGTTGAGCCCTGG - Intronic
1156568561 18:38224419-38224441 GTGGAATTGGTGTGGAGCAAAGG - Intergenic
1156812200 18:41266359-41266381 CTGCTTTTGGTGGGGAGCCCAGG + Intergenic
1158632960 18:59132143-59132165 GGGCGGTTGGGGTGGAGCCCTGG + Intergenic
1161389075 19:4011855-4011877 GTGTGTTTGGTGTGGAGCTGTGG + Intronic
1164845026 19:31424633-31424655 GTGAAATGGGTGGGGAGCCCTGG - Intergenic
1165416397 19:35696493-35696515 ATGCCATTGGTGCTGAGCCCTGG - Intergenic
1166938515 19:46349436-46349458 GTGGGAAGGGTCTGGAGCCCTGG + Intronic
1167660727 19:50794582-50794604 GTGAGAATGGTTTGGTGCCCAGG + Intronic
925032010 2:657994-658016 GTGCTGTTGATGTGGCGCCCTGG - Intergenic
929044112 2:37773912-37773934 GTGTGTGTGGTGGGGAGCCCGGG - Intergenic
931974838 2:67631817-67631839 GTGCCCTTGGACTGGAGCCCAGG - Intergenic
932773987 2:74516199-74516221 GTCCGATCGGCGTGGAGCGCCGG + Exonic
933839722 2:86276616-86276638 ATGAGATTGGTGTGCAGTCCTGG + Intronic
935678530 2:105616973-105616995 CTGAGGTTGGGGTGGAGCCCAGG - Intergenic
942191601 2:173476070-173476092 GTGCCTTTGGTGGGGAACCCAGG + Intergenic
945699520 2:213152197-213152219 CTGGGATTGGTGGGGAGGCCGGG + Intronic
945762185 2:213927333-213927355 CTTCTATTTGTGTGGAGCCCAGG + Intronic
948180021 2:235972481-235972503 GTGGGTTTGGTGTAGAACCCGGG + Intronic
1170669220 20:18415326-18415348 CTGCGGCTGGTGTGGAGCCATGG - Exonic
1171333572 20:24362396-24362418 GTCCTCTTGGTGTGGAGGCCTGG - Intergenic
1172776967 20:37413527-37413549 GGGTGATGGGTGTGGGGCCCAGG - Intergenic
1175921753 20:62453465-62453487 GTGGGAGAAGTGTGGAGCCCTGG + Intergenic
1177393834 21:20508332-20508354 CTGGGACTGGTGTGGAGCCAGGG - Intergenic
1180710749 22:17837792-17837814 GTGGGTTTGGGGTGGAGGCCAGG - Intronic
1184391777 22:44207241-44207263 GTGAGATTGGTGGGGAGGGCTGG + Exonic
950965006 3:17140022-17140044 CTGCCTTTGCTGTGGAGCCCGGG + Intergenic
955238542 3:57160826-57160848 GTGAGAGTGAGGTGGAGCCCAGG - Intronic
960927723 3:122812517-122812539 GTGGGACTGGGTTGGAGCCCTGG - Intronic
966619867 3:181952323-181952345 ATGTGATTGGTCTGGTGCCCAGG + Intergenic
966830734 3:184006135-184006157 GTGCGATTGGTGTGGAGCCCAGG - Intronic
968879468 4:3291927-3291949 GTGTGATTAGTTTGGATCCCAGG - Intergenic
969317642 4:6391595-6391617 GTGCTCTTGGGGTGGAGGCCGGG - Intronic
969697337 4:8742123-8742145 GTGAGATTGGTGTGGGGTCTGGG - Intergenic
982526977 4:156490693-156490715 GTCTGACTGGTGTGGAGCTCCGG + Intergenic
985544019 5:500355-500377 ATGCGACTGGCGTGGATCCCTGG + Intronic
985563574 5:604039-604061 GTGACCTTGGTTTGGAGCCCGGG + Intergenic
989214558 5:38891519-38891541 CTGGGACTGGTGTGGAGCCAGGG + Intronic
992077418 5:73204108-73204130 GTGCTCTTGGAGTGGAGCCCAGG - Intergenic
999553750 5:152718890-152718912 GAGCTATTGGTGTTGAGTCCAGG + Intergenic
1000672195 5:164076895-164076917 CTGAGATGGGAGTGGAGCCCTGG + Intergenic
1001008441 5:168075515-168075537 GTGAGGTTGGTGTGGGGCACAGG - Intronic
1002511586 5:179722880-179722902 GTGCTATTGGTTTGGAGCTGTGG + Exonic
1004698224 6:18054104-18054126 GTCCGCTTGGTGTGGAGATCAGG + Intergenic
1007659348 6:43473748-43473770 ATGTGCTTGGTGTGGAGTCCGGG - Intergenic
1009842454 6:69093619-69093641 GGGAGATGGGTGGGGAGCCCAGG + Intronic
1017156409 6:151325965-151325987 GAGCGTTTGGTGGGGAGCCCGGG + Intronic
1027333770 7:77126977-77126999 GTGGGGTTGGGGTTGAGCCCTGG - Intronic
1029782025 7:102744355-102744377 GTGGGGTTGGGGTTGAGCCCTGG + Intergenic
1032547788 7:132758050-132758072 GTGGGTCTGGAGTGGAGCCCTGG - Intergenic
1039883356 8:41640864-41640886 GTGATGTTGCTGTGGAGCCCAGG + Intergenic
1040560201 8:48517088-48517110 GTGGGAATGGGGTGGACCCCTGG - Intergenic
1048379995 8:133857092-133857114 GTAGGACTGGTGTGGACCCCAGG - Intergenic
1050337379 9:4602438-4602460 GTGCTAAAGGTGGGGAGCCCTGG + Intronic
1051540125 9:18206320-18206342 ATGTGATTGACGTGGAGCCCAGG + Intergenic
1051606789 9:18924315-18924337 GTGGGCTTTGTGTGGAGCCCTGG - Intergenic
1055210002 9:73780133-73780155 GTGAGATTTGTGAGGAGCCAGGG + Intergenic
1057548489 9:96035164-96035186 GTGGGATTGGTGCTGAGCCTGGG + Intergenic
1062187584 9:135226953-135226975 GTGGGATGGGGGTGAAGCCCAGG + Intergenic
1188674539 X:32922725-32922747 GACCGATTGGTCTGGGGCCCAGG + Intronic
1196134174 X:112188961-112188983 GGACAATTGGTCTGGAGCCCAGG - Intergenic
1198684163 X:139210102-139210124 GTGCGATATGTCTGGAGCCTCGG - Intronic