ID: 966830735

View in Genome Browser
Species Human (GRCh38)
Location 3:184006143-184006165
Sequence ACAACAGTGTGCGATTGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 72}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966830735_966830739 0 Left 966830735 3:184006143-184006165 CCACACCAATCGCACACTGTTGT 0: 1
1: 0
2: 0
3: 6
4: 72
Right 966830739 3:184006166-184006188 TACCTCAGCCGGAGATCTCTGGG 0: 1
1: 0
2: 0
3: 7
4: 99
966830735_966830743 24 Left 966830735 3:184006143-184006165 CCACACCAATCGCACACTGTTGT 0: 1
1: 0
2: 0
3: 6
4: 72
Right 966830743 3:184006190-184006212 TGCTATTGGAGACCAACACCTGG 0: 1
1: 0
2: 0
3: 12
4: 97
966830735_966830738 -1 Left 966830735 3:184006143-184006165 CCACACCAATCGCACACTGTTGT 0: 1
1: 0
2: 0
3: 6
4: 72
Right 966830738 3:184006165-184006187 TTACCTCAGCCGGAGATCTCTGG 0: 1
1: 0
2: 0
3: 6
4: 44
966830735_966830742 10 Left 966830735 3:184006143-184006165 CCACACCAATCGCACACTGTTGT 0: 1
1: 0
2: 0
3: 6
4: 72
Right 966830742 3:184006176-184006198 GGAGATCTCTGGGCTGCTATTGG 0: 1
1: 0
2: 2
3: 12
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966830735 Original CRISPR ACAACAGTGTGCGATTGGTG TGG (reversed) Intronic
911047727 1:93642475-93642497 ACAACAGGGTGTGTGTGGTGGGG + Intronic
917482637 1:175425141-175425163 ACAAGACTGTGCCATAGGTGTGG + Intronic
1064587996 10:16858747-16858769 AAGACAGTGTGATATTGGTGAGG + Intronic
1065535035 10:26708059-26708081 ACAACACAGTGTGATGGGTGTGG - Intronic
1076124123 10:127961328-127961350 AGAACAGTGTGGGCTTGTTGGGG + Intronic
1081037638 11:38169207-38169229 AGAACAGTGTGGAATGGGTGTGG - Intergenic
1082128070 11:48455643-48455665 ACAACAGTGTGCCCTGGATGTGG - Intergenic
1082561623 11:54626571-54626593 ACAACAGTGTGCCCTGGATGTGG - Intergenic
1084404668 11:68964335-68964357 ACTAATGTGTGGGATTGGTGGGG + Intergenic
1084925293 11:72506642-72506664 ACAGCAGTGTGCCCTTGTTGTGG - Intergenic
1084954299 11:72683335-72683357 ACAACAGTGTTGGATGGGTTAGG - Intergenic
1089150477 11:116360079-116360101 ATAACAGTGTGGGATGGGTGTGG + Intergenic
1089291316 11:117439362-117439384 GCAGCAGTGTGCCATTGGTGTGG + Exonic
1093826237 12:23693082-23693104 ACAACTGTATGCTATTGTTGAGG - Intronic
1097324643 12:58262428-58262450 AAAATATTGTGTGATTGGTGTGG + Intergenic
1099000372 12:77171838-77171860 ACACCAGTGGGCAATTGCTGAGG + Intergenic
1103197794 12:119060351-119060373 TCAACAGTGTGGGATAGGAGTGG - Intronic
1109247830 13:59978080-59978102 ATTACAGTGTGCAATTGGTATGG - Intronic
1110026078 13:70541166-70541188 GCAACAGTGTATGCTTGGTGAGG - Intergenic
1121348827 14:93156771-93156793 ACACCAGTGTGTGATTGGGATGG - Intergenic
1123108266 14:105852945-105852967 ACAGCACTGTGCGTTGGGTGTGG + Intergenic
1128145031 15:65328325-65328347 ACAACAGTGTGGGAAGGGAGAGG + Exonic
1130102611 15:80905397-80905419 AAAAGAGTGTGGGATTGTTGTGG + Intronic
1131733993 15:95312779-95312801 ATAACTGTGTGGCATTGGTGGGG - Intergenic
1139206261 16:65031994-65032016 ACAAGGATGTGCGATTGTTGTGG + Intronic
1155599443 18:27528168-27528190 ACCTCAGTGTGGGATTGCTGTGG - Intergenic
1156497639 18:37536569-37536591 ACATCTGTGTGGGATGGGTGAGG + Intronic
1159070350 18:63615997-63616019 ACAACTGTGTGCGGTTGGGGTGG - Intergenic
1161769035 19:6221554-6221576 ACAGCTGTGTGCGATGGGTGTGG + Intronic
925883047 2:8368893-8368915 GCAATAGTGTGCTATTTGTGGGG + Intergenic
931212672 2:60212722-60212744 ACTACAGTGTCTGGTTGGTGGGG + Intergenic
934704061 2:96464020-96464042 AAAACAGTGTGGTATTGGCGAGG + Intergenic
936666930 2:114607849-114607871 ACAATAGTTTGGGGTTGGTGCGG - Intronic
936740815 2:115505509-115505531 ACAACTGTTTGCGATTGTTTTGG + Intronic
940604128 2:155898433-155898455 AGAACAGTTTGCTAGTGGTGGGG - Intergenic
942112171 2:172693314-172693336 TCCACAGTGTGGGAGTGGTGAGG + Intergenic
1169068843 20:2709498-2709520 ACGACAGTGTGTGAGTTGTGGGG - Intronic
1169452018 20:5719977-5719999 ACAACAGTCTGAGGCTGGTGTGG + Intergenic
1169583889 20:7058652-7058674 ACAACAGTGTGCCCTGGATGTGG - Intergenic
1170382706 20:15778995-15779017 ACAACAGAGAGGGATTGGAGAGG + Intronic
1175658963 20:60795798-60795820 ACAACAGTTTGCTTTTTGTGTGG + Intergenic
952104934 3:30058327-30058349 AAAACAGTGTGGTATTGATGGGG - Intergenic
953289598 3:41648552-41648574 AAAACAGTTTGCAATTGATGAGG - Intronic
953866174 3:46585160-46585182 TCAACAGAGTAGGATTGGTGGGG + Intronic
966830735 3:184006143-184006165 ACAACAGTGTGCGATTGGTGTGG - Intronic
970647105 4:18135088-18135110 ACAACAGGGTGCAATTGCTAAGG + Intergenic
973676487 4:53268616-53268638 GCCACAGTGTGGGCTTGGTGTGG + Intronic
974018482 4:56671927-56671949 ACAACATTGTGTGACAGGTGGGG - Intronic
977329728 4:95622203-95622225 ACACCAGTGTGGAATTGATGAGG + Intergenic
988114934 5:26874693-26874715 ACAACAGAATGTGATTGCTGTGG + Intergenic
990925843 5:61021622-61021644 ACAACAGAGTGGGAAAGGTGGGG - Intronic
991458821 5:66834714-66834736 ACAACAGTGGGCAATGGCTGGGG - Intronic
1000276898 5:159745799-159745821 ACAGCAGTGTGAGAAGGGTGTGG + Intergenic
1001249398 5:170135042-170135064 ACCACAGTGTCCCAGTGGTGTGG - Intergenic
1002430473 5:179200606-179200628 AGAACAGTCAGCGGTTGGTGAGG + Intronic
1003746019 6:9003425-9003447 ACAGCAGTGAGTGATGGGTGGGG + Intergenic
1003952650 6:11130492-11130514 ACAGCAGTGTGGAATTGGAGTGG + Intronic
1005923419 6:30419680-30419702 ATAACAGTGTGCGAAGGGTGAGG - Intergenic
1008517307 6:52330313-52330335 ACAATAGTGTGCTATGGCTGAGG + Intergenic
1011031352 6:82927228-82927250 CCACCAGTGTGGTATTGGTGGGG - Intronic
1011700411 6:89950178-89950200 AGAACAATGTGGGAGTGGTGGGG + Intronic
1013539512 6:111093994-111094016 ACAACAATGTGAGATTCCTGTGG + Intronic
1017881364 6:158564849-158564871 ACAACAGTGTGAGAATGGGCTGG + Intronic
1022656490 7:32323897-32323919 ACCACAGTGTGCGATGGGACAGG - Intergenic
1030261470 7:107569307-107569329 AAAACTGTGTGGTATTGGTGGGG - Intronic
1030902145 7:115137796-115137818 ACAACACTGGGAGATTGGTAGGG + Intergenic
1033820623 7:145130374-145130396 ACAACAGTGTGCTATATGTGTGG - Intergenic
1043505363 8:80896915-80896937 ACTACAGAGTGTGATTGGCGTGG + Intergenic
1045290130 8:100825914-100825936 GCAACAGCGTGGCATTGGTGGGG - Intergenic
1047191734 8:122684543-122684565 AAAACAGTGTGGGCTTGGTCAGG - Intergenic
1050415272 9:5409696-5409718 ACACCAGTGTGCGCTGGATGTGG + Intronic
1055856290 9:80691896-80691918 ACACCAGTGTGCCCTAGGTGTGG + Intergenic
1061662325 9:132138453-132138475 ATAACAGTGCCTGATTGGTGGGG + Intergenic
1187948327 X:24447978-24448000 ACATGTGTGTGCTATTGGTGGGG - Intergenic
1192184870 X:68940207-68940229 AGAAGAGTGGGCCATTGGTGAGG - Intergenic
1193376124 X:80763987-80764009 AAAACAGCATGCTATTGGTGAGG + Intronic
1195269234 X:103214629-103214651 ACCACAGTTTGCCATTGGGGTGG + Intergenic
1195310236 X:103625155-103625177 ACAACAGTCTCCAAGTGGTGTGG - Intronic
1201528379 Y:14962240-14962262 ACAACAGTGTCTGGATGGTGTGG - Intergenic