ID: 966830736

View in Genome Browser
Species Human (GRCh38)
Location 3:184006148-184006170
Sequence AGGTAACAACAGTGTGCGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 56}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966830736_966830743 19 Left 966830736 3:184006148-184006170 CCAATCGCACACTGTTGTTACCT 0: 1
1: 0
2: 0
3: 6
4: 56
Right 966830743 3:184006190-184006212 TGCTATTGGAGACCAACACCTGG 0: 1
1: 0
2: 0
3: 12
4: 97
966830736_966830738 -6 Left 966830736 3:184006148-184006170 CCAATCGCACACTGTTGTTACCT 0: 1
1: 0
2: 0
3: 6
4: 56
Right 966830738 3:184006165-184006187 TTACCTCAGCCGGAGATCTCTGG 0: 1
1: 0
2: 0
3: 6
4: 44
966830736_966830742 5 Left 966830736 3:184006148-184006170 CCAATCGCACACTGTTGTTACCT 0: 1
1: 0
2: 0
3: 6
4: 56
Right 966830742 3:184006176-184006198 GGAGATCTCTGGGCTGCTATTGG 0: 1
1: 0
2: 2
3: 12
4: 136
966830736_966830739 -5 Left 966830736 3:184006148-184006170 CCAATCGCACACTGTTGTTACCT 0: 1
1: 0
2: 0
3: 6
4: 56
Right 966830739 3:184006166-184006188 TACCTCAGCCGGAGATCTCTGGG 0: 1
1: 0
2: 0
3: 7
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966830736 Original CRISPR AGGTAACAACAGTGTGCGAT TGG (reversed) Intronic
901130614 1:6960598-6960620 AGGTATCAACAGAGTGCTGTGGG - Intronic
914898751 1:151699825-151699847 AGGGAACAAAAGCGTGTGATCGG - Intergenic
917249211 1:173038926-173038948 AGGCAAAAACAGTGTGAGAAGGG + Intergenic
917733717 1:177901401-177901423 AAGGAACAACAGTGTGCTAAGGG - Intergenic
1066037531 10:31508546-31508568 AGGTGACAACAGTGTTGGACTGG + Intronic
1067792833 10:49300823-49300845 AGGGAACAACTGTGTGCGGTGGG + Intronic
1073489917 10:103846293-103846315 AGGTAACAGCAGGGAGAGATGGG + Intronic
1076242644 10:128921433-128921455 AGGCAACAAAAGTCTGCGTTGGG - Intergenic
1078007612 11:7544397-7544419 AGGAATCAACAATGTGCCATGGG - Intronic
1085038762 11:73314743-73314765 AGGTAACAAGAGTGTGGGAGGGG - Intronic
1086435048 11:86771845-86771867 AGGGAACAGCAGAGTGTGATGGG + Intergenic
1087891450 11:103542261-103542283 GGGTAACACCACTGTGGGATGGG - Intergenic
1089924691 11:122245295-122245317 ATGTAACCACAGTGTGAGATTGG + Intergenic
1092928838 12:13296198-13296220 AGGTAACATCAATGAGTGATCGG + Intergenic
1113756427 13:112814728-112814750 AGTGACCAACAGTGTGGGATTGG - Intronic
1131989575 15:98080304-98080326 AGCTAACAACAGTGGGAGGTGGG - Intergenic
1132163172 15:99562238-99562260 AGGTAACAGAAGTGTGCAAATGG + Intergenic
1137637027 16:49995813-49995835 CTGTAACAACAGTGTGGGTTGGG - Intergenic
1138789123 16:59881537-59881559 AGCTGACAAGAGTGTGTGATAGG - Intergenic
1139712506 16:68787178-68787200 AGTTAACAGCAATGTGGGATGGG - Intronic
1159070353 18:63616002-63616024 AGGGGACAACTGTGTGCGGTTGG - Intergenic
1161769034 19:6221549-6221571 AAGTCACAGCTGTGTGCGATGGG + Intronic
929078702 2:38100442-38100464 AGGGTACAATAGTGTGCAATAGG - Intronic
938611896 2:132956719-132956741 CGGTAACAACAGTTTCTGATGGG - Intronic
938932742 2:136100916-136100938 AGGAAACATCAGTCTGTGATGGG + Intergenic
939012243 2:136860315-136860337 AGCTAAAAACAGTGTGATATTGG - Intronic
941859963 2:170268975-170268997 AGGTAAGAAAAGTGCGTGATAGG + Intronic
943229621 2:185231840-185231862 AGATAACAATAGTGTACTATTGG + Intergenic
946942820 2:224787552-224787574 AGGTAACGGCAGTGCGGGATAGG - Intronic
1170382705 20:15778990-15779012 ATGTAACAACAGAGAGGGATTGG + Intronic
1170783247 20:19445990-19446012 AGGTAACAACAGTTTCCTAAAGG - Intronic
1177301854 21:19257088-19257110 AGGCAAGAACAGTGTGCTTTGGG - Intergenic
1179818431 21:43922655-43922677 GGGAAACAACAGTGTGCTCTGGG + Intronic
953167487 3:40478119-40478141 ATGTAAAAACAGTATGCGAGGGG + Intronic
953538407 3:43793420-43793442 AGCTAACAAAAGTGTGCTAAGGG + Intergenic
953907390 3:46875129-46875151 AGGCAGCAACAGTGTTCAATGGG - Intronic
966830736 3:184006148-184006170 AGGTAACAACAGTGTGCGATTGG - Intronic
970534456 4:17015603-17015625 AGTAAACAACAGTGTGGTATTGG - Intergenic
977926496 4:102705828-102705850 AGGTACCAACAGTGGTGGATGGG - Intronic
984872204 4:184335764-184335786 AGGTATCAAGACTGTGCAATAGG - Intergenic
1001213091 5:169829075-169829097 AGGAAACACTAGTTTGCGATTGG + Intronic
1004614491 6:17277521-17277543 AGATAACAAATGTGTGTGATAGG - Intergenic
1004732137 6:18368248-18368270 ACATAACCACAGTGTGCGAGGGG + Intergenic
1006215803 6:32441626-32441648 AGGTAACCACCGTGTGGGTTTGG + Intronic
1012704582 6:102505502-102505524 AGGTTACAACAGTGTGGGGAGGG - Intergenic
1014596458 6:123347303-123347325 AGATAACAACTGTGTGTGACGGG - Intronic
1014752926 6:125273310-125273332 GGGTAACACCACTGTGGGATAGG + Intronic
1021604225 7:22394195-22394217 TGATAAAAACAGTGTGCAATAGG + Intergenic
1022656491 7:32323902-32323924 AGAAGACCACAGTGTGCGATGGG - Intergenic
1022920950 7:35014276-35014298 AGGTAAGAACCCTGTGCGACTGG + Intronic
1026764273 7:73150011-73150033 AGGTAACACAAGTGTTGGATGGG - Intergenic
1027040742 7:74959782-74959804 AGGTAACACAAGTGTTGGATGGG - Intergenic
1027082895 7:75242575-75242597 AGGTAACACAAGTGTTGGATGGG + Intergenic
1034234765 7:149558022-149558044 AGGTAACCTCAGTGTGCCATGGG + Intergenic
1034239540 7:149599252-149599274 AGGTAACCTCAGTGTGCCATGGG + Intergenic
1036224637 8:6947199-6947221 AGGTAAAAATAGTGAGAGATTGG + Intergenic
1039827370 8:41186352-41186374 AGGAAGCAACAGTTTGCTATTGG - Intergenic
1042090508 8:65154085-65154107 ATGAAACAACAGTGTGCAATGGG - Intergenic
1045903697 8:107316434-107316456 TGGTAACAACACTGTATGATAGG - Intronic
1055476120 9:76665459-76665481 AGGTAAGCACAGGGTGCTATGGG - Intronic
1193160068 X:78217656-78217678 AGGAAACAACAGTTTGCATTAGG + Intergenic
1193206165 X:78750365-78750387 ATGTAACAATAGTGTACGTTTGG + Intronic
1196891651 X:120296570-120296592 AGGTAAAAACAAAGTGCTATAGG + Intronic