ID: 966830737

View in Genome Browser
Species Human (GRCh38)
Location 3:184006155-184006177
Sequence CACACTGTTGTTACCTCAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966830732_966830737 13 Left 966830732 3:184006119-184006141 CCAAGCATGAGAGCCACCTGGGC 0: 1
1: 0
2: 1
3: 13
4: 205
Right 966830737 3:184006155-184006177 CACACTGTTGTTACCTCAGCCGG 0: 1
1: 0
2: 1
3: 9
4: 146
966830733_966830737 0 Left 966830733 3:184006132-184006154 CCACCTGGGCTCCACACCAATCG 0: 1
1: 0
2: 0
3: 7
4: 121
Right 966830737 3:184006155-184006177 CACACTGTTGTTACCTCAGCCGG 0: 1
1: 0
2: 1
3: 9
4: 146
966830734_966830737 -3 Left 966830734 3:184006135-184006157 CCTGGGCTCCACACCAATCGCAC 0: 1
1: 0
2: 0
3: 8
4: 104
Right 966830737 3:184006155-184006177 CACACTGTTGTTACCTCAGCCGG 0: 1
1: 0
2: 1
3: 9
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966830737 Original CRISPR CACACTGTTGTTACCTCAGC CGG Intronic
901223165 1:7595632-7595654 CTCACTGGTGTCACCTCAGAGGG - Intronic
903720472 1:25401819-25401841 CACACTTTTGTAACCTCATTTGG + Intronic
907179940 1:52560751-52560773 TACACTCTTGTCACCTAAGCTGG + Intergenic
907633172 1:56105654-56105676 CTTTCTGTTGTTACCTCACCAGG - Intergenic
907667434 1:56445922-56445944 CTCACTCTTGTTACCCAAGCTGG + Intergenic
909999188 1:82321768-82321790 CAAAGTGTTGGTACCACAGCGGG + Intergenic
910429832 1:87149532-87149554 CAAACTGCTGTTATCTCAGCAGG + Intronic
913197093 1:116466176-116466198 CACAGTGTACTTACCTAAGCAGG + Intergenic
919862315 1:201748435-201748457 TGCACTGCAGTTACCTCAGCAGG + Intronic
1064650828 10:17507682-17507704 CACACATCTGGTACCTCAGCTGG - Intergenic
1065939897 10:30555036-30555058 CTCACTGTTGTTACCCGGGCTGG + Intergenic
1068304944 10:55196247-55196269 CACACTGTAGTTATCTGAGTAGG + Intronic
1069143893 10:64864096-64864118 CAAGCTGTTTTTACCTCACCTGG + Intergenic
1071299713 10:84247527-84247549 CACACTGTTCTGACCCCAGCTGG + Intronic
1071595247 10:86917513-86917535 CTCACTGCTGTTTCTTCAGCTGG - Intronic
1072659770 10:97356645-97356667 CACACTGTTCTTACCCCTGGAGG + Intronic
1079837726 11:25355227-25355249 CACACAGTTGTTGCCTTTGCAGG - Intergenic
1089379381 11:118016519-118016541 CACACTCCTGGTACCTCATCGGG - Intergenic
1093058880 12:14582376-14582398 CTCACTCTTGTTCCCTAAGCTGG + Intergenic
1095451600 12:42337291-42337313 TTCACTCTTGTCACCTCAGCTGG + Intronic
1100385301 12:94100431-94100453 CTGACTCTTGTTACCTCACCTGG + Intergenic
1102193224 12:111005033-111005055 CTCACTCTTGTTGCCTAAGCTGG - Intergenic
1104387799 12:128365979-128366001 CCCACTGCTGTAAACTCAGCTGG + Intronic
1104389220 12:128377380-128377402 GACTCTGTTTTTGCCTCAGCGGG + Intronic
1106966482 13:35077212-35077234 CACAATCTTGTTACCTAGGCTGG + Intronic
1107479629 13:40774857-40774879 CACACATCTGATACCTCAGCTGG + Intergenic
1108604744 13:52026260-52026282 CACAGTGCTGTTCCCTCTGCTGG - Intronic
1108833856 13:54515542-54515564 CACTCTGTTGTTTCCTTTGCAGG - Intergenic
1109088783 13:58011719-58011741 CACACCATTGTTATCTCAACTGG + Intergenic
1111257715 13:85694360-85694382 CATCCTCTTGTTTCCTCAGCAGG - Intergenic
1114385009 14:22245009-22245031 GACATTGTTGTTTCCTCTGCAGG + Intergenic
1117542336 14:56760521-56760543 CACACTGTTTTTCCTTCAGTTGG - Intergenic
1123159372 14:106263140-106263162 CTCACTGTTGTTGCCTGGGCTGG - Intergenic
1202847372 14_GL000009v2_random:192121-192143 CACACTGTAGTTAGCACAACTGG - Intergenic
1202916839 14_GL000194v1_random:182679-182701 CACACTGTAGTTAGCACAACTGG - Intergenic
1202852976 14_GL000225v1_random:32522-32544 CAGACAATTGTTACATCAGCTGG + Intergenic
1202859614 14_GL000225v1_random:72988-73010 CCCGCTGTTGCTGCCTCAGCTGG + Intergenic
1202862284 14_GL000225v1_random:90278-90300 CCCACTGGTGCTCCCTCAGCTGG + Intergenic
1202863394 14_GL000225v1_random:99592-99614 CAGACAATTGTTACATCAGCTGG - Intergenic
1127522193 15:59754078-59754100 CTCACTGTTGTCACCCAAGCTGG - Intergenic
1127964054 15:63910751-63910773 CTCACTGTTGTTGCCTGGGCTGG + Intronic
1130034177 15:80342403-80342425 CTCACTGTTGTTAACTCTGCAGG + Intergenic
1132489467 16:218161-218183 GTCACTGTTGTTGCCTCGGCTGG - Intronic
1133141868 16:3751024-3751046 CTCACTGTTGTTACCCAGGCTGG - Intronic
1138630137 16:58287404-58287426 CACAGCGTTGTTACCTCAGCAGG - Intronic
1144497834 17:15759863-15759885 CTCACTGTTGTCACCTGGGCTGG - Intergenic
1145161204 17:20574913-20574935 CTCACTGTTGTCACCTGGGCTGG - Intergenic
1145952379 17:28829242-28829264 TTCACTCTTGTTGCCTCAGCTGG + Intronic
1146647056 17:34582497-34582519 CCCCCTGGTGTTACCTCAGCCGG - Intronic
1146782957 17:35692556-35692578 CACTCAGTTTTTTCCTCAGCTGG + Intronic
1148874568 17:50679222-50679244 CACATTGTTAATACCTCAGGTGG + Intronic
1150041134 17:61862992-61863014 GACACTATTGTTGCCACAGCCGG - Intronic
1150835811 17:68563354-68563376 CTCACTCTTGTTGCCTCGGCTGG - Intronic
1151605125 17:75131056-75131078 CACAGTGGTGGTACTTCAGCAGG + Exonic
1156270067 18:35522505-35522527 GACAGTGTTGTTACCTCTGAAGG - Intergenic
1157589490 18:48827853-48827875 CACAGTGAAGTTAACTCAGCGGG + Intronic
1159372488 18:67546319-67546341 TTCACTGTTGTTACCTAGGCTGG + Intergenic
1168333569 19:55584153-55584175 TACACTCTTGTTGCCTAAGCTGG + Intergenic
925000855 2:401812-401834 TACACTTTTGTCACCTCAGGTGG - Intergenic
926478510 2:13358312-13358334 CACACTTTCTTTACCTCATCTGG - Intergenic
926956855 2:18311188-18311210 CACACTCTTATTACCCCAGTTGG - Intronic
928397532 2:30954388-30954410 TTCACTCTTGTTGCCTCAGCTGG + Intronic
928529006 2:32171720-32171742 TACACTCTTGTTGCCTAAGCTGG + Intronic
930693562 2:54388821-54388843 AACATTGCTGTTACCTCAGGAGG - Intergenic
931183958 2:59931488-59931510 CACACCATTGTGTCCTCAGCAGG - Intergenic
931874974 2:66502649-66502671 CCCACTGTGGTTACTTCACCTGG - Intronic
933368673 2:81388069-81388091 AACACTTTTATTACCTCAGAGGG - Intergenic
933769221 2:85732693-85732715 CACAGTGGTGTTAGCTCAGTGGG + Intergenic
935384083 2:102483136-102483158 GACACTGCTGTGACCTCTGCTGG + Intronic
936815592 2:116456634-116456656 CCCACTGCTGTTACCACAGAGGG - Intergenic
938878707 2:135561686-135561708 CTCACTTTTGTCACCTAAGCTGG - Intronic
942134382 2:172910574-172910596 CACACTGTCTTGGCCTCAGCTGG + Intronic
944010325 2:194966669-194966691 CACACTGTTCTTACCTCCAGAGG + Intergenic
944096047 2:195968866-195968888 AAAACTGTTCTGACCTCAGCTGG - Intronic
945027637 2:205634211-205634233 CACACTGATATTACCTCATAGGG + Intergenic
947107822 2:226685990-226686012 CTCACTTTTGTTGCCTAAGCTGG - Intergenic
948119789 2:235521116-235521138 CACACTGTTGGAAGCTCTGCTGG - Intronic
948496472 2:238353164-238353186 TCCACTGCTGTTACCTGAGCAGG - Exonic
948779035 2:240305774-240305796 CAAACTGCTGGTGCCTCAGCAGG + Intergenic
1169830759 20:9822257-9822279 CACTCTGTTGTTACCCAGGCTGG - Intronic
1171383670 20:24752706-24752728 CACTCTGTTGGGAGCTCAGCTGG + Intergenic
1171400588 20:24870979-24871001 CACAGTGTTGGGGCCTCAGCTGG - Intergenic
1179183697 21:39066990-39067012 CAGACTGTTAGTCCCTCAGCAGG + Intergenic
1182955208 22:34417931-34417953 CTCACTGTTGTCACCTGGGCTGG - Intergenic
1183554224 22:38512706-38512728 CACTCTGTTGTTACCTTGGTTGG + Intergenic
951209309 3:19957122-19957144 CTCACTGTTGGTGCCTAAGCTGG + Intronic
952723284 3:36555709-36555731 CAATCTGCTGTTACTTCAGCTGG - Intergenic
953870716 3:46625321-46625343 CACACTATTGTTTCCCCACCTGG + Intronic
954501834 3:51025039-51025061 CCCACTGTTATTACGGCAGCTGG - Intronic
957349786 3:79008968-79008990 CTCGCTGTTGTCACCTGAGCTGG + Intronic
961250254 3:125497463-125497485 CATTCTGTTCTTACTTCAGCAGG + Intronic
962778248 3:138684924-138684946 GACACTATTTTTACTTCAGCTGG - Intronic
963407534 3:144886042-144886064 CACTTTGTTTTGACCTCAGCGGG + Intergenic
963928997 3:150982504-150982526 CAGTCTCTTGTGACCTCAGCAGG + Intergenic
964094594 3:152916862-152916884 TTCACTCTTGTTGCCTCAGCTGG - Intergenic
965841201 3:172907603-172907625 TTCACTGTTGTTACCCAAGCAGG + Intronic
966830737 3:184006155-184006177 CACACTGTTGTTACCTCAGCCGG + Intronic
968326276 3:197819684-197819706 CTCACTGTTGTCACCCGAGCTGG - Intronic
974573620 4:63688309-63688331 CAAACTGTTCTAACCTCTGCCGG - Intergenic
975780786 4:77837555-77837577 CACTCTGTTGTTACCCAGGCTGG - Intergenic
977755831 4:100670603-100670625 CACAATATTCTTACCTCATCTGG - Intronic
977936860 4:102816223-102816245 CAGAATTTTGTTCCCTCAGCTGG + Intronic
978407792 4:108398343-108398365 CACAATGTTGATACTTCAGGGGG - Intergenic
978643742 4:110903355-110903377 CAAACTGATGTTACTTCATCTGG - Intergenic
980435277 4:132764228-132764250 CTCACTGTTGTTGCCTGGGCTGG + Intergenic
982366057 4:154580158-154580180 CACTCTGTTGTTACCTAGGGTGG - Intergenic
985510930 5:313491-313513 CTCACTCTTGTCACCCCAGCTGG + Intronic
987849840 5:23337294-23337316 CAAACTGTCTTTACCACAGCAGG - Intergenic
994550739 5:101231778-101231800 CCCACTGTTGCTACTGCAGCTGG - Intergenic
997059790 5:130487812-130487834 CACACCTTTGCTGCCTCAGCTGG - Intergenic
998523316 5:142819597-142819619 CAAACTGATGTTACCTGAACAGG + Intronic
999858525 5:155620824-155620846 CACACTGCTCTTCTCTCAGCAGG - Intergenic
1000783184 5:165510405-165510427 CTCACTCTTGTCGCCTCAGCTGG - Intergenic
1004413182 6:15400515-15400537 CACACTTTTGTGTCCCCAGCCGG - Intronic
1009974331 6:70657130-70657152 CTCACTCTTGTTGCCTAAGCTGG + Intergenic
1010771573 6:79838001-79838023 GACACTGTTGTAACCTCAGGTGG - Intergenic
1012483607 6:99695048-99695070 CTCACTGTTGTCACCTGGGCTGG - Intergenic
1014465088 6:121746327-121746349 CACAATGTTTTGACCTCATCAGG + Intergenic
1014837165 6:126172673-126172695 CTCACAGCTGTTACCTCTGCAGG + Intergenic
1015058933 6:128938924-128938946 TGCACTGTTGTTACCTCTTCAGG + Intronic
1016022492 6:139250680-139250702 GACACTGTGGTCTCCTCAGCTGG + Intronic
1016577297 6:145583975-145583997 CACACAGTTGCTGCCTCTGCTGG - Intronic
1017070494 6:150571727-150571749 CACTCTGCTGTTCCCTCTGCAGG + Intergenic
1018660138 6:166078321-166078343 CACACTGTTGTTTTCTTGGCTGG - Intergenic
1019166571 6:170101393-170101415 CACAGTGTTGTTGGCTGAGCCGG - Intergenic
1020177129 7:5891189-5891211 CACAGTGGTGTGATCTCAGCTGG - Intergenic
1021491340 7:21222416-21222438 CTCACTGTTGATACCTCTGCAGG + Intergenic
1022483677 7:30760974-30760996 CACACAGGTGTTCCCTCTGCTGG - Intronic
1022571982 7:31463337-31463359 AACACTTTTGTTACCTCATGAGG + Intergenic
1023030337 7:36085174-36085196 CACACTGTTAACTCCTCAGCCGG - Exonic
1023177021 7:37445477-37445499 CACACTGTGCTTACTTCATCAGG - Intronic
1023269054 7:38439721-38439743 CCCACTGTGGTTTCCACAGCTGG - Intronic
1027270705 7:76516970-76516992 CACTATGTTGTTGCCCCAGCTGG - Intergenic
1028569439 7:92270090-92270112 CTCACTGTTGTCACCCAAGCTGG + Intronic
1036389840 8:8316011-8316033 CTCACTCTTGTTACCCAAGCTGG + Intergenic
1037528422 8:19750256-19750278 CCCTTTGTTGTTACCTAAGCTGG - Intronic
1038151427 8:24944489-24944511 CACAGTGTTGTTTCCTAAGCCGG + Intergenic
1039266977 8:35836169-35836191 CACACTGTAGTTAACTCATTTGG + Intergenic
1042865423 8:73352786-73352808 CAGACTGTTGTAACCTCACATGG - Intergenic
1046929669 8:119829427-119829449 CTCACTGTTGATAGCTCAGAGGG + Intronic
1047022096 8:120785758-120785780 CCCACTGTTACTACCACAGCTGG + Intronic
1048216889 8:132504470-132504492 CAAACAGTGGTTACCTCTGCTGG + Intergenic
1048676314 8:136785978-136786000 CACTCTGTTGTTTCCTTTGCTGG - Intergenic
1049731073 8:144178837-144178859 CACACTGTCCTTGCCTCAACTGG - Intronic
1050355511 9:4779233-4779255 CTCACTTTTGTTACCCCAGCTGG - Intergenic
1051080084 9:13283855-13283877 CACACTGAGATTACCTCAGTCGG + Intergenic
1051318253 9:15867526-15867548 CACACAGGTGTTAACACAGCTGG + Intronic
1053491380 9:38506930-38506952 CCTACTGTTGTTATCTCAGTTGG - Intergenic
1057581642 9:96292394-96292416 CTCACTCTTGTCACCTAAGCTGG + Intronic
1058294725 9:103291391-103291413 CTCACTGTTGTCACCTGGGCTGG - Intergenic
1058869192 9:109187940-109187962 CAGACTGTTGTTACGTGAGAAGG + Intronic
1059030609 9:110691366-110691388 GACACTGTTGTTAGCTGAGAAGG - Intronic
1186663386 X:11692736-11692758 CACAATGTTGTTGCCCAAGCTGG + Intergenic
1187420981 X:19133492-19133514 CACATTGTTGTTGGCTCATCTGG + Intergenic
1192021995 X:67403603-67403625 CCCACTGTTATTACCACAGCTGG - Intergenic
1196977884 X:121180171-121180193 CCCACTGCTATTACCACAGCTGG - Intergenic
1199527515 X:148809003-148809025 CCCACTGTTCTTACCAGAGCAGG + Intronic