ID: 966830738

View in Genome Browser
Species Human (GRCh38)
Location 3:184006165-184006187
Sequence TTACCTCAGCCGGAGATCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 44}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966830734_966830738 7 Left 966830734 3:184006135-184006157 CCTGGGCTCCACACCAATCGCAC 0: 1
1: 0
2: 0
3: 8
4: 104
Right 966830738 3:184006165-184006187 TTACCTCAGCCGGAGATCTCTGG 0: 1
1: 0
2: 0
3: 6
4: 44
966830732_966830738 23 Left 966830732 3:184006119-184006141 CCAAGCATGAGAGCCACCTGGGC 0: 1
1: 0
2: 1
3: 13
4: 205
Right 966830738 3:184006165-184006187 TTACCTCAGCCGGAGATCTCTGG 0: 1
1: 0
2: 0
3: 6
4: 44
966830736_966830738 -6 Left 966830736 3:184006148-184006170 CCAATCGCACACTGTTGTTACCT 0: 1
1: 0
2: 0
3: 6
4: 56
Right 966830738 3:184006165-184006187 TTACCTCAGCCGGAGATCTCTGG 0: 1
1: 0
2: 0
3: 6
4: 44
966830735_966830738 -1 Left 966830735 3:184006143-184006165 CCACACCAATCGCACACTGTTGT 0: 1
1: 0
2: 0
3: 6
4: 72
Right 966830738 3:184006165-184006187 TTACCTCAGCCGGAGATCTCTGG 0: 1
1: 0
2: 0
3: 6
4: 44
966830733_966830738 10 Left 966830733 3:184006132-184006154 CCACCTGGGCTCCACACCAATCG 0: 1
1: 0
2: 0
3: 7
4: 121
Right 966830738 3:184006165-184006187 TTACCTCAGCCGGAGATCTCTGG 0: 1
1: 0
2: 0
3: 6
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966830738 Original CRISPR TTACCTCAGCCGGAGATCTC TGG Intronic
900298823 1:1966402-1966424 TTAGCTGAGCCCGAGATCTCTGG - Exonic
905132265 1:35769917-35769939 TTCCCTCAGCCGGAGAGCAGCGG + Exonic
916180037 1:162075429-162075451 TAACCTCAGCAGGATATCTGTGG + Intronic
918110655 1:181452557-181452579 CTACCTCAGCCAGGGCTCTCAGG + Intronic
1066062641 10:31737614-31737636 TTACCTCAGCAGCAGTTTTCAGG + Intergenic
1080762390 11:35264388-35264410 TGAACCCAGCCAGAGATCTCTGG - Intronic
1083352385 11:62040093-62040115 TTACCTCAGCCTCAGATTACAGG + Intergenic
1084955225 11:72687648-72687670 TTTCCTCAGCCTGGGATCTCAGG + Intronic
1094054318 12:26253368-26253390 TTTCCTCACCAGGAGATCTTAGG + Intronic
1113463400 13:110497137-110497159 TAACCTCAGCCAGGGATCTAGGG + Intronic
1118080756 14:62357526-62357548 TTAACTCAGCCAGAGATTTTAGG + Intergenic
1131981039 15:97995039-97995061 GAACCTCAGCTGGAGACCTCAGG + Intergenic
1149645598 17:58239190-58239212 TTCCCTAAGCCGGAGCTGTCAGG + Intronic
1151372801 17:73659550-73659572 TGGCCTCAGCTGGAGATGTCTGG + Intergenic
1158380728 18:56927245-56927267 TCAGCTCAGCAGGAGATGTCGGG - Intronic
1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG + Intronic
1162665734 19:12210238-12210260 TTGCCTCAGCCTGAGATTACAGG + Intergenic
926306054 2:11637895-11637917 TTACCTGAACCTGGGATCTCAGG + Exonic
929789465 2:45012746-45012768 TTCCATCAGCCTGAGATCACTGG - Intergenic
938134044 2:128739206-128739228 GTCCCTCAGCCTGAGATCTCAGG - Intergenic
947827054 2:233113651-233113673 TTACTGCAGCCAGAGATCTAGGG + Intronic
948801674 2:240436063-240436085 GTGCCCCAGGCGGAGATCTCGGG + Exonic
948960069 2:241327966-241327988 TCACCTCAGCCTGAGACGTCAGG + Intronic
1181599647 22:23941941-23941963 TCATATCAGCCAGAGATCTCTGG - Intergenic
1181608860 22:23999365-23999387 TCATATCAGCCAGAGATCTCTGG + Intergenic
1182219138 22:28743957-28743979 TTTCTTCAGCCAGAGGTCTCAGG + Exonic
949584598 3:5425420-5425442 TCCCCTCAGCTGGAGATTTCTGG - Intergenic
960161232 3:114352128-114352150 CTACCTCAGCCGAAGCTCTGGGG - Intronic
963143185 3:141964842-141964864 TTACCTCATCTGGAAATGTCTGG - Intronic
963904399 3:150762389-150762411 GTACCTCCGCCGGTGACCTCAGG - Intronic
966830738 3:184006165-184006187 TTACCTCAGCCGGAGATCTCTGG + Intronic
969145947 4:5124219-5124241 TTAGAACAGCCGGAGATTTCGGG - Intronic
990769735 5:59229700-59229722 TTACCTCAGATGCAGATCTGAGG - Intronic
991603128 5:68373239-68373261 TGACGTCAGCCTGAGGTCTCAGG - Intergenic
995433513 5:112109373-112109395 TTGCCTCAGCTGGAGATGCCTGG + Intergenic
997439631 5:133900002-133900024 TTGCATCCGCAGGAGATCTCTGG - Intergenic
1000779686 5:165465172-165465194 TTACCACAGCCGGTGCTCTCTGG + Intergenic
1001429299 5:171646825-171646847 TTCTCTCAGCCAGAGAACTCGGG - Intergenic
1015926048 6:138311489-138311511 TTACCTCAGGCGCTGCTCTCAGG + Exonic
1018841623 6:167521594-167521616 TTTCCTGAGCCTGTGATCTCTGG - Intergenic
1018871490 6:167787065-167787087 TTAATTGAGCCTGAGATCTCAGG + Intronic
1021815976 7:24448021-24448043 TTACCTGAGCGGGAGAAGTCAGG + Intergenic
1033007169 7:137578725-137578747 TTATCTCAGCCCGATATCCCTGG - Intronic
1042358442 8:67855070-67855092 GAGCCTCAGCAGGAGATCTCTGG + Intergenic
1043549176 8:81349515-81349537 TTTCCACAGTCAGAGATCTCAGG - Intergenic
1045894883 8:107202892-107202914 TTGCCTCTGCCAGAGATCTGTGG - Intergenic
1051073939 9:13207492-13207514 TTACCTCAGCCTGGACTCTCTGG + Intronic
1055136686 9:72837274-72837296 ACACCTGAGCCGGAGATCTTAGG - Intergenic
1186081596 X:5939177-5939199 GTACCTCAGCCATAGAGCTCTGG + Intronic
1190736485 X:53258729-53258751 CTGCCTCAGCAGGAGATTTCAGG - Intronic
1196933322 X:120703886-120703908 TTACCTCAGTCAGATATCTCTGG + Intergenic