ID: 966830948

View in Genome Browser
Species Human (GRCh38)
Location 3:184008134-184008156
Sequence GCTTCTATTGGTGGACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966830944_966830948 30 Left 966830944 3:184008081-184008103 CCCACAGCATCTAAATTACAGTC 0: 1
1: 0
2: 0
3: 10
4: 153
Right 966830948 3:184008134-184008156 GCTTCTATTGGTGGACAAGCAGG 0: 1
1: 0
2: 1
3: 7
4: 103
966830945_966830948 29 Left 966830945 3:184008082-184008104 CCACAGCATCTAAATTACAGTCA 0: 1
1: 0
2: 0
3: 16
4: 180
Right 966830948 3:184008134-184008156 GCTTCTATTGGTGGACAAGCAGG 0: 1
1: 0
2: 1
3: 7
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966830948 Original CRISPR GCTTCTATTGGTGGACAAGC AGG Intronic
900177770 1:1298375-1298397 GCTTCTTCTGGTAGACCAGCTGG + Exonic
901871778 1:12142647-12142669 GCATCTAGTGGTGGACCGGCCGG + Exonic
906922437 1:50078842-50078864 GCGTCTGTTGGTGGCCATGCAGG + Intronic
908424567 1:63993766-63993788 TCTGCTATTGCTGGACAAGTAGG + Intronic
909242455 1:73231947-73231969 TCTGCTATTGATGGACATGCAGG - Intergenic
913091756 1:115480844-115480866 GCTGCTGATGCTGGACAAGCAGG + Intergenic
915267808 1:154731482-154731504 GCTGATATTGGTGGACCAGACGG - Intronic
919418573 1:197341918-197341940 GCTTCCTTGGGTGGACAAGGGGG + Intronic
1064743518 10:18456887-18456909 TCATCTATTGGTGGACATTCGGG + Intronic
1065112754 10:22455836-22455858 GTTTCTATTGGTAGACTAGGCGG + Intergenic
1067508494 10:46876320-46876342 GCTTCCCTTGGAGGACAAGTGGG + Intergenic
1067653754 10:48175529-48175551 GCTTCCCTTGGAGGACAAGTGGG - Intronic
1072940016 10:99754242-99754264 GCTTTAATTGAGGGACAAGCAGG + Intronic
1075633465 10:124015355-124015377 GTTTCTATTGGTGAATCAGCTGG - Intronic
1078134462 11:8640610-8640632 GCTTCTGGTGGTGGCCAAACTGG + Exonic
1078350077 11:10585901-10585923 GCTTCTATTGAAAGAAAAGCGGG - Intronic
1079901719 11:26195064-26195086 ACTTCTATTGGTAGAAAAACAGG - Intergenic
1081092951 11:38895754-38895776 GCTTGTATTGGTGGAAAAACTGG - Intergenic
1084530225 11:69722944-69722966 GCTTCTCCTGCTGGAGAAGCAGG + Intergenic
1085358130 11:75858505-75858527 GCTCCTATTGGTGGACACTTAGG + Intronic
1090492255 11:127175177-127175199 GCTTTTAATGAAGGACAAGCAGG + Intergenic
1095597022 12:43970719-43970741 GCGTCCATTGGTGGACAAGAGGG + Intronic
1098126343 12:67297630-67297652 GCTGCTATTAGTAGGCAAGCTGG + Exonic
1102150122 12:110683539-110683561 TCATCCATTGATGGACAAGCGGG - Intronic
1110443040 13:75546525-75546547 GCTTCTATTCAAAGACAAGCAGG - Intronic
1115718493 14:36132889-36132911 TCATCTATTGGTGGACACTCAGG + Intergenic
1118708401 14:68500819-68500841 GCCTCTATTTGTGGCAAAGCAGG - Intronic
1118737219 14:68710641-68710663 TCTTCTACTGGTGGAGCAGCTGG - Intronic
1123485964 15:20739154-20739176 GCATCTACATGTGGACAAGCAGG + Intergenic
1123542453 15:21308224-21308246 GCATCTACATGTGGACAAGCAGG + Intergenic
1129725992 15:77901995-77902017 GCTTCCATTGGTGGAAAATGGGG - Intergenic
1130274048 15:82467367-82467389 GCTTCCATTGGTGGAAAATGGGG - Intergenic
1130466396 15:84194741-84194763 GCTTCCATTGGTGGAAAATGGGG - Intergenic
1130497868 15:84478795-84478817 GCTTCCATTGGTGGAAAATGGGG + Intergenic
1130588690 15:85199334-85199356 GCTTCCATTGGTGGAAAATGGGG - Intergenic
1131435797 15:92420544-92420566 GCTTTTATTGGTGTACAAAAAGG - Intronic
1131551321 15:93359615-93359637 GCTTCTGTTTGTGGAAGAGCAGG + Intergenic
1202950770 15_KI270727v1_random:35365-35387 GCATCTACATGTGGACAAGCAGG + Intergenic
1133034635 16:3028009-3028031 GCTTCTTTTGGAAGACAATCTGG + Exonic
1134204342 16:12224751-12224773 GCTTGTCTTGGTGGACTATCTGG - Intronic
1142013809 16:87732893-87732915 GCTTCTATAGGTGAAAAGGCAGG + Intronic
1142013815 16:87732937-87732959 GCTTCTATAGGTGAAAAGGCAGG + Intronic
1142013821 16:87732981-87733003 GCTTCTATAGGTGAAAAGGCAGG + Intronic
1142013827 16:87733025-87733047 GCTTCTATCGGTGAAAAGGCAGG + Intronic
1142013839 16:87733113-87733135 GCTTCTATCGGTGAAAAGGCAGG + Intronic
1146457236 17:33017466-33017488 GACTCTATTGGTGGACAGGAGGG + Intronic
1146780296 17:35664932-35664954 GCTTCTATCAGTGGAAAAGTAGG - Intronic
1161125539 19:2555402-2555424 GCTTCTCTTGCTGGACAACAGGG + Intronic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
1168420336 19:56197804-56197826 GCGTCTATTTATGGAGAAGCGGG + Exonic
1168424543 19:56228322-56228344 GCGTCTATTTATGGAGAAGCGGG + Intronic
1168585922 19:57591792-57591814 GCTTTTATTAGTGCACAAACTGG - Exonic
925196717 2:1931728-1931750 CCTTCTATTGGTGGATAAGTAGG - Intronic
926150596 2:10423556-10423578 GCTGCTGTAGGTGGACAAGGTGG - Intronic
928519136 2:32071116-32071138 GCTCCTGTGGGTAGACAAGCCGG + Intronic
931273528 2:60723542-60723564 GCTTCTCATGTTGGTCAAGCTGG + Intergenic
934122805 2:88856393-88856415 CATTCTATTGTTGGACAATCGGG + Intergenic
934934195 2:98452657-98452679 ACTTATATGGGTGGACAAGCTGG - Intronic
935314163 2:101815217-101815239 TCTTCTATTGGTGGGAAAGTAGG + Intronic
935411891 2:102772607-102772629 GGTTCTATGGGGGTACAAGCTGG + Intronic
941526157 2:166609565-166609587 ACTTCTCTTGGTGTACAGGCAGG + Intergenic
946043937 2:216805248-216805270 GCCTTTATTGGCGGAGAAGCAGG - Intergenic
946758767 2:222972669-222972691 GATTCTAATGGGGGAAAAGCCGG + Intergenic
1168890207 20:1290583-1290605 TCTTCTATTGGTGGACATTTGGG + Intronic
1169088488 20:2841625-2841647 GATTCTATTGGGGGAGAATCAGG - Intronic
1169900645 20:10548860-10548882 TCTACTAATGGTGAACAAGCTGG - Intronic
1173222943 20:41144394-41144416 ACTTCCATCTGTGGACAAGCTGG + Intronic
1178710169 21:34910023-34910045 GCTTCTTTCAGTGGCCAAGCTGG - Intronic
1183963363 22:41426279-41426301 ACTTCTACTGGTGGAAGAGCTGG - Intergenic
1184199360 22:42955426-42955448 GCTTTTATTGGTAGACATGCAGG - Intronic
952027287 3:29098899-29098921 GCCTTCAGTGGTGGACAAGCAGG + Intergenic
954530122 3:51311173-51311195 GCTGCTCTTGCAGGACAAGCTGG - Intronic
956527480 3:70180969-70180991 GCTTATGTTGGGGGACTAGCTGG + Intergenic
965257892 3:166440114-166440136 GCTGCTATTGGTGGGAAATCTGG + Intergenic
966181650 3:177194142-177194164 GTTTCTATTGGTGGCAGAGCAGG + Intronic
966830948 3:184008134-184008156 GCTTCTATTGGTGGACAAGCAGG + Intronic
974087678 4:57278670-57278692 GCTTCTATAAGTGGAGAAGGGGG - Intergenic
979538105 4:121847600-121847622 GCTGATATTGGTGGACAAAGGGG - Intronic
980375715 4:131945778-131945800 TCATCTATTGGTGGACACTCAGG - Intergenic
980744481 4:136997902-136997924 GCTTCCATTTGTAGACAACCTGG + Intergenic
985023874 4:185720087-185720109 GCTTCCCTTGGTGGTCAAGAGGG - Intronic
986990369 5:13545647-13545669 GCTGCTATTCGTGGGCAACCTGG + Intergenic
990369747 5:55105260-55105282 GCTTCTGTGGGTGGAAAAACAGG + Intronic
1004589124 6:17031717-17031739 GCTTCTACTTGAGGACAAGCAGG + Intergenic
1015855576 6:137621167-137621189 CCGTCTATTCCTGGACAAGCAGG - Intergenic
1019748395 7:2713367-2713389 GCTTCTCGTGGAGTACAAGCCGG + Exonic
1019916593 7:4136978-4137000 GCTGCTGTTGGTGGGCAAGTGGG - Intronic
1022706356 7:32805542-32805564 TCCTCTATTGGTGGACAATTGGG - Intergenic
1023277660 7:38537783-38537805 GCTTCCAGAGGTGGACAAGTTGG + Intronic
1024043432 7:45572585-45572607 GCTCCTATTTGGGGATAAGCAGG + Intergenic
1029881129 7:103811213-103811235 GCTTCTATTGCCCCACAAGCAGG - Intronic
1032007036 7:128310862-128310884 GCTTATATTGTTCGACCAGCTGG + Exonic
1033622668 7:143076358-143076380 GCTTCTTTTGGAGGATGAGCTGG + Intergenic
1036607275 8:10318668-10318690 GATTCAATGGGTAGACAAGCAGG + Intronic
1041753728 8:61289710-61289732 GCCTCTAATGGTGAGCAAGCTGG - Intronic
1047634265 8:126743577-126743599 GCTTGCAGTGGTGGACAAGAGGG + Intergenic
1051058753 9:13020977-13020999 CCATCTATTGATGGACATGCAGG - Intergenic
1057486662 9:95490184-95490206 GCTTCTATGGTTGGACATGGTGG + Intronic
1058954797 9:109935923-109935945 GCTTCTATTTTTGGTCAAGAAGG - Intronic
1059386535 9:113969181-113969203 GAGTCGATGGGTGGACAAGCTGG - Intronic
1060104398 9:120864460-120864482 GTTTCTAATGGTGGACAAATGGG + Intronic
1061634333 9:131897166-131897188 TCTCCTATTGGTGGACATTCGGG + Intronic
1062592289 9:137279775-137279797 GTTTCTGCTGCTGGACAAGCGGG + Exonic
1190649645 X:52556542-52556564 GATACTGTTGGTAGACAAGCTGG - Intergenic
1192639941 X:72852257-72852279 TCTTCTATTGATGGACACTCTGG + Intergenic
1192641770 X:72868548-72868570 TCTTCTATTGATGGACACTCTGG - Intergenic
1193549293 X:82871157-82871179 GCTTATTTTGGTGGATAAGTAGG + Intergenic
1194107148 X:89784546-89784568 TCTTCTGTTGGTGGACAATTAGG - Intergenic
1194475142 X:94348992-94349014 CCTTCTATTAGTAGAAAAGCAGG + Intergenic
1195278083 X:103301917-103301939 GCTTCTAGTTCTGGACAAGATGG - Intergenic
1199551108 X:149062299-149062321 GCTTCTATTGGTGAAAAATCAGG - Intergenic
1200459106 Y:3432408-3432430 TCTTCTGTTGGTGGACAATTAGG - Intergenic