ID: 966834529

View in Genome Browser
Species Human (GRCh38)
Location 3:184038788-184038810
Sequence CTGGGGAGGCAGAGCTGACA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 892
Summary {0: 1, 1: 1, 2: 7, 3: 77, 4: 806}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966834519_966834529 8 Left 966834519 3:184038757-184038779 CCAGAGGTATCAGCAGGGCAGAT 0: 2
1: 0
2: 1
3: 12
4: 151
Right 966834529 3:184038788-184038810 CTGGGGAGGCAGAGCTGACAGGG 0: 1
1: 1
2: 7
3: 77
4: 806

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966834529 Original CRISPR CTGGGGAGGCAGAGCTGACA GGG Exonic
900079702 1:846719-846741 CCAGGGAGGCTGAGCTGTCATGG + Intergenic
900269785 1:1781142-1781164 CTGGGGAGGCTGAGGAGAGAGGG + Intergenic
900298695 1:1965761-1965783 CTGGGGATGCCGGGCTGACCAGG - Intronic
900302609 1:1985665-1985687 CTGGGCAGGCAGTGCCCACATGG + Intronic
900338647 1:2177332-2177354 CGGGGGAGACTGAGCTGAGACGG - Intronic
900623013 1:3596045-3596067 CTGGGGAGACAGAGGAGACCTGG + Intronic
900905533 1:5554448-5554470 CTGGGGAGGCAGGCCTCAGAGGG + Intergenic
901042996 1:6376818-6376840 CCTGGGAGGCAGAGCGAACATGG + Intronic
901090493 1:6637637-6637659 CTCGGGTAGCAGAGCTGTCAGGG - Intronic
901179733 1:7333344-7333366 CAGGGGAGTCGGATCTGACACGG + Intronic
901325265 1:8361535-8361557 CTGGTGGTGCAGAGCAGACAGGG - Intronic
902061777 1:13650073-13650095 CCGGGGAGGCAGAGGTTGCAGGG - Intergenic
902351668 1:15860345-15860367 CTTGGGAGGCTGAGATGAGAGGG - Intronic
902380546 1:16050409-16050431 CTGGGGAGGAAGAGCAGGAATGG - Intronic
902447457 1:16476198-16476220 CTGGGGAGGGAGAGATGAGGAGG + Intergenic
902543799 1:17173461-17173483 TTTGGGAGGCAGATCCGACAGGG - Intergenic
902643197 1:17779845-17779867 CTGGGGAGGGAGACCTGGCTAGG + Intronic
902923473 1:19680764-19680786 TGGGGGAGGCAGGGCTGAAAAGG - Intergenic
902985065 1:20149955-20149977 CTGGGGAGGGAGAGCCGGGAAGG + Exonic
903041871 1:20536798-20536820 CTGGGGGGTCAGCTCTGACACGG - Intergenic
903127688 1:21258842-21258864 GTGGGGAGGGAGAGCAGGCAGGG + Intronic
903139735 1:21332283-21332305 CTGGGAACGCAGAGGTGAAAAGG + Intronic
903210647 1:21816213-21816235 CTGGAGGGGCAGAGCAGTCAGGG + Intronic
903386832 1:22932580-22932602 CTAGGGATGCAGAGAAGACATGG - Intergenic
903620146 1:24692199-24692221 CCCGGGAGGCAGAGGTTACAAGG + Intergenic
904263940 1:29306998-29307020 CAGGGCAGGCAGAGCGGAGACGG - Intronic
904448785 1:30597805-30597827 CTGGGGTGGGGGAGCTGCCAAGG - Intergenic
904458887 1:30663765-30663787 GTGGGGAAGCACAGCTGTCAGGG + Intergenic
904779622 1:32935820-32935842 CTGGGGAGGCAGAGGTTGCAGGG - Intergenic
905401938 1:37710073-37710095 CCGGGAAGGCAGATCTGCCAGGG - Intergenic
905416792 1:37809092-37809114 CTGGGGAGGGAGAGAAGTCAGGG - Exonic
905573309 1:39023748-39023770 CTGGAGAGGCAGAGGTTGCAGGG - Intergenic
906207375 1:43994336-43994358 CTTGGGAGGCTGAGGTGAGAAGG + Intronic
906318864 1:44804622-44804644 ATGGGGAGGCAGAGGTCAGAGGG - Intronic
907710665 1:56877473-56877495 CTGGAGAAGCAGAGATGACAAGG - Intronic
907923222 1:58932108-58932130 CTGGAGATGCAGAGGTGACTTGG - Intergenic
909614078 1:77587338-77587360 CCCGGGAGGCAGAGCTTGCAGGG - Intronic
911025734 1:93434247-93434269 CTGAGGAAGCAGAGATGTCAGGG - Intergenic
912710747 1:111948189-111948211 CTGTAGAGGCAGAGCAGAGAGGG - Intronic
912756435 1:112328776-112328798 CTTGTGGGGCAGAGCTGAGAGGG - Intergenic
913089165 1:115465032-115465054 CTGGGGAGGCAGGGGTGATGAGG - Intergenic
913341070 1:117758729-117758751 GCGGGGAGACAGAGGTGACAAGG + Intergenic
913509663 1:119550219-119550241 CTGGGGACAGAGAGATGACATGG - Intergenic
913513518 1:119583402-119583424 CTGGGGACAGAGAGATGACATGG - Intergenic
913517145 1:119614342-119614364 CTGGGGACAGAGAGATGACATGG - Intergenic
914813326 1:151045481-151045503 CCCGGGAAGCAGAGCTTACAGGG + Intronic
914821734 1:151109775-151109797 CTTGGGAGGCTGAGGTGAGAAGG - Intronic
914964413 1:152241353-152241375 CCTGGGAGGCAGAGCTTGCAGGG + Intergenic
915008533 1:152663376-152663398 CTGGGGAGTCAGAGCAGATGAGG - Exonic
915010976 1:152686103-152686125 CTGGGGAGTCAGAGCAGATGAGG - Exonic
915399229 1:155610402-155610424 CTGGGGAAGCAGAGAGGACGAGG - Intronic
915416344 1:155745982-155746004 CTGGGGAAGCAGAGAGGACGAGG - Intergenic
915765224 1:158355543-158355565 CAGGGGAGTCAGAACTGAAACGG + Exonic
915766134 1:158364579-158364601 CTGTGGATACATAGCTGACAAGG + Intergenic
916502160 1:165396508-165396530 GTGGGGAGGGAGAGCTGGGAGGG - Intergenic
916877673 1:168987328-168987350 CTGGGAAGGCAGAGGAGACCTGG - Intergenic
917116429 1:171608491-171608513 CTCGGGAGGCGGAGCTTGCAGGG - Intergenic
917329598 1:173868220-173868242 CTGAGGAGGAAGAGCAGAGAGGG + Intronic
917840914 1:178976770-178976792 CTGGTGGGGGAGGGCTGACATGG - Intergenic
918366474 1:183813152-183813174 CTGTGGCGGCAGAGTGGACAAGG + Intronic
918993568 1:191729019-191729041 CTGGAGAGACAGAGCCCACATGG - Intergenic
919065603 1:192689515-192689537 ATGGGGAGGCAGAGATGAAATGG - Intergenic
920144977 1:203852231-203852253 CTGTTGAGGCAGAGCTGAGTCGG - Exonic
920264606 1:204712377-204712399 CGAGCGAGGCAGAGATGACAGGG + Intergenic
920650381 1:207833023-207833045 CTTGGGAGGCAGAGCTTAGTGGG + Intergenic
920989411 1:210922304-210922326 CCTGGGAGGCAGAGCTTGCATGG + Intronic
920993352 1:210961762-210961784 CCTGGGAGGCAGAGGTTACAGGG + Intronic
921820331 1:219609773-219609795 CTGTTGAGGCAGAGCTGAGTCGG + Intergenic
922228009 1:223662371-223662393 CTGGGGAGGCAGAGGTTGCAGGG + Intronic
922412933 1:225393077-225393099 CTGGGGAGGAAGGGGAGACAGGG + Intronic
922737821 1:227998857-227998879 CTGGCGAGGCACAGGAGACATGG - Intergenic
922898529 1:229118997-229119019 CTGGGGACCCAGAGCTCACAAGG + Intergenic
922958798 1:229626611-229626633 CTGGGCAGGGAGTGCTGGCAGGG + Intronic
924781376 1:247151401-247151423 CTCGGGAGGCGGAGCTTGCAGGG + Intronic
1062841101 10:672481-672503 CTGGGGAGCCAGAGATGAGCAGG + Intronic
1063257752 10:4347577-4347599 CGGGGAAGGCAGAGCTGTCCAGG - Intergenic
1063743703 10:8855387-8855409 CTTGGGAGGCTGAGATGAGAGGG - Intergenic
1065212556 10:23418154-23418176 CTTGGGAGGCAGAGGTTGCAGGG + Intergenic
1065679135 10:28211204-28211226 CTAGGGAGGCTGAGGTGAGACGG - Intronic
1065867591 10:29927312-29927334 CTGGGGAGGCCTTGCTGAGAAGG - Intergenic
1065989185 10:30991302-30991324 CTGTAGAGGCACAGCTGAGAGGG + Intronic
1066265098 10:33769048-33769070 CTGGGGAGCAGGAACTGACACGG + Intergenic
1066343111 10:34555797-34555819 CTGGGGAGGCAGAGGTGTCCTGG + Intronic
1067078257 10:43200134-43200156 CTGGGCAGACAGGGCTGGCAGGG + Intronic
1067146526 10:43698213-43698235 CAGGCGAGGCAGAGCCCACATGG - Intergenic
1067556377 10:47276224-47276246 CTGGGGAGACTGAGGAGACACGG - Intergenic
1067982952 10:51107714-51107736 CTTGGGAGGCTGAGCTGGGAGGG + Intronic
1068042396 10:51841756-51841778 CCTGGGAGGCAGAGGTGGCAGGG - Intronic
1068927405 10:62554603-62554625 GTGGGGAGGGAGAACTGAAATGG - Intronic
1069547800 10:69341235-69341257 CTGGGGAAGCAGAGGTTGCAGGG - Intronic
1069679909 10:70277147-70277169 CTGGGGAGGCAGAGGCCAGATGG - Intronic
1069785595 10:70986052-70986074 AGGTGGAGGCAGAGCTAACAGGG + Intergenic
1069917332 10:71795721-71795743 GTGGGGACTCAGAGCTGACGGGG - Intronic
1069933143 10:71897022-71897044 CTGTGGAGGCAGAGAAGACAAGG - Intergenic
1070273071 10:74976665-74976687 CTGTGGCTGCAGAGGTGACATGG - Intronic
1070299781 10:75194858-75194880 CTTGGGAGGCTGAGGTGAAAAGG - Intergenic
1070493513 10:76999512-76999534 CTGGGGAGGAAGAGCAGAGGAGG - Intronic
1070824091 10:79380844-79380866 CTGGGGTGGCAGGGCTGGCCTGG + Intergenic
1070895783 10:79982147-79982169 CTGGCGGGGCAGGGCGGACATGG + Intronic
1071648532 10:87374804-87374826 CTGGGATGGCAGAGATGAAAAGG + Intergenic
1071961665 10:90813412-90813434 CTGGGGAGGCTGAGGCCACAGGG + Intronic
1072139673 10:92578317-92578339 TTTGGGAGGCAGAGGTGAGAGGG + Intergenic
1072569008 10:96642348-96642370 CTGGGGAGGCAGTGGTTACAGGG + Intronic
1073181916 10:101588475-101588497 CTGGGTCGGCAGAGCTGGAAGGG + Intronic
1073190375 10:101646599-101646621 CAGGGGACGCAGAGCTGGGAGGG + Intronic
1074519552 10:114206687-114206709 CCAGGGAGGCAGAGGTTACAGGG - Intronic
1075069706 10:119312871-119312893 CTGAGGACACAGAGCTGGCAAGG - Intronic
1075220272 10:120578638-120578660 CTGGGGAGGCAGAAAAGACCAGG - Intronic
1075246688 10:120828736-120828758 ATGGAGAGGCAGAGCTGGCTGGG + Intergenic
1075565501 10:123500733-123500755 GTGGGGTGGGAGAGCAGACATGG + Intergenic
1075741885 10:124701076-124701098 CTGGGCAGGCAGAGATACCAAGG - Intronic
1076094666 10:127721224-127721246 CTGGGGTGGCAGAGGCTACAGGG + Intergenic
1076540038 10:131207947-131207969 CAGGGGAGGCTGTGCTGAGAGGG + Intronic
1076888271 10:133272361-133272383 CTGGGGAGGGAGGGCGGGCAGGG - Intronic
1076947940 10:133664820-133664842 CTGGGGAGGTGGAGCTGCCCCGG - Intergenic
1076948930 10:133668130-133668152 CTGGGGAGGTGGAGCTGCCCCGG - Exonic
1076949914 10:133671429-133671451 CTGGGGAGGTGGAGCTGCCCCGG - Intronic
1076950898 10:133674728-133674750 CTGGGGAGGTGGAGCTGCCCCGG - Intergenic
1076951888 10:133678038-133678060 CTGGGGAGGTGGAGCTGCCCCGG - Intergenic
1076952877 10:133681348-133681370 CTGGGGAGGTGGAGCTGCCCCGG - Intergenic
1076953861 10:133684647-133684669 CTGGGGAGGTGGAGCTGCCCCGG - Intergenic
1076954845 10:133740999-133741021 CTGGGGAGGTGGAGCTGCCCCGG - Intergenic
1076955834 10:133744309-133744331 CTGGGGAGGTGGAGCTGCCCCGG - Intergenic
1076956824 10:133747619-133747641 CTGGGGAGGTGGAGCTGCCCCGG - Intergenic
1076957811 10:133750928-133750950 CTGGGGAGGTGGAGCTGCCCCGG - Intergenic
1076958796 10:133754227-133754249 CTGGGGAGGTGGAGCTGCCCCGG - Intergenic
1076959785 10:133757537-133757559 CTGGGGAGGTGGAGCTGCCCCGG - Intergenic
1076960769 10:133760836-133760858 CTGGGGAGGTGGAGCTGCCCCGG - Intergenic
1077342354 11:2031795-2031817 GTGGGCAGGCAGAGCGGCCATGG - Intergenic
1078305861 11:10185560-10185582 CTGGGGAGGCTGAGATGGAAGGG - Intronic
1078508038 11:11966516-11966538 CTGGGGATGCAGAGCTGGGGAGG + Intronic
1078512670 11:11997272-11997294 CAGGGGAAGCAGAACTCACAGGG - Intronic
1078699284 11:13665526-13665548 CCGGAGAGGCAGAGCTTGCAGGG + Intergenic
1078891163 11:15560301-15560323 CCGGAGAGGCAGGGCTGACAAGG - Intergenic
1078917665 11:15795212-15795234 CTGGGGAGGCAGATTTGTTATGG + Intergenic
1078937547 11:15964989-15965011 CTGTGGAGGCTTGGCTGACAGGG + Intergenic
1079318470 11:19430149-19430171 CTAGGGAGCCAGAACTGAGAGGG - Intronic
1079423331 11:20315891-20315913 CTAGGCAGGCAAAGCAGACAAGG - Intergenic
1080492896 11:32785507-32785529 CTTGGGAGGCTGAGGTGGCAGGG - Intronic
1080635275 11:34118266-34118288 CTGGGGAGGCAGGGCCTCCATGG - Exonic
1080954735 11:37080097-37080119 CTGGGGCGGCAGAGAGGGCAAGG + Intergenic
1081325418 11:41738371-41738393 CTGCAGAGGCAGAGCTCTCATGG - Intergenic
1083610748 11:64003046-64003068 CTGGGGAGGCAGAGCCCACTTGG + Intronic
1083812179 11:65112216-65112238 CTGGAGAGGGAGAGCTGAGGAGG + Intronic
1084153790 11:67303189-67303211 CTAGGGAGGCAGAGCTGAGGTGG - Intergenic
1084391667 11:68881235-68881257 CTCGGGAGGCTGAGGTGAGAGGG + Intergenic
1084941958 11:72617725-72617747 CTGGAGAGGCAGGGCTGGCTGGG + Intronic
1085202529 11:74710366-74710388 CCGGGCAGGCAGGGCTGACTCGG - Intronic
1085472195 11:76765571-76765593 CAGGGGAGGCAGAGCTTAGCTGG - Intergenic
1085591332 11:77764120-77764142 CAGAGGAAGCAGAGCTCACATGG + Intronic
1085701864 11:78752660-78752682 ATGGGGAGGCAGACCTGACTTGG - Intronic
1085714263 11:78857907-78857929 CTAGGGAGGCAGAACTAAGAGGG + Intronic
1086162081 11:83733163-83733185 CTTGGGAGGCAGAGGTTGCAGGG + Intronic
1086596147 11:88573656-88573678 ATGGGGATACAGAACTGACAAGG + Intronic
1086666633 11:89491464-89491486 CTGAGTGGGCAGAGCTGACCCGG - Exonic
1086821932 11:91445819-91445841 CTGGAGAGTCTGAGGTGACAAGG + Intergenic
1086998388 11:93385943-93385965 CTTGGGAGGCTGAGCTGGGAGGG + Intronic
1087311706 11:96551391-96551413 CTCTGAAGGCAGAGCTGAAAAGG - Intergenic
1088016930 11:105072136-105072158 CTTGGGAGGCAGAGCTGAGAGGG - Intronic
1088326492 11:108606280-108606302 CTGGGCAGGCATGCCTGACAGGG - Intergenic
1089163756 11:116459151-116459173 GTGGCAAGGCAGAGCAGACAAGG - Intergenic
1089223759 11:116897805-116897827 CCTGGGAGGCAGAGATTACAGGG + Intronic
1089450496 11:118592167-118592189 TTGGGGAGGCTGAGGTGAGAGGG - Intronic
1089467646 11:118695768-118695790 CCGGGGCAGCAGAGCTGGCAGGG + Intergenic
1089575596 11:119440692-119440714 CCCGGGAGGCGGAGCTGGCAGGG - Intergenic
1090270701 11:125383993-125384015 CTGGGGAGACAGACCAGAGAGGG + Intronic
1090343893 11:126051721-126051743 CTCGGGAGGCAGAGGTTGCAGGG - Intronic
1090391055 11:126387567-126387589 CTGGGGAGGCTGAGGTGGGAGGG + Intronic
1090425485 11:126604233-126604255 ACGAGGACGCAGAGCTGACAGGG + Intronic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1202825340 11_KI270721v1_random:86984-87006 GTGGGCAGGCAGAGCGGCCATGG - Intergenic
1091383405 12:77470-77492 CTGGCGAAGCAGAGCTGTCTGGG + Intronic
1091639174 12:2221447-2221469 CCTGGGAGGCAGAGTTGCCAGGG + Intronic
1092066564 12:5594728-5594750 CTAGGGAGGCTGAGGTGAGAGGG + Intronic
1092368872 12:7899789-7899811 CTCGGGAGGCTGAGCGGAGATGG + Intergenic
1092607377 12:10135383-10135405 CTTGGGAGGCTGAGGTGAGAGGG + Intergenic
1093092481 12:14937204-14937226 CTGTGTACGCAGAACTGACAGGG + Intronic
1094647047 12:32335691-32335713 CTCGGGAGGCTGAGGTGACGTGG - Intronic
1095487863 12:42703231-42703253 CTGGGGAGGCTGAGGGAACAAGG + Intergenic
1095775488 12:46005107-46005129 CTGGGGAGGCTGAGGTGGGAGGG - Intergenic
1095835773 12:46637601-46637623 TTGGGGAGTCCAAGCTGACAAGG + Intergenic
1096787286 12:54024463-54024485 CTGGGGAGAGAGAGGAGACAGGG + Intronic
1096819426 12:54222187-54222209 CTTGGGAGGCTGAGGTGAGAGGG - Intergenic
1097164783 12:57078249-57078271 CTGGGCAGGCAGAGCAGCCGCGG - Intronic
1097211529 12:57374241-57374263 CTGGGGAGGTCGAGATTACAGGG + Intronic
1097322863 12:58245528-58245550 CTGGGCAGGTGGAGCCGACATGG - Intergenic
1097759228 12:63441720-63441742 CAGGGGAGGAAGAGCAGAAAGGG + Intergenic
1098262901 12:68688994-68689016 TCCGGGAGGCAGAGGTGACACGG + Exonic
1098328364 12:69326024-69326046 CTGGGGAGGCAGAGGTTGCAGGG + Intergenic
1098721789 12:73909413-73909435 CTTGGGAGGCAAAGCTGGGAAGG - Intergenic
1098908686 12:76187662-76187684 CTGGGGAGACAGAGGTGAGGAGG - Intergenic
1100769135 12:97901983-97902005 CCCAGGAGGCAGAGCTTACAGGG - Intergenic
1100832328 12:98528350-98528372 CCCGGGAGGCAGAGCTTGCAGGG - Intronic
1100991019 12:100251513-100251535 CTGGGGAGGCTGAGGTGGGAGGG - Intronic
1100999699 12:100345114-100345136 ATGGAGTGGCAGAGCTGGCATGG - Intergenic
1101129768 12:101676641-101676663 CTCGGGAGGCTGAGGTGAAAGGG + Intronic
1101172271 12:102110391-102110413 CTTGGGAGGCGGAGGTGAGAGGG + Intronic
1101438153 12:104681904-104681926 CCTGGGAGGCAGAGCTCGCAGGG - Intronic
1101789297 12:107912846-107912868 CTGGGGCCCCAGCGCTGACAGGG + Intergenic
1101847100 12:108371381-108371403 CTTGGGAGGTAGAGGGGACAGGG - Intergenic
1102027240 12:109720445-109720467 TGGGGGAGGCAGAGGTGGCAGGG + Intronic
1102493474 12:113303488-113303510 CTGGGGAGGAAGAGATGGCCTGG - Intronic
1103685924 12:122731766-122731788 CCCGGGAGGCAGAGCTTGCAGGG + Intergenic
1103694731 12:122805588-122805610 CCCGGGAGGCAGAGCTTGCAGGG - Intronic
1103949247 12:124542303-124542325 CAGGGGAGGCTGGGCTGAGAGGG - Intronic
1103967194 12:124647290-124647312 CTGGGGAGGCTGAGGTGAGAAGG - Intergenic
1104101872 12:125620325-125620347 CTGAGTAGGCAGAGCTGAATTGG + Intronic
1104395377 12:128427955-128427977 CTGGGTAAGCACAGCTGAAAAGG - Intronic
1105417283 13:20224478-20224500 CTGGGGAGGCAAAGCCAACGTGG - Intronic
1106019396 13:25900113-25900135 GCTGGGAGGCAGAGCTGAGAGGG + Intronic
1106404562 13:29462557-29462579 GTGAAAAGGCAGAGCTGACATGG + Intronic
1106480705 13:30135145-30135167 CTGGGGAGGCAGCGCTGGTGTGG + Intergenic
1106730228 13:32533603-32533625 CTTGGGAGGCTGAGCTGCCGAGG - Intronic
1107850993 13:44573669-44573691 CTGGGGAGGCACAGTTAACAAGG + Exonic
1108073466 13:46653721-46653743 CTTGGGAGGCTGAGGTGAGAGGG + Intronic
1108693228 13:52879016-52879038 TTGGGGAGGCAGTGCAGAAAGGG - Intergenic
1109023818 13:57134318-57134340 CTCGGGAGGCGGAGCTTGCAGGG + Intergenic
1109151112 13:58848252-58848274 CTTGGGAGGCTGAGGTGAGAGGG - Intergenic
1109781948 13:67122696-67122718 CTCGGGAGGCAGAGGTTGCAGGG + Intronic
1110523939 13:76514032-76514054 CTAGGGAGGCTGAGGTGAGAGGG - Intergenic
1111145303 13:84170800-84170822 CTGGGGCAGCAGAGGTTACACGG + Intergenic
1111478625 13:88789907-88789929 CTGGGGAAACAAAGCTTACATGG - Intergenic
1112044691 13:95584386-95584408 CTGGGGAGGCTGAGGTGGGAGGG + Intronic
1112243814 13:97709286-97709308 CTTGGGAGGCTGAGGTGAAAAGG + Intergenic
1112324996 13:98438181-98438203 CTCGGGAGGCAGAGGTGCCTTGG + Intronic
1112639222 13:101254295-101254317 CTTGGGAGGCAGAGGTTGCAGGG + Intronic
1112999111 13:105611538-105611560 CTGGGGAGACAGAGCAGACCCGG + Intergenic
1113019386 13:105866254-105866276 CCTGGGAGGCAGAGATTACAGGG + Intergenic
1113543831 13:111131207-111131229 GAGTGGAGGCAGTGCTGACAAGG + Intronic
1113887649 13:113669370-113669392 CTGGGCAGGCGGGGCTGGCAGGG + Intronic
1113940427 13:114015945-114015967 CAGGGGAGGAAGAGCTGGCCGGG + Intronic
1114064870 14:19052642-19052664 CTTGGGAGGCTGAGATGAGAGGG + Intergenic
1114097391 14:19347360-19347382 CTTGGGAGGCTGAGATGAGAGGG - Intergenic
1114563579 14:23611238-23611260 CTGGACAGGCAGAGATGAGAAGG - Intergenic
1117598650 14:57350703-57350725 TTTGGGAGGCAGAGGTGAGAGGG + Intergenic
1117898418 14:60510137-60510159 GTGGGGAAGCAGAGCCGGCAAGG - Intronic
1117941264 14:60968238-60968260 GTGGTGAGGCAGCTCTGACATGG - Exonic
1118239428 14:64042344-64042366 CTGGAGAGGAAGAGATGAAAAGG + Intronic
1118580090 14:67287108-67287130 CTGGGGAGGCTGAGGTGGGAAGG + Intronic
1119183031 14:72617100-72617122 TTGTGTAGGCAGAGCAGACATGG + Intergenic
1119330708 14:73791313-73791335 CTAGGGATGCAGAGATGAAAAGG + Intergenic
1119421368 14:74509705-74509727 CTGGGGAGGCAGTGGTGGAAGGG - Intronic
1119602224 14:75983852-75983874 CCAGGGAGGCAGAGTTTACAGGG + Intronic
1119718844 14:76877490-76877512 CCTGGGAGGCAGAGCTTGCAGGG + Intergenic
1120296253 14:82645927-82645949 CTGGGGAGCTTGATCTGACAGGG - Intergenic
1120907549 14:89633513-89633535 CTGGGGAAGAAGAGCTCTCAGGG - Intronic
1121079671 14:91097286-91097308 CTTGGGAGGCTGAGGTGAGAGGG + Intronic
1121108607 14:91296771-91296793 CTGGTGAGGCAGGTCTGGCAGGG - Intronic
1121354112 14:93199139-93199161 TTGGGGAGGCTGAGCTGAAGAGG + Intronic
1121624176 14:95372455-95372477 CTTGGGAGGCAGAGGTTGCAGGG - Intergenic
1121787084 14:96670228-96670250 CTGGGGAGACAGACCTGACCCGG + Intergenic
1121908764 14:97770257-97770279 CAGGGCAGACAGAGCTGACAGGG - Intergenic
1122373651 14:101243616-101243638 CTGGGGAGTCCGAGATCACAGGG + Intergenic
1122672271 14:103381931-103381953 CTTGGGAGGCAGAGATGGGAGGG + Intergenic
1122691234 14:103533013-103533035 CAGGGGAGGCAGAGCTGGGGAGG + Intronic
1122753313 14:103956000-103956022 CTCGGGAGGCTGAGGTGAGAGGG + Intronic
1122906672 14:104804868-104804890 CCAGGGAGGCAGATCTGTCAGGG + Intergenic
1122911841 14:104833609-104833631 CCTGGGAGGCAGAGCTTGCAGGG - Intergenic
1202860567 14_GL000225v1_random:79059-79081 CTGGGGAGGTGGAGCTGCCCCGG + Intergenic
1124377798 15:29139772-29139794 CTGGGGAGGCTGAGGAGTCAAGG - Intronic
1125743073 15:41980914-41980936 GTGGGGAGGCAGCGGGGACAGGG + Intergenic
1126148348 15:45499145-45499167 CTCAGGAAGCAGAGCTGAGATGG - Intronic
1126789591 15:52209028-52209050 ATGGGGAGGCAGAGCAGCCAGGG + Intronic
1127511568 15:59647198-59647220 CTGGGGAGGCTGAGGTGAGAGGG - Intronic
1128130393 15:65223504-65223526 CCTGGGAGGCAGAGCTTGCAGGG - Intergenic
1128609522 15:69062830-69062852 CTGGGGAGACAAAGCCCACAAGG - Intergenic
1128727775 15:70000511-70000533 CAGGGCAGGCAGAGCTGAACAGG - Intergenic
1128746092 15:70115116-70115138 ATGGGGAGGCTCATCTGACAGGG + Intergenic
1129302831 15:74635939-74635961 TTGGGGAAGAAGAGCAGACAAGG - Intronic
1129430606 15:75498637-75498659 CCTGGGAGGCAGAGGTTACAGGG + Intronic
1129762481 15:78138373-78138395 CCCGGGAGGCAGAGCTTGCAGGG - Intronic
1129974572 15:79811555-79811577 GTGTGGAGACAGAGCTGGCAGGG - Intergenic
1130240187 15:82180834-82180856 CTGAGGAGGCTGAGGTGAGAGGG - Intronic
1130337699 15:82971464-82971486 TTGAGGAGGCAGAGCTGCTAAGG + Intronic
1130358154 15:83154226-83154248 CTGGGGAGGCTGAGGTGGGAGGG + Intronic
1130512341 15:84600369-84600391 CTGGGGAGGTGGTGATGACAGGG + Intergenic
1130639350 15:85656520-85656542 CCCGGGAGGCAGAGCTTGCAGGG - Intronic
1131159415 15:90094930-90094952 CTGGGTGGGAAGAACTGACAAGG + Intronic
1131284411 15:91045187-91045209 CTGGGGTGACACAGCTGAAAGGG - Intergenic
1132351818 15:101144218-101144240 CTTGGGAGGCTGAGGTGAGAGGG - Intergenic
1132355703 15:101169802-101169824 CTGGGCAGGCAGAGCAGTCAAGG + Intergenic
1132860819 16:2070933-2070955 CTGAGAGGGCAGAGCTGAGACGG + Intronic
1132871865 16:2118932-2118954 CAGGGGAGGCGGTGCTGTCAGGG - Intronic
1133190936 16:4133326-4133348 CCTGGGAGGCAGAGGTTACAGGG - Intergenic
1133288748 16:4704142-4704164 CTGGGAAGGGTGAGCTGACTGGG - Intronic
1133654836 16:7851112-7851134 CTGGGGAGGCAGAGATTGCAGGG - Intergenic
1133996223 16:10750649-10750671 CTGGGACTGCAGAGCTGAGAGGG + Intronic
1134056830 16:11175325-11175347 CTGGGGAGACAGAGCCGAGGGGG - Intronic
1134123857 16:11603004-11603026 CTCGGGAGGCTGAGGTGAGAGGG + Intronic
1134176142 16:12008017-12008039 CCTGGGAGGCAGAGCTTGCAGGG - Intronic
1134191247 16:12122646-12122668 CTGGAGCGGCAGAGAGGACATGG + Intronic
1134520662 16:14917964-14917986 CAGGGGAGGCGGTGCTGTCAGGG + Intronic
1134550913 16:15138010-15138032 CAGGGGAGGCGGTGCTGTCAGGG - Intronic
1134708334 16:16316615-16316637 CAGGGGAGGCGGTGCTGTCAGGG + Intergenic
1134715549 16:16356648-16356670 CAGGGGAGGCGGTGCTGTCAGGG + Intergenic
1134951268 16:18352030-18352052 CAGGGGAGGCGGTGCTGTCAGGG - Intergenic
1134959208 16:18395511-18395533 CAGGGGAGGCGGTGCTGTCAGGG - Intergenic
1135852414 16:25976411-25976433 CTAGGGAAGCAGAGGTGAAAAGG - Intronic
1136381238 16:29896912-29896934 CTGGGGAGGCAGGGCTGGGTGGG + Exonic
1136382112 16:29900521-29900543 CGGGGGTGGCTGAGCTGAGAGGG + Intronic
1136386393 16:29929042-29929064 CCCGGGAGGCAGAGCTTGCAGGG - Intergenic
1136476660 16:30517788-30517810 CCGGGGAGACAAGGCTGACAAGG - Exonic
1136547737 16:30965134-30965156 CTGGGGAGCCAGAGCGGGCAGGG - Exonic
1136585998 16:31185156-31185178 CCGTGGAGGCAGAGGTGGCATGG + Exonic
1136710627 16:32234025-32234047 CTGGGTAGGCAGAGGTGAGCAGG - Intergenic
1136712207 16:32248405-32248427 CTTGGGAGGCAGAGGTGGGAGGG - Intergenic
1136755707 16:32680999-32681021 CTTGGGAGGCAGAGGTGGGAGGG + Intergenic
1136757284 16:32695386-32695408 CTGGGTAGGCAGAGGTGAGTAGG + Intergenic
1136810824 16:33174989-33175011 CTGGGTAGGCAGAGGTGAGCAGG - Intergenic
1136812406 16:33189373-33189395 CTTGGGAGGCAGAGGTGGGAGGG - Intergenic
1136817300 16:33285069-33285091 CTGGGTAGGCAGAGGTGAGCAGG - Intronic
1136818882 16:33299453-33299475 CTTGGGAGGCAGAGGTGGGAGGG - Intronic
1136823863 16:33341598-33341620 CTGGGTAGGCAGAGGTGAGCAGG - Intergenic
1136825445 16:33355986-33356008 CTTGGGAGGCAGAGGTGGGAGGG - Intergenic
1136830511 16:33454757-33454779 CTTGGGAGGCAGAGGTGGGAGGG - Intergenic
1137011175 16:35321833-35321855 CTTGGGAGGCAGAGGTGGGAGGG + Intergenic
1137029833 16:35511961-35511983 CTTGGGAGGCAGAGGTGGGAGGG + Intergenic
1137258402 16:46798430-46798452 CTCGGGAGGCAGAGGTTGCAAGG + Intronic
1137287892 16:47031436-47031458 CCCGGGAGGCAGAGGTGGCAGGG - Intergenic
1138276203 16:55736719-55736741 ATCGGGAGGCAGAGATAACAGGG + Intergenic
1138432915 16:56981038-56981060 CTGGAGAGGCAAGGATGACACGG - Intronic
1138443066 16:57046694-57046716 CAGAGGGGGCAGAGCTGGCAGGG + Intronic
1138658366 16:58503447-58503469 CTGGGGAGGCAGAGCTGTCCAGG + Intronic
1139222906 16:65202750-65202772 TTTGGGAAGCAGAGCTTACAGGG - Intergenic
1139633450 16:68244546-68244568 CTGGGGAACCAGAGAGGACATGG - Intergenic
1139868825 16:70086911-70086933 CTAGGGAGGCTGAGGTGAGAGGG + Intergenic
1139955133 16:70689565-70689587 GTGGGCAGGCAGAGCTGAGCAGG - Intronic
1140386569 16:74545286-74545308 CTAGGGAGGCTGAGGTGAGAGGG - Intronic
1140889339 16:79271896-79271918 CAGGGGAGGCAGAGGGGTCAGGG - Intergenic
1141150311 16:81560070-81560092 CTGGGGAGGCAGAGGTTGCAGGG + Intronic
1141273066 16:82558383-82558405 CTGCAGAGGCAGAGCCGTCATGG + Intergenic
1141346393 16:83250491-83250513 CTGCTGAAACAGAGCTGACAAGG + Intronic
1141557058 16:84843163-84843185 CTGGGGAGGCTGAGCCTTCATGG + Intronic
1141578289 16:84980034-84980056 CCCGGGAGGCAGAGCTTGCAGGG - Intronic
1141791981 16:86243166-86243188 CTGGGCGGGGAGAGCAGACAAGG - Intergenic
1142264825 16:89058831-89058853 CTGTGGAGGCTGAGCTGCCCAGG - Intergenic
1142297321 16:89234015-89234037 CAGGGGAGGCAGAGGCCACAGGG - Exonic
1142298469 16:89242553-89242575 CCCGGGAGGCAGAGCTTGCAGGG - Intergenic
1142419535 16:89961893-89961915 CTGGGGAGGGAGAGCAGGAAGGG + Intronic
1202990983 16_KI270728v1_random:12343-12365 CTTGGGAGGCAGAGGTGGGAGGG - Intergenic
1203057850 16_KI270728v1_random:941355-941377 CTTGGGAGGCAGAGGTGGGAGGG + Intergenic
1203059434 16_KI270728v1_random:955737-955759 CTGGGTAGGCAGAGGTGAGCAGG + Intergenic
1142478696 17:204868-204890 CTGTGGGGGCAGGGATGACAGGG + Intergenic
1142966897 17:3587244-3587266 CAGGGGAGGCAGAGCAGACCAGG + Intronic
1143051096 17:4126544-4126566 CTGGGTAGGCAAGGCTGAGAAGG + Intronic
1143057055 17:4170326-4170348 CAGGGGAAGGAGAGCTGATAGGG + Intronic
1143323659 17:6084279-6084301 CTGGGGAGGCTGTGCTCTCATGG + Intronic
1143622327 17:8087725-8087747 GTGGGGAGGAAGAGCAGGCAGGG + Intergenic
1144535358 17:16083687-16083709 CTGGGGAGGCAGTGCTGAGCAGG + Intronic
1145725192 17:27114304-27114326 CCTGGGAGGCAGAGCTTGCAGGG + Intergenic
1145750957 17:27354475-27354497 CAGGGAAGGCAGAGGGGACAGGG - Intergenic
1146085082 17:29820866-29820888 CTGGGAAGAGAGAGGTGACAAGG - Intronic
1146456242 17:33011984-33012006 CAGGGGAGGCAGTGCTGTTATGG + Intergenic
1146921300 17:36714373-36714395 CTTGGGAGGCTGAGGTGAGAAGG - Intergenic
1147120408 17:38332135-38332157 CAGGGCAGGCAGAGCTCAGAGGG + Intronic
1147511844 17:41076647-41076669 CTTGGGAGGCTGAGGTGAGAGGG + Intergenic
1148371377 17:47102252-47102274 TTGGGGGGGCAGAGCTTGCAGGG - Intergenic
1148758170 17:49985505-49985527 CTGTGGAGGCAGAGCCTGCATGG - Intergenic
1149464688 17:56867817-56867839 CCCGGGAGGCAGAGCTTGCAGGG + Exonic
1149585367 17:57782778-57782800 CGGGGGAGGCACAGCTGGCCAGG - Intergenic
1149625526 17:58077799-58077821 CGAGGAAGGAAGAGCTGACAGGG - Intergenic
1149723132 17:58865461-58865483 TTGGGGAGGCAGAGGTGAGGCGG + Intronic
1149758456 17:59207826-59207848 CCCGGGAGGCAGAGCTTGCAGGG + Intronic
1150317694 17:64183500-64183522 CCTGGGAGGCAGAGGTTACAGGG - Intronic
1150440647 17:65188718-65188740 CTTGGGAGGCTGAGGTGAGAGGG - Intronic
1151820364 17:76493678-76493700 CTGGGGAGGTGGTGCTGAGAGGG - Intronic
1151841059 17:76617661-76617683 CTCGGGAGGCTGAGGTGAGAGGG + Intergenic
1151882770 17:76904977-76904999 CTGGGGAGGGTGTGTTGACAGGG + Intronic
1152007470 17:77691599-77691621 CTGGGGGAGCAGAGATGGCAGGG + Intergenic
1152170330 17:78742107-78742129 CTGAGGAGGCAAAGGTTACAAGG - Intronic
1152533318 17:80934464-80934486 CTGGGGAGGAAGAGGTGGGAGGG - Intronic
1152888958 17:82869079-82869101 CTGGGGAGGCTGAGCTGGGTTGG + Intronic
1153699114 18:7674570-7674592 GTGGGCAGGCAGTGCTGAGAAGG + Intronic
1153945810 18:10016242-10016264 CTGGGGAGGCAGAGCAGAGATGG + Intergenic
1155518311 18:26644419-26644441 CTAAGGAGGGAGAGTTGACAAGG + Intronic
1156019922 18:32588384-32588406 CTTGGGAGGCAGAGGTGGGAGGG - Intergenic
1156351057 18:36301135-36301157 CTGTGTAGGCAGCGCTGAGAAGG + Intronic
1156484351 18:37455545-37455567 TTGGGGAGCCAGGGCTGACAGGG + Intronic
1157240023 18:46000029-46000051 CTTGGGAGGCTGAGCTGGGAGGG + Intronic
1157261870 18:46182499-46182521 CTTGGGAGGCAGAGTTGGGAGGG + Intronic
1157500954 18:48190388-48190410 CTGGGGATGCAGATATGAAAAGG + Intronic
1157915491 18:51660009-51660031 CTGGGGAGGCAGGGAGCACATGG - Intergenic
1158695009 18:59696557-59696579 CTGGGGAGGCGGCGCTGTAAAGG - Intronic
1158736904 18:60092613-60092635 CTTGGGAGGCTGAGGTGAAAGGG - Intergenic
1159447117 18:68554641-68554663 ATGGGGAGGAACAGCTGACTGGG - Intergenic
1159637884 18:70827558-70827580 ATGCAGAGGGAGAGCTGACAGGG - Intergenic
1160189147 18:76700529-76700551 CCCGGGAGGCAGAGCTTGCAGGG + Intergenic
1160527754 18:79547485-79547507 CTCGGGAGGCAGAGCTGGCAGGG + Intergenic
1160590974 18:79944524-79944546 CTGGGGAGGCAGAGACCGCAGGG - Intronic
1160755370 19:754385-754407 CCTGGGAGGCAGAGCTTGCAGGG + Intronic
1160935016 19:1590508-1590530 CTTGGGAGGCTGAGCTGAGAGGG + Intronic
1161034705 19:2078120-2078142 TTGGTGAGTCAGAGCTGGCAGGG - Exonic
1161235165 19:3194021-3194043 CTGGGGGAGCAGGGCTGAGAAGG + Intronic
1161375261 19:3936680-3936702 CCGGGGAGGTGGAGCTGAGAGGG + Intronic
1161558589 19:4958110-4958132 CCGAGGAGGCAGAGATGCCATGG - Intronic
1161645748 19:5452254-5452276 CCTGGGAGGCAGAGCTTGCAGGG + Intergenic
1161868025 19:6848899-6848921 CTGGGGAGGCTGAGCTAGGAGGG - Intronic
1162084455 19:8240202-8240224 CTGGGGAGGCAGAGGTGGGGAGG + Intronic
1162171166 19:8790211-8790233 CCGAGGAGGCAGAGCTTGCAGGG - Intergenic
1162425840 19:10595035-10595057 CCCGGGAGGCAGAGCTTGCAGGG - Intergenic
1162558320 19:11401469-11401491 CCCGGGAGGCAGAGCTTGCAGGG - Intronic
1162647384 19:12059732-12059754 CTGGGGAGGGAGGGCTGCCTGGG - Intergenic
1162933856 19:13970906-13970928 CTTGGGAGGCAGAGGTTGCAGGG + Intronic
1163066178 19:14797423-14797445 CTCGGGAGGCGGAGCTTGCAGGG + Intronic
1163082010 19:14950835-14950857 CTTGGGAGGCTGAGATGGCAGGG + Intronic
1163158550 19:15451939-15451961 CTGGGGAGGCAGTGGTGATGGGG + Intronic
1163219817 19:15910474-15910496 CCCGGGAGGCAGAGCTTGCAGGG + Intergenic
1163306727 19:16484623-16484645 CTGGGGAGGCTGAGGTGGGAGGG - Intronic
1163432010 19:17273881-17273903 CTGGGGAGGCAGAGAGTACAGGG - Intronic
1163476049 19:17526851-17526873 CTGGGGAGACAGAGCTGGACAGG - Intronic
1163697714 19:18772380-18772402 CTGGGGAGGCTCTGCTGCCAGGG - Intronic
1163786668 19:19278313-19278335 CTGAGGAGAGAGGGCTGACATGG - Intronic
1164310821 19:24044460-24044482 CCCGGGAGGCAGAGCTTGCAGGG + Intronic
1164318900 19:24120736-24120758 CCCGGGAGGCAGAGCTTGCAGGG - Intronic
1164583495 19:29450029-29450051 CTGGGGAGGCTGAGGTGTGAGGG + Intergenic
1165204927 19:34175304-34175326 CTTGGAAGGCAGAGGTTACAGGG - Intronic
1166149517 19:40862004-40862026 CCCGGGAGGCAGAGCTTGCAGGG + Intronic
1166703757 19:44896944-44896966 CTGGGGACGCTGAGCTGGCAGGG + Intronic
1166726980 19:45034397-45034419 CTGGGGAGGAAGGGCTGTCGGGG + Intronic
1166886917 19:45967249-45967271 CTGGGGAGGTAGGACTCACATGG - Intronic
1167007171 19:46783676-46783698 CTGGGAAGGCTGAGGTGAGAAGG + Intronic
1167071606 19:47225462-47225484 CTTGGGAGGCTGAGGTGAAAGGG - Intronic
1167350336 19:48970230-48970252 CTGGGGAGGCTGAGGTGGTAGGG - Intronic
1167815726 19:51879179-51879201 CCCGGGAGGCAGAGCTTGCAGGG + Intronic
1167874631 19:52401480-52401502 CTGGGGAAGCAGATCAGGCAGGG - Intronic
1167950836 19:53026352-53026374 CTGGGGAAGCAGATCAGATAGGG + Intergenic
1167957097 19:53074592-53074614 CCTGGGAGGCAGAGCTTGCAGGG + Intronic
1168212719 19:54902406-54902428 CTTGGGAGGCTGAGGTGAGAGGG - Intergenic
1168260321 19:55189884-55189906 CTGGGGAGGCTGAGATGGGAGGG + Intronic
1168454919 19:56499228-56499250 CTGGGGAGGCGGAGGTTTCAGGG + Intergenic
925128131 2:1476311-1476333 CCAGGGAGGAAGAGCTGACAGGG + Intronic
925555629 2:5128619-5128641 CTGGGGATGCCAAGCTGACCAGG - Intergenic
925611226 2:5705318-5705340 CTGGGGAGGAGGAGCTGAGAAGG + Intergenic
926119912 2:10236260-10236282 CTGGGGAGGCACAGGTGGCTGGG - Intergenic
926326115 2:11786066-11786088 GTGGGGTGGCAGCACTGACAAGG + Intronic
926705529 2:15834846-15834868 CTGGGGAGCCAGGGCTCACTGGG - Intergenic
926882828 2:17567432-17567454 CTCGGGAGGCGGAGCTTGCAGGG - Intronic
927148035 2:20179776-20179798 CTGTGGAGGGAGACGTGACAGGG - Intergenic
927173608 2:20390378-20390400 CTGGAGAGGCAGAGGTTGCAAGG - Intergenic
927719210 2:25372390-25372412 CTGGGGGAGAAAAGCTGACAAGG - Intergenic
927788111 2:25988142-25988164 CCCGGGAGGCAGAGGTTACATGG - Intergenic
927853193 2:26512689-26512711 GTGGGGAGCAAGAGCTGAGAAGG + Intronic
927920876 2:26970984-26971006 CTGGGGAGGCCGGGCCGCCAAGG - Intronic
928036180 2:27825663-27825685 TGAGGAAGGCAGAGCTGACAGGG + Intronic
928060584 2:28109100-28109122 CAGGGGAGGAAGGGCTGACATGG + Intronic
928077535 2:28278831-28278853 CTGGGGAGGTGCAGGTGACAAGG + Intronic
928277536 2:29916692-29916714 GTGGGGAGGGAGTGCTTACAGGG + Intronic
929460271 2:42098156-42098178 CCTGGGAGGCAGAGGTTACAGGG + Intergenic
929474598 2:42233379-42233401 CCTGGGAGGCAGAGCTTGCAGGG - Intronic
929713952 2:44292218-44292240 CTGGGGAGACCCAGCTGAGAGGG + Intronic
930000666 2:46859638-46859660 CTGGCGAGGGAGAGCTGAACTGG + Intergenic
930685344 2:54301884-54301906 CTGAGGAGGCAGATCAGGCAGGG + Intronic
930708133 2:54524465-54524487 CTTTGGAGGGAGAACTGACAGGG - Intronic
930726604 2:54687698-54687720 CTGGGGCTGCAGTGGTGACAAGG + Intergenic
930755570 2:54968805-54968827 ATGGGGAGGGAGAGCTGGCCAGG - Intronic
930773348 2:55149631-55149653 CTTGGGAGGCTGAGGTGAGAGGG + Intergenic
930798861 2:55421544-55421566 CTAGGGAGGCTGAGGTGAGAGGG - Intergenic
931050485 2:58408314-58408336 GTGGGGAGGGAGAGATGACCAGG + Intergenic
931334320 2:61323437-61323459 CCTGGGAGGCAGAGCTTGCAGGG + Intronic
931588704 2:63857191-63857213 CTGGGGAGGCTGAGGTGGGAGGG + Intronic
931719724 2:65058309-65058331 CTTGGGAGGCTGAGGTGAGAGGG - Intronic
932207452 2:69895632-69895654 CAGGGGAGGCAGAGATTGCAGGG - Intronic
933174210 2:79158242-79158264 CTGGGCAGGCACAGGGGACAGGG + Intronic
933195293 2:79382687-79382709 CCCGGGAGGCAGAGCTTGCAGGG - Intronic
934533312 2:95110692-95110714 CTGGGGAGGCTGAGGTGGGAGGG + Intronic
934767959 2:96891062-96891084 CTGAGCAGGCAGAGCTTATATGG - Intronic
935292381 2:101621404-101621426 CTTTGGAGGCAGAGCTGACGGGG + Intergenic
935357877 2:102221384-102221406 CTGGAAACGCAGAGCTGTCATGG - Intronic
935606347 2:104975336-104975358 CTGGGGAGGCGGAGCTTGCAGGG + Intergenic
936189438 2:110328630-110328652 GAAGAGAGGCAGAGCTGACAGGG + Intergenic
936582604 2:113716496-113716518 ATGAGGAGGCAGAACTGATATGG + Intronic
936737369 2:115462835-115462857 CTGGGGAGGCTGAGGTGGGAGGG - Intronic
937114685 2:119396957-119396979 GTGAGGGGGCAGAGCTGGCAGGG + Intergenic
937295500 2:120807630-120807652 CTGGAGAGGCTGAGCTGAGCGGG + Intronic
937363256 2:121243579-121243601 CACGGGAGGCAGAGCTTAGACGG - Intronic
937482354 2:122275981-122276003 CTGGGGATGAAGGGCTGACGTGG + Intergenic
937904013 2:127043096-127043118 TGGGGGAGGCAGAGCAGCCACGG - Intergenic
937912574 2:127082569-127082591 CTGGGGTGGCAGTGGTGAAAGGG + Intronic
937937715 2:127259476-127259498 CTGGGGAGAGAGAGCAGAAAGGG - Intronic
938023254 2:127923434-127923456 CCGGCGAGGCAGAGGTTACAGGG - Intergenic
938139107 2:128782138-128782160 CTGGGAAGGCACAGCTGCCCTGG + Intergenic
938369675 2:130761391-130761413 GTGGGCAGGCAGAGCTGCAAGGG - Intronic
938683518 2:133715405-133715427 TTAGGGAGGCAGGGCTCACAAGG - Intergenic
939006413 2:136792585-136792607 CTGGGGAGGCTGTGCTGATGGGG + Intronic
939291969 2:140207272-140207294 CTTGGGAGGCTGAGGTGAAAGGG + Intergenic
940847760 2:158660018-158660040 TTGTGGAGGAAGAGCTGACAAGG + Intronic
942796824 2:179830704-179830726 ATGGGGAGGCAGAGATGAATAGG + Intronic
943230826 2:185248923-185248945 CTGGGGAGGTAGAGGTTACAGGG + Intergenic
943575550 2:189626991-189627013 CTCGGGAGGCTGAGCTGAGTCGG + Intergenic
943582477 2:189701338-189701360 CTAGGGAGGCTGAGGTGAGAGGG - Intronic
944036625 2:195302318-195302340 CTGTGGGGGCAAAGTTGACAGGG - Intergenic
944695853 2:202200004-202200026 CCGGGGAGGCAGAGGTTGCAGGG - Intergenic
944847409 2:203682398-203682420 CTGGGGATGCAAAGATGAAAAGG + Intergenic
946013378 2:216584457-216584479 GTGGAGAGGGAGAGCTGAGAGGG - Intergenic
947745318 2:232504165-232504187 CTGGGGAGGCAGAGCTGCCGCGG + Intergenic
947756072 2:232566260-232566282 CTCGGGAGGCAGAGCTTGCAGGG - Intronic
947776025 2:232710033-232710055 CCCGGGAGGCAGAGCTTGCATGG - Intronic
947937794 2:234022927-234022949 TTGGGGAGACAGAGCTGTGATGG - Intergenic
948103524 2:235394197-235394219 CTGGGAAGGCTGTGCTGACATGG + Intergenic
948230141 2:236343229-236343251 CTGGGGAAGGAGCGCTGAGAGGG - Intronic
948356116 2:237378700-237378722 CTGCTGAGGCAAAGCTGGCAGGG + Exonic
948674128 2:239587283-239587305 CAGAGGGGGCAGAGCAGACAGGG - Intergenic
948690113 2:239696744-239696766 CTGGGGAGGCAGAGCGGGGTTGG - Intergenic
1168828561 20:831179-831201 CTTGGGAGGCAGAGGTTGCAGGG + Intergenic
1168902519 20:1377217-1377239 ATGGGGAGGCAGAGATGAATTGG + Intronic
1168978970 20:1988883-1988905 CCAGGGAGGCAGAGCCAACAAGG - Intronic
1169418545 20:5439657-5439679 CTTGGGAGGCAGAGGTTGCAGGG - Intergenic
1170792103 20:19516865-19516887 CTGTGGAGTCAGAGAAGACATGG + Intronic
1171412087 20:24954069-24954091 GTGGGGAGGCAGAGCAGGCCTGG - Intronic
1172052094 20:32125774-32125796 CTGGGGAGGCTGAGGTGGGAGGG - Intronic
1172281592 20:33711624-33711646 TTTGGGAGGCTGAGCTGAGATGG + Intronic
1172523390 20:35583433-35583455 ATGGGGAGGCAGGGCTGTGAGGG - Intergenic
1172566727 20:35936356-35936378 CTGGAGTGGGAGAGCTGAGACGG + Intronic
1172668010 20:36614112-36614134 CTGGGGAAGCTGATCTGATAGGG - Intronic
1172800733 20:37574420-37574442 CTGGGGAGTCAGGACTGAGAAGG + Intergenic
1172968416 20:38855790-38855812 GTGGGAAGGCACAGCTTACATGG - Intronic
1173058757 20:39641852-39641874 CTGGGGAGGCTGAGGTGGGAGGG - Intergenic
1173494000 20:43505889-43505911 CTAGGGAGGCTGAGGTGAGAGGG - Intergenic
1173494585 20:43509330-43509352 CTGGGGAGGCTGAGGTGGGAGGG - Intronic
1173632665 20:44528339-44528361 CTGGGGAGGCAGAGGCTGCAGGG + Intergenic
1173738715 20:45380502-45380524 CTGAGCAGGCAGAGCAGCCAAGG - Intronic
1173791826 20:45833032-45833054 CTGGGGAGGCTGAGGTGGGAGGG + Intronic
1173879985 20:46405343-46405365 CAGGGGAGGAAGAGCAGACCAGG + Intronic
1173940046 20:46903130-46903152 CTGGAGAGCCAGAGGTGAGAAGG + Intronic
1174045422 20:47729529-47729551 TTTTGAAGGCAGAGCTGACAGGG + Intronic
1174199055 20:48794387-48794409 CTGGGAAGACAGAGCTAACCAGG + Intronic
1175382806 20:58575372-58575394 CTAGGGAGGCAGAGGTTGCAGGG + Intergenic
1175411148 20:58770267-58770289 CCGAGGAGGCAGAGCTTTCAGGG - Intergenic
1175522378 20:59610177-59610199 CTGGGGAAGCAGAGGTTGCATGG + Intronic
1175730907 20:61353262-61353284 CTGGGGGTGCAGAGGTGCCAGGG + Intronic
1175823933 20:61926419-61926441 CAGGGGAGGCAGCGCTGGCTGGG - Intronic
1175887390 20:62300144-62300166 TTTGGGAGGCCGAGCTGAGAGGG - Intergenic
1175972452 20:62693556-62693578 CTGGGGAACCGGAGCTGAGACGG - Intergenic
1176022837 20:62970903-62970925 CTTGGGTGGCAGTCCTGACACGG + Intergenic
1176127920 20:63484222-63484244 GTGGGGGGGCAGAGCTCACTGGG - Intergenic
1176281773 20:64317317-64317339 CTGGCGAAGCAGAGCTGTCTGGG - Intergenic
1176718936 21:10377997-10378019 CTTGGGAGGCTGAGATGAGAGGG + Intergenic
1177219990 21:18180258-18180280 CTTGGGAGGCTGAGGTGAGAGGG - Intronic
1177369189 21:20179908-20179930 CCGGGGAGGCGGAGCTTGCAGGG - Intergenic
1178070996 21:28967071-28967093 CTGGGAAGCCAAAGCAGACACGG - Exonic
1178527148 21:33340464-33340486 CTGGGTAGGCTGAGGTGAGAGGG - Intronic
1178552263 21:33550931-33550953 CTGGGGTGCCAGAGTTGCCAGGG + Exonic
1178971216 21:37178850-37178872 CTTGGGAGGCTGAGCTGAGAGGG + Intronic
1179507006 21:41847859-41847881 CTGGGGAGGGAGAGCTAAGCTGG + Intronic
1180145674 21:45917368-45917390 CTGGGCGGGCAGAGCTGAGCTGG - Intronic
1180483357 22:15775262-15775284 CTCGGGAGGCTGAGATGAGAGGG + Intergenic
1180969891 22:19809880-19809902 CTGGGGAGGCTGAGGTGGGAGGG - Intronic
1181010820 22:20039551-20039573 CCTGGGAGGCAGAGGTTACAGGG + Intronic
1181149998 22:20876363-20876385 CTTGGGAGGCAGAGGTGGGAGGG - Intronic
1181695120 22:24589096-24589118 CTGGGCATTCAGAGCTGGCAGGG + Intronic
1181971533 22:26694084-26694106 CTGGAGATGCAGAGATGACCAGG + Intergenic
1182144754 22:27990597-27990619 GAGGGGAGGCAGAGCAGAGAAGG + Intronic
1182202323 22:28586201-28586223 CCTGGGAGGCAGAGCTTGCAGGG + Intronic
1182447761 22:30399437-30399459 CCCGGGAGGCAGAGCTTACAGGG + Intronic
1182515116 22:30853831-30853853 CCGAGGAGGCAGAGCTGAGATGG - Intronic
1182618591 22:31605253-31605275 CTGGAGTGGAAGAGATGACAAGG - Intronic
1183053526 22:35285616-35285638 CTTGGGAGGCAGAGGTGAGAGGG + Intronic
1183107558 22:35625702-35625724 CAGGGGATTCAGAGCTGACATGG + Intronic
1183230926 22:36581548-36581570 CTGGGGATGTAGAGCAGAGAGGG - Intronic
1183305256 22:37079608-37079630 CTGGGGCTGCAGAGCTGAATTGG + Intronic
1183475301 22:38032871-38032893 GTGGGGAGGCCAAGCTGAGAAGG + Intronic
1183741145 22:39669334-39669356 GTGAGGAGACAGAGCAGACAAGG - Intronic
1184435039 22:44467701-44467723 CTGGAGAGGCAGAGGTTGCAGGG - Intergenic
1185047330 22:48534995-48535017 CTGGGGTGACAGAGCTGGCTGGG - Intronic
950128270 3:10524486-10524508 ATCTGGAGGCAGAGCTGCCAGGG - Intronic
950332407 3:12167003-12167025 CTGTGGAGCCAGAGCTGTCTGGG + Intronic
950465290 3:13149696-13149718 TGGGGGAGGCGGAGCTGCCAGGG - Intergenic
950531242 3:13553413-13553435 CTGAGGAGGAAGAGCTGGGACGG + Intronic
950567309 3:13777920-13777942 GTTGGGAGGTAGAGCAGACATGG + Intergenic
951535677 3:23738376-23738398 CCTGGGAGGCAGAGGTTACAGGG + Intergenic
952212405 3:31241561-31241583 CTGGGGATGCAGTGCTGAACTGG - Intergenic
953449495 3:42994382-42994404 CTGGGGAGGAAGCACTGATAGGG + Intronic
953792332 3:45957837-45957859 ACAGGGAGGCAGAGCTGAGACGG - Intronic
954184505 3:48906498-48906520 CTCGGGAGGCAGAGTTTGCAGGG - Intergenic
954290161 3:49645465-49645487 GTGGGGAGGCAGAGCTGGCAGGG - Intronic
954297161 3:49680669-49680691 CTGGGCAGGCAGAGCTCACCAGG + Intronic
954307289 3:49735245-49735267 CTTGGGAGGCTGAGGTGAGAGGG + Intronic
954466753 3:50659665-50659687 CTTGGGAGGTAGAGGTTACAGGG + Intergenic
954504250 3:51053495-51053517 CCTGGGAGGCAGAGCTTGCAGGG - Intronic
954675307 3:52312132-52312154 CTGGCCAGGCAGAGCTGGCTTGG - Intergenic
955077672 3:55629241-55629263 GTGGGGTGGCAGAGATGCCATGG + Intronic
955399493 3:58581300-58581322 CAGGGGAGGCAGTCCTGACAGGG + Intronic
956519164 3:70084642-70084664 ATGGGGAGGGAAAGCTGTCATGG - Intergenic
956750773 3:72342229-72342251 CTGAGGAGGGAGAGCTGGCTTGG - Intergenic
956766110 3:72485909-72485931 CTGGGGAGGAAGGGCTGGCCTGG + Intergenic
957739230 3:84241932-84241954 CTCGGGAGGCAGAGGTTGCAGGG + Intergenic
958693341 3:97496963-97496985 ATTTGAAGGCAGAGCTGACAGGG - Intronic
958841245 3:99208594-99208616 CCTGGGAGGCGGAGCTTACAGGG - Intergenic
959297338 3:104553899-104553921 CTGGCCAGGCAGTGTTGACAAGG - Intergenic
959445612 3:106435429-106435451 CTCGGGAGGTTGAGCTGAGATGG + Intergenic
959572413 3:107899190-107899212 CTGGTAAGGCAGAGCTGGCAGGG - Intergenic
959889073 3:111533913-111533935 CTGAGGAGGCAGAGATGCCCAGG + Intronic
960123197 3:113968555-113968577 CTGGGGAGGCTGAGGTGTAAAGG - Intronic
960364322 3:116752495-116752517 CCTGGGAGGCAGAGCTTGCAGGG - Intronic
961278919 3:125749866-125749888 CTCGGGAGGCGGAGCTTGCAGGG + Intergenic
961452661 3:127009364-127009386 TTGGGGAGGCAGAGCAGGCAGGG + Intronic
961728891 3:128952671-128952693 CTCGGGAGGCTGAGGTGGCAGGG + Intronic
962994418 3:140611379-140611401 CTGGGGAGTCTGAACAGACATGG - Intergenic
963035119 3:141019369-141019391 CTAGGGAGGCAGAGCAGTCTAGG - Intergenic
964355364 3:155846787-155846809 ATGGGGAGACAGAGGTGAGAAGG - Intronic
965150527 3:164968486-164968508 TTTGGGAGGCTGAGGTGACAGGG + Intergenic
965537335 3:169836892-169836914 TTGGGGAGGCAGATCAGAGAGGG + Intronic
965561495 3:170066214-170066236 CCCGGGAGGCAGAGCTTGCAGGG - Intronic
966834529 3:184038788-184038810 CTGGGGAGGCAGAGCTGACAGGG + Exonic
966843322 3:184106506-184106528 CTGCGGAGGCAGAGCTGACAGGG + Exonic
967223212 3:187266708-187266730 CTGGGAAGGCACATCTGATAAGG + Intronic
968317652 3:197737544-197737566 CTGGGTAGCCAGAGCTGGGAAGG + Intronic
968651307 4:1761344-1761366 CAGGGCAGGCAGGGCGGACAGGG - Intergenic
968814185 4:2813173-2813195 GTGGGGAGGCAGGGCAGCCAGGG + Intronic
969234451 4:5855750-5855772 CTGGGCAGGCAGAGGAGAAAGGG + Intronic
969327719 4:6453405-6453427 CTGAGGAGGCAGAGCTGGGGTGG - Intronic
969393556 4:6906794-6906816 CTGGGGAGGCAGAGGTTGCAGGG - Intergenic
969706287 4:8794037-8794059 CTGGGGTGGCAGAGCGGACCTGG - Intergenic
970939611 4:21616082-21616104 CTGGGGAGCCAGAGCTTGTAGGG - Intronic
971196573 4:24475828-24475850 TTGGGGTGACAGAGCTGCCAGGG - Intergenic
971870160 4:32225084-32225106 CTCAGGAGGCTGAGATGACAGGG - Intergenic
972077611 4:35106376-35106398 CTGGGGAGAATAAGCTGACAGGG - Intergenic
973198584 4:47474248-47474270 CTGGGGAGGCTGAGGTGGGAGGG + Intergenic
973849199 4:54944776-54944798 CTGGGCTGGGAGAGCTGAAAGGG + Intergenic
973922789 4:55705744-55705766 CCCGGGAGGCAGAGCTTGCAGGG - Intergenic
975758925 4:77598881-77598903 CTCGGGAGGCAGAGGTTGCAGGG - Intronic
976048147 4:80977680-80977702 CCGGGGAGGCAGAGGTTGCAGGG - Intergenic
976777681 4:88723784-88723806 CTGGGGACACAAAGCTGCCATGG - Intergenic
977632122 4:99254678-99254700 CTTTGGAGGCAAAGCTGGCAGGG - Intergenic
977915443 4:102587138-102587160 CTCGGAAGGCCGAGCTGGCAGGG - Intronic
978255593 4:106689236-106689258 CTTGGAGGGCAGAGATGACATGG - Intergenic
978593718 4:110354482-110354504 CCTGGGAAGCAGAGCTGAGAGGG - Intergenic
979237317 4:118415906-118415928 CTTGGGAGGCAGAGGTTGCAGGG + Intergenic
979275310 4:118809047-118809069 CCTGGGAGGCAGAGCTTGCAGGG - Intronic
979521185 4:121668823-121668845 CTGGGGCTGCAGGGCTGTCATGG + Intronic
979709027 4:123755795-123755817 CTACAGAGGCTGAGCTGACAGGG - Intergenic
980936207 4:139228012-139228034 TTGGGGAGGCAGTGGTTACAGGG + Intergenic
981200722 4:141976199-141976221 CCTGGGAGGCAGAGCTTGCAGGG + Intergenic
981926783 4:150148923-150148945 CTGGGGAGGCTGAGATGAGATGG + Intronic
981956527 4:150480973-150480995 GTGGGGAGGGAGAGATGATAGGG - Intronic
982229214 4:153193205-153193227 CCTGGGAGGCAGAGCTTGCAGGG - Intronic
982943742 4:161591853-161591875 CTGGGGAGGCTAAGATGTCAAGG + Intronic
984119960 4:175730316-175730338 CCCGGGAGGCAGAGGTGGCAGGG - Intronic
984570256 4:181383535-181383557 CTTTGAAGGCAGAGTTGACAGGG - Intergenic
984702829 4:182829061-182829083 CTGGGGAGGCAGAGGGGAGGAGG + Intergenic
985445990 4:190021664-190021686 CTGGGGAGGTGGAGCTGCCCCGG + Intergenic
985451394 4:190065621-190065643 CTGGGGAGGTGGAGCTGCCCCGG - Intergenic
985452384 4:190068914-190068936 CTGGGGAGGTGGAGCTGCCCCGG - Intergenic
985453369 4:190072211-190072233 CTGGGGAGGTGGAGCTGCCCCGG - Exonic
985454359 4:190075504-190075526 CTGGGGAGGTGGAGCTGCCCCGG - Exonic
985455347 4:190078797-190078819 CTGGGGAGGTGGAGCTGCCCCGG - Exonic
985457319 4:190085391-190085413 CTGGGGAGGTGGAGCTGCCCCGG - Intergenic
985458306 4:190088684-190088706 CTGGGGAGGTGGAGCTGCCCCGG - Exonic
985459295 4:190091984-190092006 CTGGGGAGGTGGAGCTGCCCCGG - Exonic
985463547 4:190174753-190174775 CTGGGGAGGTGGAGCTGCCCCGG - Exonic
985502794 5:259418-259440 GTCGGGAGGCGGAGCTCACACGG - Intergenic
985502896 5:259994-260016 GTGGGGAGGCGGAGCTCACACGG - Intergenic
985502960 5:260377-260399 GTCGGGAGGCGGAGCTCACACGG - Intergenic
985503012 5:260697-260719 GTCGGGAGGCGGAGCTCACACGG - Intergenic
985503022 5:260761-260783 GTCGGGAGGCGGAGCTCACACGG - Intergenic
985503111 5:261273-261295 GCGGGGAGGCGGAGCTCACACGG - Intergenic
985503173 5:261625-261647 GTGGGGAGGCGGAGCTCACACGG - Intergenic
985503274 5:262202-262224 GTCGGGAGGCGGAGCTCACACGG - Intergenic
985503284 5:262266-262288 GTCGGGAGGCGGAGCTCACACGG - Intergenic
985663162 5:1167419-1167441 CTGGGCAGGCAGGGCTGGCCAGG - Intergenic
985913248 5:2898879-2898901 CTGAGGAAGGGGAGCTGACAGGG - Intergenic
985933735 5:3079220-3079242 CTGGGGAGGGAAGGCTGACAGGG - Intergenic
985933925 5:3080162-3080184 CTGGAGAGGTGGAGCTGCCAGGG + Intergenic
985973019 5:3392498-3392520 CTGGGGAGGCCGGGGTGACTGGG + Intergenic
985973066 5:3392615-3392637 CTGGGGAGGCTGGGGTGACTAGG + Intergenic
986091945 5:4517469-4517491 CTGGTGAGGCTGATCAGACATGG + Intergenic
986221432 5:5772130-5772152 CTAGGGAGGCAGAGCTCAGTCGG + Intergenic
987706234 5:21464360-21464382 CTTGGGAGGCTGAGATGAGAGGG + Intergenic
988006328 5:25416546-25416568 CTTGGGAGGCAGAGGTTGCAGGG - Intergenic
988010078 5:25470611-25470633 CTGATGAGGCAGAGCTCAGATGG - Intergenic
988382371 5:30514399-30514421 CTTGGGAGGCTGAGATGAGAGGG - Intergenic
988592294 5:32559068-32559090 CTCGGGAGGCAGAGGTTGCAGGG + Intronic
988678304 5:33457271-33457293 CTGGGAAGGCAAAGCAGATATGG + Exonic
988704536 5:33711476-33711498 CTGGGGTGTGAGACCTGACAGGG - Intronic
989058293 5:37385410-37385432 CTTGGGAGGCTGAGGTGAGAGGG + Intronic
989255224 5:39358907-39358929 CCCGGGAGGCGGAGCTTACAGGG + Intronic
989525220 5:42445994-42446016 CAGGGGAGGCAGAACTGCCCAGG + Intronic
990648895 5:57876589-57876611 CTTGGGAGGCTGAAGTGACAGGG - Intergenic
990661415 5:58019836-58019858 CTGGAGTGGCAGTGATGACATGG + Intergenic
991651456 5:68859277-68859299 CTGGAGAGGAAGGGCTGACATGG - Intergenic
992205684 5:74428110-74428132 CCCGGGAGGCAGAGCTTGCAGGG + Intergenic
992335669 5:75766240-75766262 CTGGGGAGGCAGAACAATCATGG - Intergenic
992467233 5:77018522-77018544 CTGGGTGGGCAGATCTGATAAGG - Intergenic
992655640 5:78907125-78907147 CTGGGGAATTAGAGGTGACACGG + Intronic
992908560 5:81372561-81372583 CTGATGAGGCAGAGCCAACAAGG - Intronic
992948587 5:81833995-81834017 CTTGAGAAGCAGAGATGACATGG - Intergenic
993096032 5:83479275-83479297 TTGGGGAAGCTCAGCTGACAAGG - Intronic
994368863 5:98946953-98946975 CCCGGGAGGCAGAGCTTGCAGGG - Intergenic
997282599 5:132658267-132658289 CTGGGGAGGCAAAGCCGCCAAGG - Exonic
997440177 5:133903718-133903740 CGAGGCTGGCAGAGCTGACAAGG - Intergenic
998353400 5:141515448-141515470 CTGGGGATGGAAAGCTGAGAGGG + Exonic
998405932 5:141874745-141874767 GTGGGGAGTCAGAGCTGACCTGG - Intronic
999458383 5:151736940-151736962 CTTGGGAGGTAGAGCAGAAAGGG + Intergenic
999901371 5:156090029-156090051 CTTGGGAAGCAGAGATGTCAGGG - Intronic
1000197708 5:158975739-158975761 CTGGGGGGTCAGAGCTGGAAGGG + Intronic
1000502284 5:162067059-162067081 CTGGGGTTGGAGAACTGACAAGG + Intergenic
1001052738 5:168426009-168426031 CTGGAGCCACAGAGCTGACATGG - Intronic
1001116653 5:168946273-168946295 CTGGGGAGGCTGAGAGGACTGGG - Intronic
1001754811 5:174159984-174160006 CTGGGGAGGGAGAGCAGGCAGGG - Intronic
1001798055 5:174518687-174518709 GTGGGGAAGCAGAGCCCACATGG - Intergenic
1001880912 5:175243383-175243405 CTGGGGTGGCAGAGCTCACTTGG - Intergenic
1002100333 5:176854535-176854557 CTGGGGAAGCAGAGGGGTCAGGG - Intronic
1002401120 5:178992056-178992078 CTGTGGAGGCATAGCTGATCTGG + Exonic
1002655357 5:180742314-180742336 CCCGGGAGGCAGAGCTTGCAGGG - Intergenic
1003548036 6:7077389-7077411 CTTGGGAGGCTGAGGTGACTAGG + Intergenic
1005182829 6:23125958-23125980 ATGGGGCCCCAGAGCTGACACGG - Intergenic
1005568123 6:27116848-27116870 CCCGGGAGGCAGAGATGGCAGGG + Intergenic
1006184978 6:32176301-32176323 CAGGGGATCCAGAGCTGAAAGGG - Intronic
1006450477 6:34103121-34103143 ATGGGGAGACAGAGGTGGCATGG - Intronic
1006612699 6:35304055-35304077 CCCGGGAGGCAGAGGTTACAGGG + Intronic
1006640621 6:35487916-35487938 CTGGGGAGGAGGAGCTGACAGGG - Intronic
1006878876 6:37321808-37321830 CTGGGGAGGCCGTGTTGACTGGG + Intronic
1006988764 6:38194862-38194884 CAGGGGAGGCAGGGCTGGCAGGG + Intronic
1007177327 6:39905861-39905883 TTAGGGAGGCAGAGCTGCCGGGG + Exonic
1007646314 6:43384322-43384344 CCTGGGAGGCAGAGCTTGCAGGG - Intergenic
1007664417 6:43505911-43505933 CTGGGGACCCTGAGCTGCCAAGG - Exonic
1007744695 6:44036385-44036407 CTGGGGAGTCAGAGCTGTACTGG - Intergenic
1007799647 6:44381353-44381375 CCCGGGAGGCAGAGCTTGCAGGG - Intergenic
1008606989 6:53150148-53150170 CTTAGGAGGCAGAGATGAGAAGG + Intergenic
1009021890 6:57955286-57955308 CTTGGGAGGCTGAGGTGAGAGGG - Intergenic
1009058728 6:58371768-58371790 CTGGGGAGGGAGAGATCACTTGG + Intergenic
1009565306 6:65304789-65304811 CTGTTGAGGCAGAGCTGAGTCGG - Intronic
1010191235 6:73199199-73199221 CTGGTGAGGCAGAGCTGGGTAGG - Intergenic
1011149157 6:84249934-84249956 GTGGGGAGGCAGTGTTGGCAGGG + Intergenic
1011889117 6:92134781-92134803 CTGAAGAGGGAGAGCTGGCAGGG + Intergenic
1012559818 6:100566792-100566814 CTAGGGAGGCAGGGATGGCATGG - Intronic
1012679723 6:102164836-102164858 CCCGGGAGGCAGAGGTGGCAGGG - Intergenic
1012914101 6:105149836-105149858 CTGGGGAGGCTGAGGTGGGAGGG + Intergenic
1013304889 6:108838682-108838704 CTGGGGAGGCGGAGGCGAGAGGG + Intergenic
1013367740 6:109447940-109447962 CTGGGGAGGCCTGGCTGACAGGG + Exonic
1014358529 6:120444418-120444440 CTGTTGAGGCAGAGGTGAAATGG + Intergenic
1015803791 6:137088439-137088461 CTGGGGAGGCTGAGGTGGGAGGG + Intergenic
1016770276 6:147841768-147841790 CTGGGGAGGGAGAGGTGATTTGG + Intergenic
1017841759 6:158228015-158228037 CTCGGGAGGCTGAGCTGGGAGGG + Intergenic
1018001844 6:159586524-159586546 CTGGGGAGGAAGGGCTGAGTAGG + Intergenic
1018056110 6:160053817-160053839 CTCAGGAGGCTGAGGTGACAGGG - Intronic
1018199834 6:161384433-161384455 CTTGGGAGGCTGAGGTGGCAGGG + Intronic
1019015743 6:168878557-168878579 CTGGGGAGGCAGCTCTGACCTGG - Intergenic
1019015812 6:168878788-168878810 CTGGGGAGGAAGCTCTGACCTGG - Intergenic
1019015916 6:168879109-168879131 CTGGGGAGGCAGTTCTCACCTGG - Intergenic
1019047741 6:169161428-169161450 GTGCAGAGGCTGAGCTGACAGGG - Intergenic
1019502574 7:1371827-1371849 CCCGGGAGGCAGAGCTTGCAGGG + Intergenic
1019974595 7:4570576-4570598 CTGGGGATGCAGAGGTTGCAAGG + Intergenic
1020058275 7:5133644-5133666 CTTGGGAGGCAGAGGTTGCAGGG + Intergenic
1020063464 7:5169649-5169671 CTTGGGAGGCAGAGGTTGCAGGG + Intergenic
1020152145 7:5690821-5690843 CTGGTGTGGCAGAGCTGTCCTGG - Intronic
1020169299 7:5832681-5832703 CTTGGGAGGCAGAGATCACAGGG - Intergenic
1020170606 7:5841975-5841997 CTTGGGAGGCAGAGGTGGGAGGG - Intergenic
1021434837 7:20602356-20602378 CTGGTGGGGCAGAGCTGGCTGGG - Intergenic
1021893553 7:25211938-25211960 CCCGGGAGGCAGAGCTTGCAGGG - Intergenic
1021983116 7:26073927-26073949 CTTGGGAGGCAGAGGTGGGAAGG - Intergenic
1022295001 7:29042495-29042517 CTTGGGAGGCTGAGGTGAGAGGG + Intronic
1023041980 7:36180325-36180347 CTGGGGAGGCAGAGGGGATGAGG + Intronic
1023056922 7:36298253-36298275 CTGGGGAAGCTGAGCCAACAGGG + Intronic
1023086814 7:36579206-36579228 CTGGGAAGGGACAGCTGGCAAGG - Intronic
1023731713 7:43197924-43197946 CGGGGCAGCCACAGCTGACAGGG - Intronic
1023845148 7:44116283-44116305 CAGGGCAGGGAGAGCTCACAGGG + Intronic
1023852515 7:44158304-44158326 CTGGTCAGGCAGGGCTGCCAGGG + Intronic
1023865912 7:44238387-44238409 CTGGGGAGGCACTGCTGCCCAGG - Intronic
1023867607 7:44245672-44245694 CTTGGGATGCAGAGATGAGAGGG + Intronic
1023882461 7:44328055-44328077 GGTGGGAGGCAGAGATGACACGG - Intronic
1023904890 7:44514935-44514957 CTTGGGAGGCAGAGGTTGCAGGG + Intronic
1023987382 7:45104747-45104769 CTGGGGTGGCAGAGATGAGCTGG + Intronic
1024273548 7:47659863-47659885 CTGGGGAGCCAGAGCCACCAAGG + Exonic
1024585542 7:50838793-50838815 CTGTGCAGGCAGAGCAGAGAAGG + Intergenic
1024623814 7:51187560-51187582 ATGGGCAGGCAGAGGTGAAAAGG + Intronic
1024739653 7:52340223-52340245 AAGGGGAGGCTGAGCTCACAAGG - Intergenic
1024962649 7:54993955-54993977 CCTGGGAGGCAGAGCTTGCAGGG - Intergenic
1025261448 7:57421734-57421756 CTGGGGAGGTGGAGGTGAGAGGG + Intergenic
1025738774 7:64178929-64178951 CTGGGGAGGTGGAGGTGAGAGGG + Intronic
1026013521 7:66654793-66654815 CTGGGAAGGCGGAGCTGACGGGG - Intronic
1026068080 7:67093057-67093079 CTGAGGAGGCAGAGGTGGGAGGG + Intronic
1026330956 7:69352189-69352211 CCTGGGAGGCAGAGGTGGCAGGG - Intergenic
1026510896 7:71026744-71026766 CTTGGGAGGCAGAGGTGGGAGGG - Intergenic
1026839923 7:73664651-73664673 CTGAGGAGGCAGAGCAAACTGGG + Intergenic
1026961257 7:74409189-74409211 CCCGGGAGGCAGAGGTGACAGGG + Intergenic
1027166139 7:75835628-75835650 CTGGGGAGGCCCAGAAGACAGGG - Intergenic
1028162758 7:87504727-87504749 CCCGGGAGGCAGAGCTTGCAGGG + Intronic
1029049742 7:97672612-97672634 GTGGGGTGGAAGAGGTGACAAGG - Intergenic
1029680189 7:102103091-102103113 CTTGGGAGGCAGGGCTGTCTTGG - Intronic
1029899345 7:104022670-104022692 CTGGGAATGCAGAGATGACGGGG + Intergenic
1030085867 7:105815068-105815090 CTGAAGAGGCAAAACTGACATGG - Intronic
1030723072 7:112892662-112892684 CTGGGGAGGCTGAGGTGGGAGGG + Intronic
1030831052 7:114222064-114222086 CTTGGGAGGCTCACCTGACATGG - Intronic
1031976995 7:128100446-128100468 GTGGGGAGGCTGAGATGACTGGG + Intergenic
1032081205 7:128859348-128859370 CTGGGGAGGCAGAGGCGGCCTGG + Intergenic
1032578874 7:133084986-133085008 CTGGGGAGGCTGAACTGGGAGGG - Intergenic
1032743224 7:134760316-134760338 ATGGAGAGGCAGAGCAGGCAGGG + Intronic
1032941953 7:136803872-136803894 CCCGGGAGGCAGAGCTTGCAGGG + Intergenic
1033424965 7:141235914-141235936 CTGGGAAGGCTGAGCTGGGACGG - Intronic
1033448080 7:141439294-141439316 CTGAGGAGGCAGCTCTGGCATGG - Intronic
1033755027 7:144391253-144391275 CTCGGGAGGCTGAGGCGACAGGG + Intergenic
1034088743 7:148344691-148344713 GTGAGGAGGCAGAGCTGGCATGG + Intronic
1035284293 7:157796394-157796416 CAGGGGCAGCAGAGCTGACTAGG - Intronic
1035525802 8:312197-312219 CCAGGGAGGCTGAGCTGTCAAGG - Intergenic
1035567970 8:654387-654409 CTGGAGGGGCAGAGCTGGGACGG + Intronic
1035571169 8:673620-673642 CTAGCGAGGAAGACCTGACACGG - Exonic
1035596577 8:862811-862833 CTGAGGATGCACTGCTGACATGG + Intergenic
1036433164 8:8708183-8708205 CAGGGGGGACAGTGCTGACAAGG + Intergenic
1038024023 8:23573232-23573254 CGGGTGACGCAGAGCAGACAAGG - Exonic
1038420385 8:27430628-27430650 CTGGGGCCGCAGAGCTGATACGG - Intronic
1038490222 8:27965366-27965388 CTGGCCAGGCCGAGCTGACTTGG - Intronic
1038797484 8:30722622-30722644 CTGGGGAGGCTGAGGTGGGAGGG + Intronic
1040695087 8:49986771-49986793 CTCGGGAGGCAGAGGTGGGAGGG + Intronic
1040737784 8:50531646-50531668 CCTGGGAGTCAGAGCTCACAGGG + Intronic
1042319158 8:67456924-67456946 CTGTGGAGGAAGAGCTCTCAGGG + Intronic
1042684701 8:71425205-71425227 CCCGGGAGGCAGAGCTTGCAGGG + Intronic
1043052402 8:75400350-75400372 CTGGTAAGTCAGAGCTGATATGG - Intergenic
1043426122 8:80150325-80150347 CTGCAGAGGCAGGGCTGTCATGG + Intronic
1044355587 8:91219039-91219061 CTGTGTATGCAGAGCTGACAGGG - Intronic
1045619808 8:103962730-103962752 CTGGGGAAGCTGAGCTGAGAGGG - Intronic
1045941705 8:107746225-107746247 CTTGGGAGGCAGAGGTTGCAGGG + Intergenic
1046593088 8:116229008-116229030 CTTGGGAGGCAGAGGTGGGAAGG - Intergenic
1046641494 8:116736584-116736606 CCGGGGAGGCAGAGTTTGCAGGG + Intronic
1047518096 8:125572631-125572653 CTGGGGAGTCTGAGCTGACCAGG + Intergenic
1047779035 8:128096944-128096966 CTGGGGAGGCAGAGGAAACATGG - Intergenic
1048317318 8:133371788-133371810 CTGGGAAGCCAGAGCTGAGCTGG - Intergenic
1048739409 8:137537866-137537888 CTCGGGAGGCTGAGCTTGCAGGG + Intergenic
1048884484 8:138898732-138898754 CTGGGGTGGGAGATCTGATAGGG - Intronic
1049204686 8:141358280-141358302 CTCGGGATGGAGAGCTGATAAGG + Intronic
1049214670 8:141402203-141402225 GTGGGCAGGCACAGCTGGCAGGG + Intronic
1049247432 8:141570302-141570324 TTGTGGAGGGAGAGGTGACATGG + Intergenic
1049282734 8:141758728-141758750 CAGGGGAGGGAGAGCTGAGGAGG - Intergenic
1049353001 8:142174270-142174292 CTAGAGAGGCGGAGCTGACCAGG + Intergenic
1049503130 8:142978725-142978747 CTGGAGAGACAGAGGGGACATGG + Intergenic
1049536033 8:143182971-143182993 CTGGAGAGGGAGGGCTGAGAAGG - Intergenic
1049551809 8:143263509-143263531 CAGGGGAGGGAGAGCTGGGAGGG - Intronic
1050951510 9:11601314-11601336 CCCGGGAGGCAGAGCTTGCAGGG + Intergenic
1051161334 9:14211704-14211726 CTGGGGAAGCACAGCTCAGACGG - Intronic
1052495488 9:29218476-29218498 CAGGGGAGGTAGAATTGACAAGG - Intergenic
1052657852 9:31387043-31387065 CTTGGGAGGCTGAGGTGAGACGG - Intergenic
1052765049 9:32632649-32632671 CTGGGGTGGCAGATCCCACAGGG - Exonic
1052816548 9:33106602-33106624 CTGGTGAGGGAGGGCTGGCATGG - Intronic
1053008429 9:34619954-34619976 CTGGGGAGGCAGAGCAGAGGTGG - Intronic
1053221778 9:36318594-36318616 CCTGGGAGGCAGAGGTTACAGGG + Intergenic
1053428714 9:38027835-38027857 CTGGGGAGGCAGAAGGGACAGGG + Intronic
1053512581 9:38701209-38701231 TGGGGGAGGCAGAGCCCACAGGG + Intergenic
1054140067 9:61521028-61521050 TTTGGGAGGCAGAGGTCACAAGG - Intergenic
1055770369 9:79710509-79710531 CTGGGGAGGCAGCACATACACGG - Intronic
1055868948 9:80850956-80850978 CTGGAGAGACAGAGGTTACATGG + Intergenic
1056284944 9:85078249-85078271 CTGGGGGAGCAGAGCTCATATGG + Intergenic
1056488388 9:87081993-87082015 TTAGGGAGGCAGAGGTGATAAGG - Intergenic
1056975240 9:91246940-91246962 CTGGGAAGGCATTGCTGGCATGG - Intronic
1057059662 9:91992257-91992279 CTGGGAAGCCAGTGCTGTCATGG - Intergenic
1057175119 9:92991152-92991174 CTAGGGAGGCAGAGGTTGCAGGG - Intronic
1057191870 9:93092882-93092904 CTTGGAAGGCAGAGCCCACAGGG + Intergenic
1057326311 9:94067675-94067697 CTTGGGAGGCAGAGGTTACAGGG - Intronic
1057720800 9:97530561-97530583 CCCGGGAGGCAGAGCTTGCAGGG - Intronic
1057754171 9:97818108-97818130 CTGGGGAGGTAGAGTGGACATGG + Intergenic
1057803675 9:98205637-98205659 CTCGGGAGGCTGAGGTGATAAGG - Intronic
1058478141 9:105361941-105361963 CTCGGGAGGCAGAGGTGGGAGGG + Intronic
1058583665 9:106484666-106484688 CCAGGGAGACAGTGCTGACAAGG + Intergenic
1059740639 9:117146212-117146234 CTGGGGAGTCAGAGCTCAGCGGG - Intronic
1060036932 9:120263799-120263821 CTGGAGAGGCAGAGGCGACCAGG + Intergenic
1060234604 9:121853525-121853547 GTGGGGATGCAGAGTGGACAGGG + Intronic
1060309117 9:122443545-122443567 AAGGGCAGGAAGAGCTGACATGG - Intergenic
1060891576 9:127192540-127192562 CTCAGGAGGCTGAGCTGACAGGG + Intronic
1061281877 9:129602264-129602286 CTCGGGAGGCTGAGGTGACAGGG - Intergenic
1061338713 9:129961658-129961680 CCCGGGAGGCAGAGGTCACAGGG - Intronic
1061940683 9:133882287-133882309 CTGTGAAGGCTGAGCGGACAGGG - Intronic
1061973476 9:134056771-134056793 GTGGGGAGGGAGGGCTGAGACGG + Intronic
1062048402 9:134434944-134434966 CTGGGCAGGCAGCGGGGACACGG - Intronic
1062174325 9:135152637-135152659 CTTGGAAGGCAGAGCTCCCAGGG + Intergenic
1062400658 9:136371293-136371315 CGGGGGAGGCGGGGCCGACAGGG - Intronic
1062707833 9:137954980-137955002 CTGGGGATGCTGAGCTGGAAGGG + Intronic
1185668763 X:1788770-1788792 CTGGGGAGGGAGAGTGGAAAGGG - Intergenic
1185851357 X:3491696-3491718 CCCGGGAGGCAGAGCTTGCAGGG + Intergenic
1185892310 X:3832636-3832658 CTCGGGAGGCAGAGGTTTCAGGG - Intronic
1185897418 X:3871055-3871077 CTCGGGAGGCAGAGGTTTCAGGG - Intergenic
1185902537 X:3909487-3909509 CTCGGGAGGCAGAGGTTTCAGGG - Intergenic
1186092711 X:6066999-6067021 CTTGGGAGGCTGAGGTGAGAGGG + Intronic
1186122815 X:6381999-6382021 CTTGGGAGGCTGAGCTGGGAGGG - Intergenic
1187791288 X:22952903-22952925 CTGGGGCAGCAGAGCAGACCAGG + Intergenic
1188106422 X:26152669-26152691 CTGGAGAGGAAGAGATGAAATGG - Intergenic
1188923396 X:36008211-36008233 GAGGGGAATCAGAGCTGACAGGG - Intergenic
1189299498 X:39942310-39942332 ATGGGGAGGATGAGCTGAAAAGG - Intergenic
1190283424 X:48946450-48946472 GAGGGGAGGAAGAGGTGACAAGG + Intronic
1190412740 X:50153237-50153259 CTGTGGAGTCTGAGCTCACAGGG - Intergenic
1194150808 X:90323393-90323415 CTGCAGAGGCAGAGCCTACATGG - Intergenic
1194334265 X:92626131-92626153 CTCGGGAGGCGGAGCTTGCAGGG + Intergenic
1197114483 X:122817278-122817300 CTGGGCATCCAGAGCTGTCAAGG - Intergenic
1197648466 X:129041458-129041480 CTGGGGACCCTGAGCTGCCAAGG + Intergenic
1198083651 X:133263119-133263141 CTGGGGAGGCCGCACTAACATGG + Intergenic
1198249711 X:134868210-134868232 CTTGGGAGGCTGAGGTGAGAGGG - Intergenic
1198623366 X:138539000-138539022 CTGGGGAGGTGGAGCTTGCAGGG + Intergenic
1198952043 X:142082538-142082560 CTACGGAGGCAGAGCTCTCATGG - Intergenic
1199728960 X:150612085-150612107 CTTGGGAGGCTGAGGTGAGAGGG + Intronic
1199875742 X:151926562-151926584 CTGGGGAGACTCAGCTGTCAAGG - Intergenic
1200087677 X:153616980-153617002 CTGGGGAGGCTGAGGTGGGAGGG - Intergenic
1200497176 Y:3900154-3900176 CTGCAGAGGCAGAGCCTACATGG - Intergenic
1201379013 Y:13352414-13352436 CTTGGGAGGCTGAGGTGAGAGGG - Intronic
1202031717 Y:20582284-20582306 CTCGGGAGGCAGAGGTTGCAGGG - Intronic