ID: 966835918

View in Genome Browser
Species Human (GRCh38)
Location 3:184049412-184049434
Sequence AGAGAAAGAAGACAGTGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966835914_966835918 4 Left 966835914 3:184049385-184049407 CCCAAGACATAAGCTCCAAAGAT No data
Right 966835918 3:184049412-184049434 AGAGAAAGAAGACAGTGTGGAGG No data
966835913_966835918 28 Left 966835913 3:184049361-184049383 CCAAGAATTCTAGAGATATGTAA No data
Right 966835918 3:184049412-184049434 AGAGAAAGAAGACAGTGTGGAGG No data
966835912_966835918 29 Left 966835912 3:184049360-184049382 CCCAAGAATTCTAGAGATATGTA No data
Right 966835918 3:184049412-184049434 AGAGAAAGAAGACAGTGTGGAGG No data
966835915_966835918 3 Left 966835915 3:184049386-184049408 CCAAGACATAAGCTCCAAAGATG No data
Right 966835918 3:184049412-184049434 AGAGAAAGAAGACAGTGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966835918 Original CRISPR AGAGAAAGAAGACAGTGTGG AGG Intergenic
No off target data available for this crispr