ID: 966837355

View in Genome Browser
Species Human (GRCh38)
Location 3:184059431-184059453
Sequence TCCAGGTGGCCATCAGGCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 2, 2: 1, 3: 19, 4: 204}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966837350_966837355 -4 Left 966837350 3:184059412-184059434 CCATCTTCTCCGGTCTCTCTCCA 0: 1
1: 0
2: 0
3: 47
4: 486
Right 966837355 3:184059431-184059453 TCCAGGTGGCCATCAGGCGCAGG 0: 1
1: 2
2: 1
3: 19
4: 204
966837347_966837355 18 Left 966837347 3:184059390-184059412 CCCTCTGACATCTATTTATTTGC 0: 1
1: 0
2: 4
3: 34
4: 398
Right 966837355 3:184059431-184059453 TCCAGGTGGCCATCAGGCGCAGG 0: 1
1: 2
2: 1
3: 19
4: 204
966837348_966837355 17 Left 966837348 3:184059391-184059413 CCTCTGACATCTATTTATTTGCC 0: 1
1: 0
2: 2
3: 31
4: 270
Right 966837355 3:184059431-184059453 TCCAGGTGGCCATCAGGCGCAGG 0: 1
1: 2
2: 1
3: 19
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966837355 Original CRISPR TCCAGGTGGCCATCAGGCGC AGG Exonic
900671801 1:3858910-3858932 TCCAGGTGCCCATCAGGGTGGGG + Intronic
900750041 1:4389985-4390007 TCCATGTGGCCTGCAGGGGCTGG - Intergenic
902412121 1:16217698-16217720 GCCAGGTGGGCATGGGGCGCGGG + Intergenic
903500325 1:23796925-23796947 TCCAGGTGGCGATCGGGCGACGG - Exonic
904417230 1:30370739-30370761 TCCAGGTGGCCTCTAGGAGCTGG - Intergenic
905494324 1:38372587-38372609 TCAAGGTGGCCAACAGGGGCTGG - Intergenic
907296297 1:53457814-53457836 TCAAGGTGGACACCAGGCGTGGG + Intergenic
910802601 1:91160862-91160884 TCCAGGCGACCATCAGGTGGTGG - Intergenic
912512463 1:110198516-110198538 TTGAGGTGGCCACCAGGCCCAGG + Exonic
914919240 1:151836615-151836637 TCCAGGTGTCCACCAGGTGGTGG - Intergenic
916531022 1:165656619-165656641 TCCAGGTGGCCATTTGGCCAAGG - Intronic
917535533 1:175871946-175871968 TCCAGGTGGGCCTCAGGAGCTGG - Intergenic
920052361 1:203171745-203171767 TCCAGGTGTCCATCCCGCTCTGG + Intronic
923057430 1:230437526-230437548 TGCAGGTGGCCACCAGGAGCTGG - Intergenic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
924351137 1:243115677-243115699 TCCATGTGGACATCAGGCCAAGG + Intergenic
1062761762 10:28005-28027 TCCAGCTGGCCAGCAGCAGCAGG + Intergenic
1064501275 10:15976347-15976369 TCCAGGAGGCCAGGAGGAGCAGG - Intergenic
1064775907 10:18777147-18777169 GTCAGGTGACCATCAGGCGGTGG + Intergenic
1064848791 10:19686639-19686661 GCCAGGTGACCATCAGGTGATGG - Intronic
1066287732 10:33984662-33984684 TCTAGATGGCCATCAGGACCAGG - Intergenic
1067566759 10:47345141-47345163 TCCAGTTGGCCATCAGTGGTTGG - Intergenic
1068373990 10:56155153-56155175 TCCAGCTGGCCAGCAAGCGCCGG - Intergenic
1069122535 10:64585083-64585105 CCCAGGTGTCAATCAGGAGCAGG - Intergenic
1069854155 10:71430230-71430252 TCCATGTGCCCAGCAGGGGCTGG + Intronic
1069857905 10:71451796-71451818 TCCAGGCGCACACCAGGCGCAGG - Intronic
1070857629 10:79619902-79619924 TCCAGGTTGCCATCAGTAACAGG - Intergenic
1073849540 10:107598898-107598920 TTCAGGTGACCATCAGGTGATGG + Intergenic
1075402415 10:122170775-122170797 TCCTGGTGAACATCAGGCGAGGG - Intronic
1075409077 10:122214148-122214170 TCCAGGTGGCCAGCAGTCCCAGG + Intronic
1076612568 10:131735841-131735863 TGCAGGTGGCCAAGAGGAGCTGG + Intergenic
1077012003 11:383150-383172 TCCAGGTGGCCTTGAGAAGCTGG - Intergenic
1077223140 11:1426168-1426190 GCCACGTGGCCATCAGGGCCTGG + Intronic
1079244741 11:18743918-18743940 TCCAGGTGGCCATCCTGGGGAGG + Intronic
1080011232 11:27461742-27461764 TCCATGTGGACATAAGGAGCAGG - Intronic
1080911335 11:36602365-36602387 TGCAGGTGGCTAACAGGCTCAGG + Intronic
1083199583 11:61112195-61112217 CCCAGCTGCCCATCAGGAGCAGG - Intronic
1085245571 11:75098237-75098259 TCCAGCTGGCCTGCAAGCGCAGG - Intergenic
1085524808 11:77157982-77158004 GCCAGGTGGGCAACAGGGGCTGG + Intronic
1086102466 11:83115743-83115765 TCCAGGGGGCAAACAGGCGGGGG - Intergenic
1086397778 11:86433851-86433873 TCCAGCTGGCCCACAAGCGCCGG + Intergenic
1090137273 11:124210640-124210662 TCCAGGTGGCTTCCAGGGGCGGG + Intergenic
1092683424 12:11014899-11014921 GTCAGGTGGCCATCAGGTGATGG + Intronic
1094811510 12:34142946-34142968 TCCAGCTGGCCAGCAGCAGCAGG + Intergenic
1095924770 12:47567431-47567453 TCCAGGAGGCCAGCAGGGCCTGG - Intergenic
1096502791 12:52075286-52075308 TCCAGGTGTCCATGAGAGGCAGG + Intronic
1096788412 12:54030893-54030915 TGCAGGGGGCCGGCAGGCGCGGG - Intronic
1097046338 12:56189809-56189831 TCCAGGCGGCCGCCAGTCGCTGG + Intergenic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1098744100 12:74213637-74213659 TCGAGGAGGACATCAGCCGCTGG - Intergenic
1098846127 12:75538082-75538104 GCCAGGTGACCATCAGGTGATGG + Intergenic
1101407183 12:104438925-104438947 GTCAGGTGGCCATCAGGTGATGG + Intergenic
1102059341 12:109920973-109920995 TTCAGGAGGCCACCAGGAGCCGG - Intronic
1104767253 12:131338158-131338180 TGGAGATGGCCATCAGGGGCAGG - Intergenic
1104955872 12:132465551-132465573 TCCAGGTGGCCGAGAGGCCCTGG - Intergenic
1106568447 13:30906437-30906459 TCCTGGGGACCATCAGGTGCCGG + Exonic
1107883675 13:44855978-44856000 TCCAGGTGGCCCAGAGGGGCTGG - Intergenic
1113434841 13:110282982-110283004 TCCAGGTGCCCCTGAGGCCCTGG + Intronic
1113484740 13:110645753-110645775 CCCAGGTGGCCCTGAGGCCCGGG + Intronic
1114084966 14:19232053-19232075 CCCAGGTGACCATCAGGCCATGG - Intergenic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1117319734 14:54609533-54609555 ACAAGGTGACCATCAGGAGCAGG - Intronic
1117396791 14:55318797-55318819 TCCAGTTGCCCATCAGTAGCTGG + Intronic
1117961030 14:61161765-61161787 TCCAGTTGGCAATAAGGAGCTGG - Intergenic
1121323780 14:93007973-93007995 CCCAGGAGGCCACCAGGCCCAGG + Intronic
1122000411 14:98646373-98646395 TTCATGTGGCCATCAAGCACTGG + Intergenic
1122263253 14:100535059-100535081 GCCAGGCAGCCTTCAGGCGCAGG - Intergenic
1202896568 14_GL000194v1_random:13866-13888 CCCAGGTGACCATCAGGCCATGG - Intergenic
1128940546 15:71784499-71784521 TACAGGAGTCCACCAGGCGCCGG + Intergenic
1130600748 15:85271512-85271534 TTCAGGTGGCCACCCGGGGCAGG - Intergenic
1132658635 16:1051842-1051864 CCCAGGGGGCCAACAGGCCCTGG - Intergenic
1132884090 16:2174901-2174923 TCCAGGCAGGCATCAGGGGCTGG + Intronic
1133307676 16:4821085-4821107 TCCAGGTGACTGTCAGGCACAGG + Intronic
1135836027 16:25826160-25826182 TGCACGTGGCCAGCAGGGGCAGG - Intronic
1139949896 16:70663731-70663753 TGCTGGTGGCCATCCGGCGTGGG - Exonic
1141847699 16:86622131-86622153 AGCAGGTGGCCGTCAGGGGCCGG - Intergenic
1142082520 16:88157701-88157723 CCCAGGAGGCCACCAGGAGCGGG - Intergenic
1142203588 16:88772363-88772385 TCCATGTGGACATGAGGCCCAGG + Intronic
1142848267 17:2692354-2692376 TCAAGGTGGCCCTCAGGTGAGGG - Exonic
1143581584 17:7830774-7830796 TGTAGGTGGTCAGCAGGCGCCGG - Exonic
1144312193 17:14023996-14024018 CCCAGGTGATCATCAGGCCCAGG + Intergenic
1144332572 17:14237348-14237370 CCCAGGTGATCATCAGGCCCAGG - Intergenic
1144498255 17:15764165-15764187 CCCAGGTGATCATCAGGCCCAGG + Intergenic
1144848880 17:18234109-18234131 TCCAGATGACCAGCAGGCCCCGG - Exonic
1145161635 17:20579207-20579229 CCCAGGTGATCATCAGGCCCAGG + Intergenic
1145294401 17:21576269-21576291 CCCAGGTGGACAACAGGCCCTGG - Intergenic
1145302921 17:21653496-21653518 TCCAGGTGGACATCAAGCCTCGG + Intergenic
1145369431 17:22296911-22296933 CCCAGGTGGACAACAGGCCCTGG + Intergenic
1146634593 17:34494676-34494698 TCCAGGTGACCAGAAGGAGCAGG + Intergenic
1148793384 17:50185942-50185964 CCTCGGTGGACATCAGGCGCAGG + Exonic
1152253589 17:79224561-79224583 TCCAGGTGGCCCTGCGGCCCAGG + Intronic
1152954669 18:28335-28357 TCCAGCTGGCCAGCAGCAGCAGG + Intergenic
1155626926 18:27845380-27845402 GCCAAGCGGCCATCAGGAGCTGG - Intergenic
1157915098 18:51656596-51656618 GTCAGGTGACCATCAGGTGCTGG - Intergenic
1158965234 18:62616732-62616754 CCCAGCTGGCCATCAGGAGCAGG + Intergenic
1160156920 18:76441574-76441596 TCGAGGTGGCCGGCGGGCGCGGG + Exonic
1160297939 18:77654928-77654950 TCCAGGTGGCCTCCAGGAGCTGG + Intergenic
1160966995 19:1751028-1751050 TCCAAGTGTCCATCAGCCGAAGG + Intergenic
1162318615 19:9957234-9957256 TTCAGGTGGCCTTAAGGGGCTGG + Intergenic
1165188386 19:34041139-34041161 TCCAGGTGCCCATCAGTGGTGGG - Intergenic
1165335966 19:35169792-35169814 GCCAGGTAGCCTTCAGGGGCGGG - Exonic
1166670407 19:44706521-44706543 CCCAAGTGGCCATCAGCCCCCGG + Intronic
1167522160 19:49961387-49961409 TCCAGGGGGCCATGAGACACTGG + Intergenic
928850014 2:35734396-35734418 TCCAGCTGGCCAGCAGCAGCAGG + Intergenic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
929897766 2:45976483-45976505 GGCAGGGGGCCGTCAGGCGCAGG + Exonic
931884967 2:66607348-66607370 GCCAGGTGACCATCAGGTGATGG + Intergenic
933046195 2:77540078-77540100 TCCAGGTGGAAATCTGGTGCAGG + Intronic
937330477 2:121024225-121024247 TGCAGGTGGCCCTCAGAAGCAGG + Intergenic
937912011 2:127080338-127080360 TCCAGGTGTCCAGGAGGGGCTGG + Intronic
941917128 2:170820238-170820260 TCCCGGTGGCCGCCAGTCGCCGG + Intronic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
943191799 2:184686283-184686305 TCCAGGGGGCCAGCAAGAGCTGG - Intronic
944242666 2:197500555-197500577 TCCAAGGTGCCATCGGGCGCTGG - Intronic
945134901 2:206616641-206616663 TCCAGCTGGCCCTCAGTCGGTGG + Intronic
946879824 2:224165363-224165385 TACAGGTGGCCACCAGCTGCTGG - Intergenic
947098357 2:226592076-226592098 TCCAGCTGGCCAGCAGCAGCAGG - Intergenic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1171200751 20:23240142-23240164 GCCAGGTGACCATCAGGTGATGG - Intergenic
1171520374 20:25770896-25770918 CCCAGGTGTACATCAGGCTCAGG + Intronic
1171556545 20:26085597-26085619 CCCAGGTGTACATCAGGCTCAGG - Intergenic
1173246530 20:41341176-41341198 TCCAGGGGGCCTGCAGCCGCTGG - Intronic
1174452311 20:50627985-50628007 GCCAGGGGGCCATCCGGCCCAGG - Intronic
1176305198 21:5119559-5119581 CCTGGGTGGCCATGAGGCGCTGG - Intronic
1176616254 21:9029862-9029884 CCCAGGTGACCATCAGGCCATGG - Intergenic
1176708901 21:10133875-10133897 CCCAGGTGACCATCAGGCCATGG + Intergenic
1178624640 21:34204598-34204620 CCCAGGTGGCCAGCAGCCCCTGG + Intergenic
1178681399 21:34675322-34675344 ACCAGGAGTCCATCAGACGCTGG - Intronic
1179851856 21:44142471-44142493 CCTGGGTGGCCATGAGGCGCTGG + Intronic
1180293004 22:10861140-10861162 CCCAGGTGACCATCAGGCCATGG + Intergenic
1180495809 22:15890562-15890584 CCCAGGTGACCATCAGGCCATGG + Intergenic
1181023338 22:20114556-20114578 TCCAGGTAGCCATGAGTCCCTGG - Exonic
1181038068 22:20179376-20179398 TCCAGGTGGGCCTCAAGCCCAGG - Intergenic
1181419436 22:22787526-22787548 CCCAGGTGCACATCAGGCACAGG - Intronic
1182300045 22:29332082-29332104 TCCAGATGGCCATCTGGGGGAGG - Intronic
1184142114 22:42583960-42583982 GCCACGTGGCCATCTGGAGCTGG - Exonic
1184587027 22:45454812-45454834 TCCAGGTGGCCAGCAATGGCTGG - Intergenic
1184735560 22:46395705-46395727 TGCTGGTGGCCATCAGGTGCAGG - Intronic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
950396031 3:12734744-12734766 TCCAGGTGGGCAGCAGAGGCAGG - Exonic
950572600 3:13811354-13811376 GCCAGGAGGGCATCAGGGGCTGG - Intergenic
952337276 3:32414870-32414892 TCCAGGTGGAAAACAGGCCCTGG + Intronic
952867483 3:37863531-37863553 TCCAGGTGTTCACGAGGCGCAGG - Intronic
952925261 3:38315452-38315474 CCCAGCTGGCCAGCAGGCTCAGG - Intronic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
956386514 3:68725265-68725287 TCCAGCTGGCCAGCAGTGGCAGG - Intergenic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
960629775 3:119717941-119717963 TCCAGGTGGGCATGAGGCCTTGG + Intronic
960987905 3:123292446-123292468 TCCAGGAGGCCACCAGGCCATGG - Intronic
961315419 3:126032248-126032270 CCCAGGTGGCCAGGAGGAGCTGG + Intronic
961442000 3:126958795-126958817 TCCACGTGGGCAGGAGGCGCTGG + Intronic
961455661 3:127022694-127022716 TCCAGCTGTCCAGCAGGCACAGG - Intronic
962695873 3:137946607-137946629 TCCAGGAAGCCTTCAGGCCCCGG - Intergenic
966834370 3:184038016-184038038 ACCAGGTGGCCATCAGGCGCAGG + Exonic
966837355 3:184059431-184059453 TCCAGGTGGCCATCAGGCGCAGG + Exonic
966840432 3:184083167-184083189 ACCAGGTGGCCATCAGGTGCAGG + Intergenic
966843150 3:184105760-184105782 ACCAGGTGGCCATCAGGCGCAGG + Exonic
968042146 3:195597681-195597703 TCCAGGAGGCCCTCAGGCCCTGG - Intergenic
968581484 4:1397336-1397358 CCCAGGTGGCCATCACAAGCAGG + Intergenic
969199626 4:5592489-5592511 GTCAGGTGGCCATCAGGTGATGG + Intronic
969850803 4:9954792-9954814 GTCAGGTGGCCATCAGGTGATGG + Intronic
973175484 4:47199944-47199966 TCCAGGTGGCCAAAAGTAGCTGG - Intronic
975596468 4:76051399-76051421 TCAAGGTAGCCATTAGGCACTGG + Intronic
980158351 4:129132825-129132847 TCCTGGTGGACATCAGGTGCAGG + Intergenic
980623681 4:135344413-135344435 TGCAGGTGGCTGTCAGGCACTGG - Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
984873834 4:184350088-184350110 TCCAAGTGGCCATCTTGTGCAGG - Intergenic
985511389 5:316026-316048 TCCAGGTGCCCATGAGGCGAGGG - Intronic
985580862 5:694435-694457 ACCAGGTGTCCAGCAGGCCCTGG + Intergenic
985595487 5:785767-785789 CCCAGGTGTCCAGCAGGCCCTGG + Intergenic
985674198 5:1221835-1221857 GCCAGGGGACCATCAGGGGCTGG + Exonic
986685690 5:10273699-10273721 GTCAGGTGGCCATCAGGCGATGG - Intergenic
986884367 5:12215719-12215741 GTCAGGTGACCATCAGGCGATGG - Intergenic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
988806827 5:34748013-34748035 TCCTGGTGGCCATGAAGGGCTGG + Intronic
990230967 5:53712578-53712600 TCCAGCTGGCCAGCAGCAGCAGG - Intergenic
991030477 5:62077320-62077342 GTCAGGTGGCCATCAGGTGATGG + Intergenic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
994151222 5:96449760-96449782 TCCAGGAGGCCAGCAGGCTGTGG - Intergenic
998074733 5:139226315-139226337 GCCAGGTGACCATCAGGTGATGG - Intronic
1003441408 6:6146021-6146043 TCCCAGTGGCCATCAGGAGCTGG + Intronic
1005267371 6:24126208-24126230 CCCAGCTGTCAATCAGGCGCGGG + Exonic
1006679396 6:35786633-35786655 TGTAGGTGACCATCAGGCACAGG + Intronic
1007049713 6:38814882-38814904 TCCAGATGCCCATCAGCAGCTGG - Intronic
1007687776 6:43677255-43677277 TCCAGGCGGCCATCAGGAGAAGG + Intronic
1017767154 6:157616262-157616284 TCCAGGTGGTCAGCAGGAGGTGG - Intronic
1018690767 6:166342520-166342542 TCCTGGTGGGCGTCAGGGGCAGG - Exonic
1019642055 7:2108837-2108859 CCCAGGTGGCCTCCAGGAGCCGG + Intronic
1021021264 7:15600528-15600550 TCCAGGGAGCCAGCAGGAGCTGG - Intergenic
1023845201 7:44116523-44116545 CCCAGAAGGCCATCAGGCCCAGG + Intronic
1025024029 7:55501471-55501493 TCTGGGTGGCCCTCAGGCTCAGG + Intronic
1025030061 7:55549573-55549595 TGCAGGTGGCCGGCAGGAGCAGG + Intronic
1030063476 7:105641375-105641397 TCCAGGTCGACATGAGGCGCTGG - Intronic
1030711712 7:112757627-112757649 TCCAGGTGGCCCTCATGGGCAGG - Intergenic
1031189356 7:118527248-118527270 CCCAGGTGTCAATCAGGTGCAGG - Intergenic
1033446549 7:141428050-141428072 GCCAGGTGACCATCAGGTGATGG + Intronic
1034101948 7:148457808-148457830 TCCAGGAAGCCAGCAGGAGCTGG - Intergenic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1035788450 8:2281381-2281403 TCCAGGAGGCCATCAGTAGCAGG - Intergenic
1035804355 8:2440324-2440346 TCCAGGAGGCCATCAGTAGCAGG + Intergenic
1035818507 8:2566108-2566130 GCCAGGTGACCATCAGGCAATGG - Intergenic
1036765282 8:11546076-11546098 TCCAGGTGTTCATCGGGCGGTGG - Exonic
1044702281 8:94975511-94975533 TCCAGGAGGCCAGCAGCTGCAGG - Intronic
1045509991 8:102806640-102806662 TCCAGGCTGACATCAGACGCTGG - Intergenic
1046288872 8:112132724-112132746 TCCAGCTGGCCTGCAAGCGCCGG - Intergenic
1047161634 8:122387008-122387030 TCCAGTTGGCCCCCAGGCTCGGG + Intergenic
1049496766 8:142939251-142939273 CCCAGGAGGCCAGCAGGGGCAGG + Intergenic
1049771202 8:144382860-144382882 ACCAGATGGCCATAAGGGGCAGG - Intronic
1051499991 9:17765861-17765883 TCCAGGCAGCCAACAGGCACTGG + Intronic
1053645882 9:40119390-40119412 CCCAGGTGACCATCAGGCCATGG + Intergenic
1053759836 9:41344146-41344168 CCCAGGTGACCATCAGGCCATGG - Intergenic
1054326891 9:63717291-63717313 CCCAGGTGACCATCAGGCCATGG + Intergenic
1054538691 9:66256582-66256604 CCCAGGTGACCATCAGGCCATGG - Intergenic
1055058672 9:72046877-72046899 GCCAGGTGACCATCAGGTGATGG + Intergenic
1058915623 9:109561613-109561635 TACAAGTGGCCATCAAGTGCTGG + Intergenic
1059334852 9:113562661-113562683 TCTAGGTGGCCCACAGGCCCAGG - Intronic
1060730993 9:126036972-126036994 TGCAGGCGGCCATCCGTCGCAGG + Intergenic
1060893764 9:127204575-127204597 TCCTGGAGGCCAGCAGGTGCTGG - Intronic
1061659485 9:132119356-132119378 TTCACATGGCCAGCAGGCGCAGG - Intergenic
1062162497 9:135087915-135087937 CCCAGGCGGCCTTCAGGCGGCGG - Exonic
1062207986 9:135347718-135347740 TCAAGGAGGCCTTCAGGAGCCGG - Intergenic
1202793662 9_KI270719v1_random:102845-102867 CCCAGGTGACCATCAGGCCATGG + Intergenic
1187902063 X:24034677-24034699 GCCACGTGGCCATCTGGAGCTGG - Intergenic
1191022870 X:55881200-55881222 TCCAGGAGTCAATCAGGAGCAGG - Intergenic
1192366338 X:70476875-70476897 TCCAGCTGCCCATCAGTCTCTGG - Intronic
1195752817 X:108174910-108174932 TCCAGGCAGCCTTCAGGCCCAGG + Intronic
1201149631 Y:11088586-11088608 CCCAGGTGACCATCAGGCCATGG - Intergenic