ID: 966846933

View in Genome Browser
Species Human (GRCh38)
Location 3:184138028-184138050
Sequence CTCCATTTTCAGAAGACCCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 240}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966846926_966846933 26 Left 966846926 3:184137979-184138001 CCACGAAGACAATGTGGTAGTGG 0: 1
1: 0
2: 0
3: 7
4: 72
Right 966846933 3:184138028-184138050 CTCCATTTTCAGAAGACCCAGGG 0: 1
1: 0
2: 1
3: 20
4: 240
966846931_966846933 -9 Left 966846931 3:184138014-184138036 CCACAAACAGGGTTCTCCATTTT 0: 1
1: 0
2: 1
3: 14
4: 167
Right 966846933 3:184138028-184138050 CTCCATTTTCAGAAGACCCAGGG 0: 1
1: 0
2: 1
3: 20
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966846933 Original CRISPR CTCCATTTTCAGAAGACCCA GGG Exonic
902104083 1:14018945-14018967 CTCCATTATCACATGAGCCAAGG + Intergenic
902128581 1:14238765-14238787 TTCCAATTTCAGTAGAGCCACGG + Intergenic
903543908 1:24111779-24111801 CTCAGCTCTCAGAAGACCCAGGG + Intronic
906821301 1:48933150-48933172 TTTCATTTTCAGAATAACCATGG - Intronic
912309063 1:108601057-108601079 CTCCATTTTCAGGAAAACCAGGG + Intronic
912336299 1:108866172-108866194 CTCCATTTTTAAAAGCCCCTGGG - Intronic
912616376 1:111104062-111104084 CACCACTTTCAGAAGACTCATGG - Intergenic
913646448 1:120860145-120860167 TTCTATTTTCAGTAGACACAGGG - Intergenic
914080201 1:144402726-144402748 TTCTATTTTCAGTAGACACAGGG + Intergenic
914175107 1:145271258-145271280 TTCTATTTTCAGTAGACACAGGG + Intergenic
914529832 1:148512738-148512760 TTCTATTTTCAGTAGACACAGGG + Intergenic
916218290 1:162417689-162417711 CTCCATTTTCTGAAAAACAAAGG - Intergenic
916863465 1:168831657-168831679 CCTCATTCTCAGAAGCCCCATGG + Intergenic
917961780 1:180151339-180151361 AACCATTTTCAGTAGACCCTTGG + Intergenic
918132513 1:181642197-181642219 CTCATTTTACAGAAGAACCAAGG - Intronic
919219108 1:194602323-194602345 CTCTATTTTCACATAACCCAAGG + Intergenic
920033923 1:203053573-203053595 CTGCATTTTAACAAGACCCCTGG - Intronic
921103412 1:211951478-211951500 TTGCATTTTCAGTAGACACAGGG + Intronic
921667091 1:217885815-217885837 CTGCATTTTCACAAGATCCTTGG + Intergenic
1065556634 10:26921933-26921955 TTGCATTTTCAGTAGACACAAGG - Intergenic
1065790016 10:29252115-29252137 CTCCAATTTCTGAACACCTAGGG - Intergenic
1065800270 10:29345597-29345619 TTCAATTTTCAGAAGATCCCAGG + Intergenic
1069822152 10:71234845-71234867 CTCTATTTGCAGAGGTCCCAGGG + Intronic
1070638697 10:78150011-78150033 CCCCATTTTCAGATGTCCAAGGG - Intergenic
1072748290 10:97957668-97957690 ATCCACTTTCAGAAGACTGAAGG - Intronic
1074040448 10:109783192-109783214 CTCTATTTTCACAAAGCCCAGGG - Intergenic
1074455645 10:113593256-113593278 CTCCATTTCCAGGAGACAAAAGG - Intronic
1074702652 10:116106080-116106102 CTCCATTTTCAGAACCAGCAAGG - Intronic
1074980638 10:118617138-118617160 CTACATTTTTAGTAGAGCCAGGG + Intergenic
1075397000 10:122134657-122134679 CACCGTTTTAGGAAGACCCAGGG + Intronic
1075974541 10:126684177-126684199 TTTCATTTTCAGAAAACACATGG - Intergenic
1080457504 11:32429921-32429943 CTCCATTTTCGAAACACACACGG + Intronic
1080499293 11:32853335-32853357 CATCATTTTCAGAAGACCTGAGG + Exonic
1083782461 11:64925456-64925478 CTTCGTTTTCAAAAGAGCCAGGG + Exonic
1088977424 11:114828149-114828171 CCCCAATTTCAGAATCCCCAGGG - Intergenic
1090082850 11:123625862-123625884 CTGCATTCCCAGGAGACCCAGGG + Intronic
1090268513 11:125369982-125370004 CTGCATTTTCACAAGATCCCAGG + Intronic
1093107959 12:15112101-15112123 CTCGATTTTTAGAAGGACCAAGG - Intronic
1093913232 12:24770991-24771013 CTCCACATTCAGAAGATCCGGGG - Intergenic
1094202328 12:27806708-27806730 ATATATTTTCAGAAAACCCAAGG - Intergenic
1097504927 12:60455026-60455048 CTCCATGTTTGGAAGTCCCAAGG - Intergenic
1097828085 12:64195092-64195114 CTCCATTTTCTGTAGAGACAAGG + Intronic
1100602898 12:96127556-96127578 CTGCATTTTAAGAAGAGACATGG - Intergenic
1101747503 12:107554665-107554687 CTGCATTTTAAGAAGATCCCAGG - Intronic
1102719728 12:115005710-115005732 TCCCATTTTCAGAACCCCCATGG + Intergenic
1104179923 12:126369201-126369223 ATTCATTTTCAGAAGGACCAGGG + Intergenic
1104558268 12:129821720-129821742 CTGCATTTTAAGAAGATCCCAGG - Intronic
1104714848 12:131009542-131009564 CTCCATTTTTAGGAGACACGTGG + Intronic
1104727897 12:131088908-131088930 CTGCATCTTCACAAGACCCCAGG - Intronic
1105986546 13:25572745-25572767 CTCCATTTGGGGAAGACGCAGGG + Intronic
1108141086 13:47422167-47422189 CTCCATTTACAGAAGACACCTGG + Intergenic
1110202736 13:72871849-72871871 CCCCTTTTTCAGAAGCCTCATGG + Intronic
1112195216 13:97219148-97219170 CTGCATTTTAACAAGACCCCTGG + Intergenic
1116989891 14:51264348-51264370 CCCCATTCTCAGCAGACTCAGGG - Intergenic
1117332377 14:54725972-54725994 CTGCATTTTAACAAGACCCTAGG - Intronic
1117422507 14:55560687-55560709 GTCCATTTACAGTAGAACCAAGG - Intronic
1118049627 14:62012769-62012791 CACCATTTGCAGAATAGCCAAGG - Intronic
1118368008 14:65112034-65112056 CTCCTTTGTCAGAAAACCAAAGG + Intergenic
1118682746 14:68260171-68260193 CTCACTTTTCCCAAGACCCATGG - Intronic
1121489367 14:94346784-94346806 CTTCATTTTCATAAGATCCCAGG - Intergenic
1123517832 15:21046041-21046063 CTGTATTTTCAGTAGACACAGGG - Intergenic
1125836540 15:42756612-42756634 CTTCAATCTCAGAAGACCAATGG - Intronic
1126881145 15:53099489-53099511 CACAATTTTCAGAATACTCAGGG - Intergenic
1129102918 15:73283164-73283186 CTCCATATACAGAAGTCACATGG - Intronic
1130651413 15:85764122-85764144 CTCCATTTCCTGGTGACCCAGGG + Intronic
1131894570 15:97012439-97012461 CTCTATTTTCACAAGATCCCAGG + Intergenic
1132311724 15:100862321-100862343 CTACATATTCTGAAGAACCAAGG + Intergenic
1134102880 16:11464882-11464904 CCTCATTTTCAGAATTCCCAGGG - Intronic
1135996964 16:27257494-27257516 CTCCAGTTGCTGATGACCCATGG - Exonic
1136604546 16:31324576-31324598 CTCCATGCTTGGAAGACCCAGGG - Intronic
1136692641 16:32046437-32046459 CTCCTTTTTCAGCACACGCATGG + Intergenic
1136793138 16:32989663-32989685 CTCCTTTTTCAGCACACGCATGG + Intergenic
1136876715 16:33864394-33864416 CTCCTTTTTCAGCACACGCATGG - Intergenic
1137069464 16:35888757-35888779 CTCCAGTTTCAGAAAACGCCTGG - Intergenic
1137353070 16:47731459-47731481 CTGGATTTGGAGAAGACCCAAGG - Intergenic
1139009385 16:62613460-62613482 TATCATTTTCAGAAGAACCAAGG - Intergenic
1139125851 16:64076245-64076267 CTAGATTCTCAGAAGACCCTTGG - Intergenic
1203095394 16_KI270728v1_random:1251354-1251376 CTCCTTTTTCAGCACACGCATGG + Intergenic
1143767617 17:9147990-9148012 CTCCAGTTCCAGGAGACACAAGG - Intronic
1145915580 17:28571851-28571873 CTCCATTTTCAGATGAGCCTCGG - Exonic
1146693910 17:34894692-34894714 CTCCTTTTTAGGAAGAACCACGG + Intergenic
1147744740 17:42688215-42688237 CTCCAGTTCCAGAAGGCCCCTGG + Intronic
1147911450 17:43858508-43858530 CTCCCTCTTCAGCAGAGCCAGGG - Intronic
1148152609 17:45405345-45405367 CTCCTGTTTCTGCAGACCCAGGG - Intronic
1148479121 17:47948641-47948663 CTGCATTTTCACTAGACCCCAGG + Intergenic
1151329659 17:73399279-73399301 CTCCTTTTCCAGAACTCCCAGGG - Exonic
1151781182 17:76246694-76246716 CTCCAGTTTCAGAAGAGCAGAGG - Intergenic
1152171349 17:78751149-78751171 CTCTATTTTTAGTAGACACAGGG + Intronic
1153183820 18:2465318-2465340 CTGCTTTTACAGAATACCCAAGG + Intergenic
1154247320 18:12710655-12710677 CTCCAGTTACAGAAAACACAGGG - Intronic
1155670960 18:28370456-28370478 CTCTATTTACATAAAACCCATGG + Intergenic
1157035718 18:43970588-43970610 CTCCATTTTTAGTAGAGACAAGG - Intergenic
1157044412 18:44082022-44082044 CACCATTTTCAGTTGTCCCACGG - Intergenic
1157122408 18:44923960-44923982 GTGCATTTGCAGAAGTCCCATGG + Intronic
1158417000 18:57257337-57257359 CCCCATCTTCAGATCACCCAGGG - Intergenic
1162664216 19:12195755-12195777 CTCATTTTTCCGAAGAACCAGGG + Intergenic
1164018559 19:21275326-21275348 CTCCATTTTCATCAAATCCATGG + Intronic
1166015718 19:39977995-39978017 CTTCATTTTCAGTAGAGACAGGG + Intronic
926391661 2:12400178-12400200 CCCCATTTTCAGATGACAAATGG + Intergenic
926443920 2:12921076-12921098 CTTCATTTTTACAAGACCCCAGG - Intergenic
926620826 2:15045932-15045954 CCCTAATTTCAGCAGACCCAGGG + Intergenic
926860644 2:17305266-17305288 CCCCATTTTCTGAAGCCACATGG - Intergenic
928350569 2:30549378-30549400 CTCAATTTTCAGCAGACCTAAGG - Intronic
930036237 2:47087120-47087142 CTCTGTTTTCAGAAAACCCCAGG - Exonic
930811600 2:55547350-55547372 TACCATTTTAAGAAGACCTAAGG + Intronic
930866316 2:56125617-56125639 CTTAACTTTCAGAAGCCCCAGGG + Intergenic
932720693 2:74137246-74137268 CTCCACTCTCAGAAATCCCAAGG - Intronic
932924043 2:75950293-75950315 CACCATTATGAGATGACCCAAGG - Intergenic
933262970 2:80150774-80150796 ATCCATTTTCAGAAACCACACGG - Intronic
933512171 2:83254742-83254764 CTTCATTTTAACAAGACCCTTGG - Intergenic
933858669 2:86442305-86442327 CTCCGTTTTCAGAAAACGGAAGG - Intronic
935326625 2:101943524-101943546 CTCCATTGGCAGAAGACACCTGG - Intergenic
935538821 2:104325875-104325897 CTGCATTTTTAGTAGACACAGGG + Intergenic
935540588 2:104343681-104343703 CTCTATTTTCTGAGGACACAGGG - Intergenic
938748905 2:134309689-134309711 CTCCATTCTGATAAGCCCCACGG - Intronic
939988572 2:148855860-148855882 CTTCATTTTCTCAAGTCCCACGG + Intergenic
942236587 2:173914525-173914547 CTCCCTGTTCAGAACACCTATGG - Intronic
944130925 2:196346824-196346846 CTGTATTTTCAGTAGACACAGGG - Intronic
944373271 2:199011347-199011369 AGCCTGTTTCAGAAGACCCAGGG - Intergenic
944635918 2:201676017-201676039 CTCCATTTTAATAAGAGCCCAGG + Intronic
946082146 2:217130351-217130373 CTCCATTTCCAGAGGACGGAGGG + Intergenic
946154920 2:217801026-217801048 GGCCAGTCTCAGAAGACCCAGGG + Exonic
946418452 2:219552113-219552135 CTCCACTTCCAGTAGAGCCAGGG + Exonic
946623649 2:221587964-221587986 CTCCATTTTCTGAAGACAAAAGG - Intergenic
947224046 2:227822969-227822991 CTTCATGTTGAGAAGACCCCAGG + Intergenic
948151216 2:235746553-235746575 CTGCATTCTCACAAGAACCAAGG - Intronic
948213776 2:236214228-236214250 CTGCATTTTCACAAGTCCCCAGG + Intronic
1169724401 20:8713628-8713650 CTTCATTTTAATAAGACCCCAGG + Intronic
1169941754 20:10945451-10945473 CTCTGTTTTTAGAAAACCCATGG + Intergenic
1170627999 20:18044140-18044162 CTGCATTTTAACAAGACCCCAGG - Intronic
1172060108 20:32181650-32181672 CTCCATTTTAAGAGGAGCCATGG + Intergenic
1172442787 20:34977758-34977780 CTCCAGATTCAGAAGACTCGCGG - Intronic
1172618109 20:36303086-36303108 CTGCATTTTAACAAGACCCCTGG + Intergenic
1176887706 21:14275797-14275819 CTCCAGTTTCTCAAGGCCCAGGG - Intergenic
1177302063 21:19260285-19260307 TACCATCTTCAGAAGACACATGG + Intergenic
1184925815 22:47636532-47636554 CTCAATTTACAGAGGACCCAAGG + Intergenic
1185368466 22:50447610-50447632 CTGCATTTCCAGCAGAACCAGGG + Intronic
949160802 3:879588-879610 CCACATTTTCAGAAGACCCCAGG + Intergenic
950218130 3:11174346-11174368 TCCCACCTTCAGAAGACCCAGGG - Intronic
952327352 3:32333453-32333475 CTGCATTTTAACAAGACCCCTGG + Intronic
952386131 3:32842992-32843014 CTCCAATTACAGAAGACCAAGGG - Intronic
953311436 3:41883942-41883964 CTCCATTTACAGACGGGCCAAGG - Exonic
954370381 3:50166918-50166940 CTCCAGTTTCAGAGGCCCCCGGG - Intronic
955326964 3:58016000-58016022 CTCCAGTTTCAGAAAGCCCTTGG - Intronic
956249020 3:67216046-67216068 CTCCATTTTCAGAATACTGTGGG + Intergenic
960689246 3:120326795-120326817 CTAAATTTTCATAAGACCCTTGG - Exonic
963203515 3:142608836-142608858 CTGCATTTTCAGAAGACATGTGG - Intronic
964037789 3:152219438-152219460 CTCCATTTTCAGAAGCAACCTGG + Intergenic
964921732 3:161904930-161904952 CTCAATTTTCAGAAAACCAGTGG - Intergenic
966376050 3:179296936-179296958 ATCCAATTTCATGAGACCCATGG + Intergenic
966846933 3:184138028-184138050 CTCCATTTTCAGAAGACCCAGGG + Exonic
968900909 4:3431264-3431286 CTCCATTTTCGGAAACCCCCAGG - Intronic
969891246 4:10262035-10262057 CTCCATTTTCAGATTATTCAAGG + Intergenic
969894854 4:10294007-10294029 CTCTAGTTTCAGAAGGACCAAGG - Intergenic
972067407 4:34966912-34966934 TTCCATTTTCAGAAAACTCAGGG + Intergenic
972191917 4:36603522-36603544 CTCCATTTTAAGAAGAATGATGG - Intergenic
975699973 4:77055204-77055226 CTCCATTTCCAGACTAACCATGG + Exonic
976028096 4:80715921-80715943 CTTCATTTTAAGAATAACCATGG + Intronic
979230946 4:118348561-118348583 CTGCATTTTAACAAGTCCCAAGG + Intronic
981090776 4:140730004-140730026 CTCCATTTTAGCAAGAGCCAGGG + Intronic
981194758 4:141905870-141905892 AGGCATTTTCAGAAGACTCAAGG + Intergenic
982219807 4:153114780-153114802 CACCATTTTCTGAGGACCGATGG - Intergenic
985712903 5:1439970-1439992 CTCCATCTTCATGAGACCCTGGG - Intronic
986010979 5:3715045-3715067 CTCCATTTTTAGAAGGTCCCTGG - Intergenic
986720657 5:10558777-10558799 TTCCATTGGCAAAAGACCCAAGG + Intergenic
987878035 5:23706353-23706375 CTCCAGTTCCAGACTACCCATGG + Intergenic
988828181 5:34961451-34961473 TTCTATTTTCAGAAGGCACATGG - Intergenic
989955641 5:50356383-50356405 CACCATTTTCAGGACACTCAAGG - Intergenic
993594978 5:89842851-89842873 CTCCATCATCAGAAGACTCTTGG + Intergenic
994309131 5:98246137-98246159 CTCCATCTACAGATGACCCAAGG + Intergenic
994689762 5:103002756-103002778 CTGCATTTTCACAAGACCCTTGG - Intronic
996087566 5:119320581-119320603 CTCCATTTTAACAAATCCCATGG + Intronic
998525096 5:142835555-142835577 CTCCATTTTGAAAAGACACCTGG - Intronic
1002370593 5:178750596-178750618 CTCCATATTCAGACCACTCAAGG - Intergenic
1003547023 6:7067712-7067734 AACCATTTTCAGAAAACTCAGGG + Intergenic
1003784350 6:9467518-9467540 CTCCATTTTCATGAAACTCAGGG - Intergenic
1003976716 6:11351596-11351618 ATCCTTTTTCTGAAGACACAAGG + Intronic
1005356633 6:24990493-24990515 CACTTTTTTCAGAAGCCCCAGGG - Intronic
1006163804 6:32053041-32053063 CTCCTTCCTCACAAGACCCAAGG - Intronic
1006468193 6:34208823-34208845 CTCCTGTTTGAGAAGGCCCAAGG + Intergenic
1006919546 6:37618451-37618473 CTCCAGTTTGAGAAATCCCAGGG - Intergenic
1007140239 6:39565450-39565472 CTCCATTTTCCGCAAGCCCAGGG + Intronic
1008127572 6:47686095-47686117 CTCCCTTTTCAGATGCACCATGG + Intronic
1008665241 6:53709551-53709573 CTCCATTTTGTGTAGACCCAAGG - Intergenic
1009318099 6:62248698-62248720 CTTCATCTTCAAAAGACTCATGG + Intronic
1016706408 6:147113731-147113753 TTCCATTTTCAGTAGAGACAGGG + Intergenic
1016820823 6:148344449-148344471 CTCCATTTTCAGGTGACCATTGG + Intronic
1017476324 6:154797566-154797588 CTCTATTTTCAGTAGAGACAGGG + Intronic
1018310874 6:162507028-162507050 CTTCACTTTCAGAAGAACCCAGG - Intronic
1019919082 7:4151328-4151350 CTCGATTTTCAGAAGAGCAGAGG - Intronic
1020717936 7:11701626-11701648 CTGCATTTTAACAAGACCCCAGG - Intronic
1022796792 7:33738113-33738135 CTGCATTTTCACATGACACAAGG - Intergenic
1024155701 7:46621745-46621767 CTTTATTTTCATAATACCCATGG + Intergenic
1026839653 7:73662840-73662862 TTCTATTTTCAGAAGAGACAGGG + Intergenic
1027162708 7:75814026-75814048 ATGCATTGTCAGAAGGCCCATGG + Intronic
1027765147 7:82331020-82331042 CTGCATTTTAACAAGAGCCACGG + Intronic
1028097186 7:86775699-86775721 CCCTATTTTCAGAATACCCAGGG - Intronic
1028703964 7:93816213-93816235 CTTCATATTCAGAGCACCCATGG - Intronic
1029693565 7:102198595-102198617 CTCCTTTTGCAGCAGAGCCACGG + Intronic
1031510470 7:122642434-122642456 CTCCCTTTGCAGAAGTCCTAGGG + Intronic
1031523886 7:122800483-122800505 CTCAATTTTAAGAAGATCCCAGG - Intronic
1031568104 7:123324072-123324094 CTCCCTTTTCAGCAGACCTAAGG + Intergenic
1032896498 7:136256860-136256882 CTCCATCTACAGAGGAACCAGGG - Intergenic
1035421483 7:158732525-158732547 CTCCATTATAAGTAAACCCATGG + Exonic
1035450685 7:158975002-158975024 ATCCATAGTCAGAAGAACCAAGG + Intergenic
1037447549 8:18981448-18981470 CTCTATTTTCCAAAGACACAGGG - Intronic
1039373416 8:37009887-37009909 CTCCATATTCTGAACACACACGG - Intergenic
1039797700 8:40929217-40929239 CTACATTTGCAGAAGAACTATGG - Intergenic
1039885590 8:41652441-41652463 CTGCATTTTTAAAAGCCCCATGG + Intergenic
1040284284 8:46092085-46092107 CTCCCTTCCCAGAAGCCCCAAGG + Intergenic
1040284436 8:46092719-46092741 CTCCCTTTTCAGAAGACCCTGGG + Intergenic
1040284689 8:46093786-46093808 CTCCCTTTTCAGAAGTCCCTGGG + Intergenic
1040291605 8:46128349-46128371 CTCCCATTTCAGAAGCCCCCCGG - Intergenic
1040292013 8:46130290-46130312 CTCCAATTCCAGAAGCCCCCAGG - Intergenic
1040299517 8:46180633-46180655 CTCCCATTCCAGAAGCCCCAAGG - Intergenic
1040301305 8:46189375-46189397 CCCCAATTTCAGAAGCCCCCAGG + Intergenic
1040301477 8:46190259-46190281 CTCCCATTTCAGAAGTCCCCAGG + Intergenic
1040302869 8:46197026-46197048 CTCCCTTCCCAGAAGCCCCAAGG + Intergenic
1040304609 8:46205574-46205596 CTTCCATTTCAGAAGCCCCAAGG + Intergenic
1040309694 8:46230395-46230417 CTCCTATTTCAGAAGCCCCCAGG + Intergenic
1040312212 8:46242651-46242673 CTCCCATTCCAGAAGACCCCAGG + Intergenic
1040313594 8:46249466-46249488 CTCCCATTTCAGAAGCCCCTAGG + Intergenic
1040314953 8:46256093-46256115 CTCCCATTTCAGAAACCCCAAGG + Intergenic
1040319480 8:46285433-46285455 CTCCCTTTCCAGAAGCCCCTGGG - Intergenic
1040331104 8:46386236-46386258 CTCCCACTGCAGAAGACCCAAGG + Intergenic
1040334288 8:46408255-46408277 CTCCAATCCCAGAAGCCCCAGGG + Intergenic
1040337799 8:46424947-46424969 CTCCCATTTCAGAAGCCCCCAGG + Intergenic
1040338412 8:46427753-46427775 CTCCCATCTCAGAAGGCCCAGGG + Intergenic
1040339352 8:46432641-46432663 CTCCGATTTCAGAAGCCCCCAGG + Intergenic
1040341609 8:46443898-46443920 CTTCCATTTCAGAAGAACCAAGG - Intergenic
1040342164 8:46446556-46446578 CTCCAGTACCAGAAGCCCCAGGG - Intergenic
1040443946 8:47474289-47474311 CTGAATTTTCAGAATACACATGG - Intronic
1040486466 8:47877057-47877079 TTCCATTTACAGAAAATCCAAGG + Intronic
1045200497 8:99975498-99975520 CACAAATTTGAGAAGACCCAAGG + Intronic
1046301411 8:112296692-112296714 CTCCATGTTAAGAAGAAGCAAGG + Intronic
1048453494 8:134555140-134555162 CTCCACTTGGAGAAGACCCTTGG - Intronic
1052459847 9:28748307-28748329 ATTAATTTTCAGAAGACACATGG - Intergenic
1052725074 9:32219659-32219681 CTTCTTTTTTGGAAGACCCAAGG - Intergenic
1053407349 9:37888721-37888743 AAGCATTTTCAGAAGACCCCTGG + Intronic
1053748156 9:41221932-41221954 TTCCATTTTAATAAGATCCACGG - Intergenic
1054338235 9:63828640-63828662 TTCCATTTTAATAAGATCCACGG + Intergenic
1058240755 9:102555205-102555227 CTCCATTTACAGTAGGCACAAGG + Intergenic
1059964184 9:119597514-119597536 CTCCATTGGCAGGACACCCAGGG - Intergenic
1060791542 9:126488902-126488924 CTCCATGCTCAGAATACACAGGG - Intronic
1061229425 9:129305571-129305593 CTCCAATTTTAAAAGACCGATGG + Intergenic
1061873815 9:133534333-133534355 CCCCATTCTCAGGAGCCCCAGGG + Intronic
1061959959 9:133982882-133982904 CTCCGTTTACAGACCACCCAGGG + Intronic
1202784286 9_KI270718v1_random:32645-32667 TTCCATTTTAATAAGATCCACGG - Intergenic
1186488158 X:9950017-9950039 CTCCATTATCAGTAGACACGAGG - Intergenic
1188134291 X:26475182-26475204 ATCCATTTTCAGAAAAGCTATGG - Intergenic
1188244858 X:27827307-27827329 CTTCACTGTCAGAGGACCCAGGG - Intergenic
1191245191 X:58223080-58223102 CTCTATTTTCAGAATGCCTAAGG - Intergenic
1192171321 X:68856963-68856985 CTCCATTTTCAAAAGCCCTATGG - Intergenic
1193393069 X:80952174-80952196 CCCCATTTGCAGAACAGCCAAGG - Intergenic
1194751469 X:97689472-97689494 CTCCATATTGAAAAGGCCCAGGG + Intergenic
1199623447 X:149719131-149719153 CTCCACTCTCACATGACCCAGGG - Intergenic
1199953190 X:152721679-152721701 CTCCACTCTCACATGACCCAGGG - Intergenic
1199956492 X:152746767-152746789 CTCCACTCTCACATGACCCAGGG + Intergenic
1200900465 Y:8426313-8426335 CTCCATGTGCATAGGACCCAAGG + Intergenic
1200925128 Y:8647525-8647547 ACCCAATATCAGAAGACCCATGG + Intergenic
1201774441 Y:17648180-17648202 CTCAATTTCCAGAAGTCCCACGG + Intergenic
1201827115 Y:18257809-18257831 CTCAATTTCCAGAAGTCCCACGG - Intergenic