ID: 966847168

View in Genome Browser
Species Human (GRCh38)
Location 3:184139632-184139654
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 148}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966847168_966847174 13 Left 966847168 3:184139632-184139654 CCCACTGGGAGTCTCTTTGGAAT 0: 1
1: 1
2: 0
3: 21
4: 148
Right 966847174 3:184139668-184139690 CAGCTGTCATAGGGTTTGCTAGG 0: 1
1: 0
2: 0
3: 4
4: 116
966847168_966847175 20 Left 966847168 3:184139632-184139654 CCCACTGGGAGTCTCTTTGGAAT 0: 1
1: 1
2: 0
3: 21
4: 148
Right 966847175 3:184139675-184139697 CATAGGGTTTGCTAGGTCTCTGG 0: 1
1: 0
2: 1
3: 7
4: 99
966847168_966847178 23 Left 966847168 3:184139632-184139654 CCCACTGGGAGTCTCTTTGGAAT 0: 1
1: 1
2: 0
3: 21
4: 148
Right 966847178 3:184139678-184139700 AGGGTTTGCTAGGTCTCTGGGGG 0: 1
1: 0
2: 0
3: 10
4: 105
966847168_966847171 3 Left 966847168 3:184139632-184139654 CCCACTGGGAGTCTCTTTGGAAT 0: 1
1: 1
2: 0
3: 21
4: 148
Right 966847171 3:184139658-184139680 GGTCCATGTTCAGCTGTCATAGG 0: 1
1: 0
2: 0
3: 7
4: 83
966847168_966847176 21 Left 966847168 3:184139632-184139654 CCCACTGGGAGTCTCTTTGGAAT 0: 1
1: 1
2: 0
3: 21
4: 148
Right 966847176 3:184139676-184139698 ATAGGGTTTGCTAGGTCTCTGGG 0: 1
1: 0
2: 0
3: 8
4: 100
966847168_966847177 22 Left 966847168 3:184139632-184139654 CCCACTGGGAGTCTCTTTGGAAT 0: 1
1: 1
2: 0
3: 21
4: 148
Right 966847177 3:184139677-184139699 TAGGGTTTGCTAGGTCTCTGGGG 0: 1
1: 0
2: 0
3: 8
4: 144
966847168_966847172 4 Left 966847168 3:184139632-184139654 CCCACTGGGAGTCTCTTTGGAAT 0: 1
1: 1
2: 0
3: 21
4: 148
Right 966847172 3:184139659-184139681 GTCCATGTTCAGCTGTCATAGGG 0: 1
1: 0
2: 0
3: 4
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966847168 Original CRISPR ATTCCAAAGAGACTCCCAGT GGG (reversed) Intronic