ID: 966847172

View in Genome Browser
Species Human (GRCh38)
Location 3:184139659-184139681
Sequence GTCCATGTTCAGCTGTCATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966847169_966847172 3 Left 966847169 3:184139633-184139655 CCACTGGGAGTCTCTTTGGAATT 0: 1
1: 0
2: 1
3: 17
4: 183
Right 966847172 3:184139659-184139681 GTCCATGTTCAGCTGTCATAGGG 0: 1
1: 0
2: 0
3: 4
4: 95
966847168_966847172 4 Left 966847168 3:184139632-184139654 CCCACTGGGAGTCTCTTTGGAAT 0: 1
1: 1
2: 0
3: 21
4: 148
Right 966847172 3:184139659-184139681 GTCCATGTTCAGCTGTCATAGGG 0: 1
1: 0
2: 0
3: 4
4: 95
966847166_966847172 11 Left 966847166 3:184139625-184139647 CCAGTATCCCACTGGGAGTCTCT 0: 1
1: 0
2: 0
3: 9
4: 146
Right 966847172 3:184139659-184139681 GTCCATGTTCAGCTGTCATAGGG 0: 1
1: 0
2: 0
3: 4
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966847172 Original CRISPR GTCCATGTTCAGCTGTCATA GGG Intronic