ID: 966854129

View in Genome Browser
Species Human (GRCh38)
Location 3:184182630-184182652
Sequence CAGAACAAGGAGAAGTGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 228}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966854129_966854133 -2 Left 966854129 3:184182630-184182652 CCTGACCACTTCTCCTTGTTCTG 0: 1
1: 0
2: 4
3: 15
4: 228
Right 966854133 3:184182651-184182673 TGGCACCTCCTGCAAGCTCCTGG 0: 1
1: 0
2: 0
3: 41
4: 557
966854129_966854138 20 Left 966854129 3:184182630-184182652 CCTGACCACTTCTCCTTGTTCTG 0: 1
1: 0
2: 4
3: 15
4: 228
Right 966854138 3:184182673-184182695 GGCTCTCTCCTTGCTTGAAATGG 0: 1
1: 0
2: 1
3: 10
4: 138
966854129_966854134 -1 Left 966854129 3:184182630-184182652 CCTGACCACTTCTCCTTGTTCTG 0: 1
1: 0
2: 4
3: 15
4: 228
Right 966854134 3:184182652-184182674 GGCACCTCCTGCAAGCTCCTGGG 0: 1
1: 0
2: 1
3: 39
4: 621
966854129_966854139 21 Left 966854129 3:184182630-184182652 CCTGACCACTTCTCCTTGTTCTG 0: 1
1: 0
2: 4
3: 15
4: 228
Right 966854139 3:184182674-184182696 GCTCTCTCCTTGCTTGAAATGGG 0: 1
1: 0
2: 0
3: 17
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966854129 Original CRISPR CAGAACAAGGAGAAGTGGTC AGG (reversed) Intronic
903884474 1:26532807-26532829 CAGAACTGGGGGCAGTGGTCTGG + Intronic
905551518 1:38844468-38844490 AAGAAACAGGAGAGGTGGTCGGG + Intronic
908398306 1:63746396-63746418 CAGAACAAGGTGGCGTGGGCTGG + Intergenic
911512493 1:98824920-98824942 CATAAAAAGGGGAAGTGGTTTGG - Intergenic
912920590 1:113862809-113862831 CAGAAGAAGTACAAGTGGTAAGG + Intronic
914682303 1:149947175-149947197 CAGAACAAGGAGATCTGGGATGG - Intronic
914690902 1:150025855-150025877 CTGAAAAAAGAGATGTGGTCAGG + Intergenic
914754550 1:150555287-150555309 CAGCACAAGCTGAGGTGGTCAGG - Intronic
915371480 1:155354953-155354975 TATAACAAGGAGAACTGGACTGG + Intronic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916824138 1:168428214-168428236 CAGAAAAAGGAAAAGTGGAGAGG + Intergenic
916837589 1:168563918-168563940 CAGAACAATGAGAAATAGGCGGG + Intergenic
918968955 1:191387930-191387952 AAGTACAAAGAGAAGTGGTGTGG + Intergenic
918978629 1:191525509-191525531 CAGAACACGGAGGACTGGTAAGG + Intergenic
920250855 1:204621353-204621375 AAGAACAAGTAGGAGTTGTCTGG - Exonic
921042715 1:211448925-211448947 CAGAACAAAGAGAAATACTCTGG + Intergenic
921328664 1:214013766-214013788 CAGATAAAGGAGAGGTGGCCTGG - Intronic
921580869 1:216894724-216894746 GAGAACACGGTCAAGTGGTCAGG + Intronic
924657337 1:245984899-245984921 CAGAGCAAGGAGAAGTCGGATGG - Intronic
1063257094 10:4340398-4340420 CAGAGCAAGGACAAATGTTCTGG - Intergenic
1063505055 10:6590274-6590296 AAGAACAAGCAGGAGTGGTGAGG + Intergenic
1064647914 10:17479013-17479035 CAGAGCGTGGAAAAGTGGTCAGG - Intergenic
1065188957 10:23193333-23193355 CAGCTCAGGGAGAAGGGGTCGGG + Intronic
1067894640 10:50165773-50165795 CAGAACAAGGACAAGAATTCAGG + Intergenic
1068499039 10:57819829-57819851 CTGAAGAAGGAGGAGTGGTGGGG + Intergenic
1069740154 10:70682208-70682230 CAGAAGAAAGAGAAGAGGACCGG + Intronic
1070247321 10:74744551-74744573 AAGAATGAGGAGAAGTGGTGCGG - Intergenic
1071499624 10:86194076-86194098 CAGAGAAAGGAGAAGTGTTCTGG - Intronic
1071499976 10:86196355-86196377 AAGAAAAACGAGAAATGGTCTGG + Intronic
1073453891 10:103625123-103625145 CAGAACAAGTAGTAGTGGGTTGG - Intronic
1074890848 10:117735562-117735584 AAGTACAAGGGGAAGTGGTCAGG - Intergenic
1076168887 10:128303913-128303935 CAGAGCATGGGGATGTGGTCAGG - Intergenic
1076362396 10:129898474-129898496 CAGAACAAGGAGAGGAATTCAGG - Intronic
1076591579 10:131587248-131587270 CAGACCATGGGGATGTGGTCAGG + Intergenic
1077363397 11:2151222-2151244 GAGAGCAGGGAGAAGCGGTCAGG + Intronic
1079006307 11:16793704-16793726 AAGAAATAGGAGATGTGGTCAGG - Intronic
1079633173 11:22702818-22702840 CAGAGCAAGGAGAAGAGATAGGG + Intronic
1082123182 11:48402541-48402563 AAGAACAAGCACAAGGGGTCAGG + Intergenic
1082757916 11:57096455-57096477 AAGAAAAAAGAGAAGGGGTCTGG - Intergenic
1082782845 11:57300651-57300673 CACAACAAGGAGACGTGATAGGG + Intronic
1083544545 11:63538650-63538672 CAGGACATGGAGAAGTGGGAAGG + Intronic
1084327547 11:68410527-68410549 CAAAGCAAGGAGACCTGGTCAGG - Intronic
1085462393 11:76701996-76702018 CAGAACGAGGAGAAGGGTTGGGG + Intergenic
1088804459 11:113339411-113339433 TAGAACAAGGGGATCTGGTCAGG - Exonic
1089498709 11:118920677-118920699 CAGGACAAGAAGAGGTGGACAGG + Intronic
1092170928 12:6373776-6373798 CAGAACAAGGAGAATGGGTCAGG - Intronic
1096755408 12:53795434-53795456 CAGAGCAGGGAGAATTGGTTTGG - Intergenic
1098801070 12:74958908-74958930 TATAACATGGAGAAGTGGTTTGG - Intergenic
1101256655 12:102984456-102984478 CAGGAGCAGGAGAAATGGTCTGG + Intergenic
1102209624 12:111116328-111116350 CAGAATATTGAGAAGTGGTGAGG + Intronic
1103244781 12:119447308-119447330 CAGTACAAGGGGAAGTGGGAGGG - Intronic
1104337383 12:127912213-127912235 CACAACAAGGAGAGGTCTTCTGG - Intergenic
1104389994 12:128384079-128384101 CAAAACAAAAAGAGGTGGTCAGG + Intronic
1105658657 13:22469006-22469028 CACAGCAAGAAGATGTGGTCTGG + Intergenic
1105753616 13:23444687-23444709 AAAAACAAGGAGAACTGGTGTGG + Intergenic
1107088957 13:36455281-36455303 CAGAACAAGAAGAAAATGTCAGG + Intergenic
1107100106 13:36581128-36581150 CAGAATGAGGAGATGTGGTTTGG - Intergenic
1109525580 13:63570464-63570486 CAGAACTAAGGAAAGTGGTCAGG - Intergenic
1109610684 13:64761362-64761384 CAAAACAAAGACAAGAGGTCTGG + Intergenic
1114648394 14:24268329-24268351 CAAAACAAGGAGAGGGGCTCTGG - Intronic
1115395842 14:32907375-32907397 CAGAACAAGGAGAAGAGTAGAGG - Intergenic
1115905910 14:38202711-38202733 CAGAACTACCAGGAGTGGTCCGG - Intergenic
1116672412 14:47860509-47860531 CAGGACAAGGAGTAGTGGTCAGG + Intergenic
1117348582 14:54858686-54858708 AAGAACAAGATGAAGGGGTCGGG - Intronic
1119735241 14:76977446-76977468 CAGACCCTGGAGGAGTGGTCTGG - Intergenic
1119756298 14:77122255-77122277 CAGAAGAAGGAGAAATGTTCGGG - Intronic
1121369567 14:93344808-93344830 GAGAACAAGGAGATGAGGTTAGG + Intronic
1124387574 15:29223296-29223318 CAGAACCAGGAGGACTTGTCTGG - Intronic
1128896220 15:71376471-71376493 CAGAACAAGGGTTGGTGGTCTGG - Intronic
1129143966 15:73631897-73631919 GAGAAGATGGAGAAGTGGTGGGG - Intronic
1129429942 15:75492515-75492537 CAGGACAATGAGAATGGGTCAGG - Intronic
1129797255 15:78387227-78387249 CAGACCTAGGAGAAGTGGGAAGG + Intergenic
1130751433 15:86717207-86717229 GAGAACAAGGAGAAGGAGTGGGG + Intronic
1131940485 15:97559601-97559623 CAGAAGATGTAGAAGTGGTATGG - Intergenic
1133507003 16:6422215-6422237 AAAAAAAAGGAGAGGTGGTCGGG - Intronic
1136452174 16:30359615-30359637 AAGAACAAGGAGGAGGGGTGGGG + Intronic
1136499742 16:30664411-30664433 GAGAACAAGGAGGGGTGGTGGGG - Exonic
1136777230 16:32878522-32878544 CAGAACCTGGAGAGGTGGGCAGG + Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1138251189 16:55503053-55503075 CAGGCCAAGGAGCAGAGGTCAGG - Intronic
1144234298 17:13242301-13242323 CAGGAGAATGAGAAGTGTTCTGG + Intergenic
1148207719 17:45790024-45790046 CATCAAAAGGAGAAGTGGTGAGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148876613 17:50691064-50691086 CAAAAAAGAGAGAAGTGGTCAGG - Intronic
1151138649 17:71971260-71971282 TAGAAGATGGAGAAATGGTCTGG + Intergenic
1151784122 17:76266638-76266660 CAGCACACAGAGAAGTGGTCCGG + Intronic
1203156451 17_GL000205v2_random:8425-8447 CAGAACCAGCAGCAGTGTTCTGG + Intergenic
1154254155 18:12768204-12768226 TAGAACAAGGGGTGGTGGTCAGG - Intergenic
1154406055 18:14092235-14092257 CAGGACCAGGATAAGGGGTCAGG + Intronic
1155628193 18:27860700-27860722 GAGAAGAAGAAGAAGTTGTCTGG - Intergenic
1156697954 18:39790642-39790664 CAGAACAAGGATTAGGGGTAGGG + Intergenic
1158072310 18:53487172-53487194 CAATACAAGGGGAAGTGGTGGGG + Intronic
1158429239 18:57369353-57369375 CAGAGGAAGGAGAACTGGACAGG - Intronic
1159021817 18:63149483-63149505 CAGAACAAGCGAAAGTCGTCTGG - Intronic
1161286370 19:3470486-3470508 AACAACAAGTAGAAGTGGCCGGG + Intergenic
1162576295 19:11500949-11500971 CAGAAGTTGGAGAAGTGGACAGG - Intronic
1163087104 19:14989574-14989596 AAGAAAAAAGATAAGTGGTCAGG + Intronic
1163812087 19:19439550-19439572 TAGCAAAAGGACAAGTGGTCAGG + Intronic
1163921184 19:20290393-20290415 GAGAAAAAGGAGAAGAGGCCGGG - Intergenic
1165096177 19:33411088-33411110 CACGACAAGGAGATGTGGGCAGG - Intronic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
1165548167 19:36559961-36559983 AAAAACAAAGAGAAGTGGCCTGG + Intronic
927585368 2:24298710-24298732 GAGAACAAGAAGAAATTGTCAGG - Exonic
930641769 2:53860208-53860230 CAGAGCAAGGTGGAGTGGTAAGG + Intergenic
931098979 2:58974043-58974065 CAGAGCAAGGTGAAGGTGTCTGG + Intergenic
932106692 2:68949713-68949735 CAGAAAAAGAACAATTGGTCAGG - Intronic
932572473 2:72945309-72945331 CAGAAGAAAGAGATCTGGTCTGG - Intronic
935085592 2:99841547-99841569 CAGAACACTGAGAAATGTTCTGG + Intronic
936279038 2:111122221-111122243 CAAAACAAGGACAAGTGGCGAGG + Intronic
937861912 2:126718089-126718111 AAGATCAGGGAGAAGTGTTCTGG - Intergenic
939105714 2:137946213-137946235 CAGAACATGGACAGGTGGTTGGG + Intergenic
940189867 2:151029221-151029243 CAGGACAAGGAAGTGTGGTCTGG + Intronic
940613285 2:156018159-156018181 GAAAACAAGGAGAAGTTGTTTGG - Intergenic
941963570 2:171277609-171277631 CAGAAAATGGCGAAGTTGTCAGG + Intergenic
942419385 2:175792395-175792417 CAGACCAAGGACTAGTGTTCTGG - Intergenic
945233660 2:207614515-207614537 CAGCCTAAGGAGAAGTGGACTGG - Intronic
946100205 2:217314119-217314141 CAGAACAAGAGGAAGGGGGCTGG - Intronic
946656823 2:221957644-221957666 CAAAACAAGGAGGATGGGTCAGG + Intergenic
947216880 2:227757949-227757971 CAGAAAAAGGAGCAGTGATGAGG - Intergenic
949037632 2:241824519-241824541 AAGAAGAAGAAGAAGTAGTCAGG - Intergenic
1168971228 20:1932288-1932310 CAGATCAAGGAGGTGGGGTCTGG + Intronic
1169284656 20:4297846-4297868 CTGAACAAGGAGAAAAAGTCAGG - Intergenic
1169947005 20:10999777-10999799 CAGAACTGGCAGAAGTGGACAGG - Intergenic
1171306411 20:24110518-24110540 CAATACAAGGAGAGCTGGTCTGG - Intergenic
1172639262 20:36431224-36431246 CAGAGCTAGGAGATGTGGGCTGG + Intronic
1174581720 20:51576940-51576962 CAGAAGAAGGGGAAGGGGTGGGG - Intergenic
1174702358 20:52621694-52621716 AATAACAAGAAGAAGTGGTTTGG - Intergenic
1175700625 20:61134350-61134372 CAGCACAAGGAGATGTGGAATGG + Intergenic
1178005494 21:28215389-28215411 CAGAACCAGGAGAACTGATATGG + Intergenic
1179281742 21:39939616-39939638 CAGCACCAGGAGAATTGGACAGG - Intergenic
1180522623 22:16223884-16223906 CAGATCCAGCAGAAGTGTTCTGG + Intergenic
1180834071 22:18921092-18921114 CACCACAAGGAGAGGGGGTCTGG - Intronic
1181065750 22:20305147-20305169 CACCACAAGGAGAGGGGGTCTGG + Intergenic
1181602185 22:23959215-23959237 CAGGAAAAGGACAAGAGGTCAGG - Intronic
1181606324 22:23982092-23982114 CAGGAAAAGGACAAGAGGTCAGG + Intronic
1203284159 22_KI270734v1_random:146390-146412 CACCACAAGGAGAGGGGGTCTGG - Intergenic
949617621 3:5771408-5771430 TACAACAAGGAGAGATGGTCTGG - Intergenic
950231105 3:11276616-11276638 GATAAGAAGGAAAAGTGGTCAGG - Intronic
950603083 3:14052714-14052736 CAGAAAAGGCAGAAGTGTTCAGG - Intronic
951179457 3:19641933-19641955 AAGAACAAAGAGAAGAGGTGGGG + Intergenic
952147107 3:30545315-30545337 CAGAACAAAGAAAAGTGTTGGGG + Intergenic
953810108 3:46104863-46104885 CAGAACAAGAAGCAGTGGGTTGG - Intergenic
955275190 3:57540495-57540517 AAGAACAAGGATAAGTATTCAGG + Intronic
955393289 3:58536597-58536619 CAGAGCAAGGAAAAGAGGTAAGG - Intronic
955803800 3:62713222-62713244 CAGGAGAAGGAGAAATGGTCTGG - Intronic
957187347 3:76958935-76958957 CTGACCTAGGAGAAGTGGTGGGG - Intronic
958821904 3:98984634-98984656 GAGAACAAGGAGAAGAGGCAGGG - Intergenic
959497100 3:107064382-107064404 GAGAATAAGGAGAAATGGTAAGG + Intergenic
959567531 3:107847942-107847964 CAGAGCAAGGCCAGGTGGTCTGG + Intergenic
961056486 3:123793373-123793395 CAGAAAAAGAAGACGCGGTCCGG - Intronic
961861652 3:129921202-129921224 CAGAACAAGGAGAAGACGGCTGG + Intergenic
962962396 3:140322516-140322538 CATCCCAAGGATAAGTGGTCAGG + Intronic
966816887 3:183896740-183896762 CAGAACGAGGAGAAATGGAATGG + Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
968726590 4:2250747-2250769 CAGAAAAGGGAGAAATGGGCTGG - Intronic
968961216 4:3744584-3744606 CAGGACCGGGAGAAGGGGTCTGG + Intergenic
970318854 4:14855951-14855973 GAGAACCAGGAGCAGTTGTCAGG + Intergenic
970964316 4:21910178-21910200 CAAAAGAAGGAGATGAGGTCAGG + Intronic
971469673 4:27008872-27008894 CAGAATAAAGGGAAGAGGTCAGG - Exonic
973844045 4:54892786-54892808 TAAGACAAGGAGATGTGGTCAGG - Intergenic
975839068 4:78455095-78455117 CAGAGCAAAGAGAAGAGGACTGG - Intronic
976163125 4:82225054-82225076 CAGATGAAGGAGCAGTGGTCTGG - Intergenic
976267185 4:83195446-83195468 AAGAGCAAGGAGAAGAGGGCGGG - Intergenic
978272689 4:106909562-106909584 AAGAACATGGGGAAGTGGTTGGG + Intergenic
979603349 4:122609743-122609765 CTGAACATGGAGGAGTGGCCAGG + Intergenic
981756520 4:148146077-148146099 AAGAAGAAGGGGAAGTGGGCTGG + Intronic
983028767 4:162771921-162771943 CAGAACAAAGAGAAGAGGAGAGG + Intergenic
983029811 4:162785595-162785617 AAGAAGAAGAAGAAGTAGTCAGG + Intergenic
983057998 4:163122340-163122362 CAGAACAAAAAGAAGTGGAGAGG + Intronic
984226663 4:177043653-177043675 CAGTGAAAGGAGAAGTGTTCTGG + Intergenic
985663218 5:1167770-1167792 CAGAAGAAGCAGGTGTGGTCAGG + Intergenic
986623959 5:9706300-9706322 CAGAACCAGGGGAACTGGCCTGG + Intronic
988255178 5:28810225-28810247 CAGGACAAAGAGAAGGCGTCGGG + Intergenic
989192977 5:38689362-38689384 CATATCGAGGAGAAATGGTCTGG - Intergenic
990181410 5:53164638-53164660 CAGTACCAGGAGGGGTGGTCAGG + Intergenic
991921094 5:71657720-71657742 AAGAATAAGGAGATGTGGTCAGG - Exonic
992102833 5:73423705-73423727 CAGAACAAAGAGAACAGGACAGG + Intergenic
994103825 5:95923290-95923312 AAGAACAAGGAAAAATGGTAGGG - Intronic
994163169 5:96579651-96579673 AAGAACAAGGAAAACTGGTGTGG - Intronic
995714495 5:115068784-115068806 CAGAAAAAGGAGAAGAGGAGGGG - Intergenic
995736808 5:115310459-115310481 GAGAAGCAGGAAAAGTGGTCAGG - Intergenic
995762895 5:115582713-115582735 AAGAACAAGTAGAAATGCTCTGG - Intronic
996074173 5:119169866-119169888 CAGACTGAGGAGAAGTGTTCAGG + Intronic
996383121 5:122882534-122882556 CAGAACAAAGAGATGAGGGCAGG - Intronic
996393241 5:122986480-122986502 CAGAAAAAAGAGAAGTGGGAGGG + Intronic
997895376 5:137711476-137711498 CCCAACAGGGAGAAGTGGACAGG + Intronic
1000731511 5:164839733-164839755 CAGCCCAGGAAGAAGTGGTCAGG - Intergenic
1002661030 5:180791271-180791293 CAGGTCAGGGAGAAGGGGTCTGG + Exonic
1003109611 6:3242528-3242550 CATAAGAAGGAGAAAGGGTCAGG - Intronic
1003343971 6:5248257-5248279 CAGCACAGGGAGAAGGGGACTGG - Intronic
1003846932 6:10183390-10183412 AAGAACAAGGAAAAGTAATCAGG + Intronic
1004389480 6:15198059-15198081 CAGAAGAAGGAGAAGGGGCATGG + Intergenic
1006575030 6:35038779-35038801 CAGAAAAAGGAAAAGTGGCCAGG - Intronic
1007341845 6:41195606-41195628 CAGAACAAGCAGCATTGGTGAGG + Intronic
1007513388 6:42391765-42391787 CAGAACATGGAGCAGTGGGCTGG + Intronic
1007671243 6:43555933-43555955 CACAACAAGGAGAGGTGATGAGG - Exonic
1010487092 6:76427792-76427814 CAACACAAGGAGAAGAGGTTGGG + Intergenic
1010749639 6:79603791-79603813 AAGAAAAAAGAAAAGTGGTCTGG - Intergenic
1012394319 6:98778366-98778388 CAGAAGAAGCAGAGGTGGTGGGG + Intergenic
1013412572 6:109894573-109894595 CAGAACAAGGAACAATGGTAAGG + Intergenic
1015111454 6:129596449-129596471 CAGAACAAGGGGAATTGGGAAGG - Intronic
1015112337 6:129607478-129607500 AAGCACAAGGAGAAGTGGTAGGG - Intronic
1016962443 6:149687004-149687026 CAGAAGAAGTAGTTGTGGTCTGG - Intronic
1016986710 6:149900814-149900836 CAGCAAAAGGAGAAGCAGTCTGG - Intergenic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1022629067 7:32068404-32068426 AAGAAGAAGAAGAAGTGGTAAGG + Intronic
1023056722 7:36296500-36296522 CAGCACAGGGAAAGGTGGTCAGG - Intronic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1024194255 7:47043291-47043313 CAGAACTAGGAGAATTGCTCAGG - Intergenic
1026777142 7:73237602-73237624 CTGAACAAGCAGAAGGGGTGAGG - Intergenic
1027017988 7:74790974-74790996 CTGAACAAGCAGAAGGGGTGAGG - Intergenic
1027070036 7:75154953-75154975 CTGAACAAGCAGAAGGGGTGAGG + Intergenic
1030106746 7:105993885-105993907 CAGATCAAGGAGATCTGGGCAGG + Intronic
1030629843 7:111883711-111883733 CAGGAAAAGGTGATGTGGTCAGG + Intronic
1031584872 7:123522102-123522124 CAGAACCCTGAGAAATGGTCTGG - Intronic
1033714165 7:143982157-143982179 CAGAACAAGGATCAGGAGTCAGG - Intergenic
1033813001 7:145039452-145039474 TTGGACAAGAAGAAGTGGTCAGG + Intergenic
1035613962 8:988800-988822 CAGAAAAAGCAGGATTGGTCAGG - Intergenic
1036097734 8:5741988-5742010 CAGAACAAGGAGGTGTCGCCTGG - Intergenic
1036619013 8:10410634-10410656 CAGAACCAGGAGAAGAGCCCAGG + Intronic
1038142595 8:24862987-24863009 CAGGACAAGGACATGTGCTCCGG - Intergenic
1041256336 8:55982615-55982637 CACAGCAAGGAGGAGTGTTCGGG - Intronic
1041865392 8:62567370-62567392 CAGAGCAAGAAGAAATGGTGTGG + Intronic
1043358192 8:79438768-79438790 CAGAAGAAGGAGAACTGGTCTGG + Intergenic
1043812951 8:84765294-84765316 AAGAACAAGGAGAGGTAGTGGGG + Intronic
1051138021 9:13945611-13945633 AGAAACAAGGAGAAATGGTCAGG - Intergenic
1051444286 9:17124096-17124118 CAGCAAGAGGAGAAGAGGTCTGG + Intergenic
1056195503 9:84224774-84224796 TAGAACAAAGAAAGGTGGTCAGG + Intergenic
1056430995 9:86527615-86527637 AAGAACAAGAAGAAGAGGTTGGG + Intergenic
1057533280 9:95874228-95874250 TAAAACACGGAGAAGTGATCTGG + Intergenic
1057919406 9:99084575-99084597 CTTAAAAAGGAGAAATGGTCCGG + Intergenic
1059808067 9:117826240-117826262 CAGAAGAAGGGGAAGTAGTGGGG + Intergenic
1060502308 9:124169796-124169818 CAGAACAAGGAGTATTGCTGTGG - Intergenic
1062271820 9:135713355-135713377 CAGAACAAGGAGCAGGGTTTGGG + Intronic
1203786659 EBV:132130-132152 CGGAACCAGGAGAAGGGGTCTGG + Intergenic
1190291771 X:48997730-48997752 CAGAACAGGGAGAAGAGGAGGGG + Intronic
1190752599 X:53375253-53375275 CAGGACAGGCAGAGGTGGTCAGG - Exonic
1191201739 X:57790560-57790582 CAGAACAACTCGAAGTGGGCAGG - Intergenic
1193584828 X:83308028-83308050 GATAAAAAGGAGAAGTTGTCTGG + Intergenic
1194995648 X:100588935-100588957 CAGAGCAATGAGGAGTGGTAGGG + Intronic
1195071719 X:101287609-101287631 CAGTACTACCAGAAGTGGTCAGG - Intronic
1195285887 X:103383303-103383325 CAGAACTGGGAGAAGTGGGTGGG - Intergenic
1196495344 X:116318022-116318044 AAGAACAAGGAGCAGTAGCCAGG + Intergenic
1196645802 X:118116649-118116671 CAGGACAGGGTGAAGTGGTCGGG - Intronic
1197089905 X:122523831-122523853 CAGCCCTGGGAGAAGTGGTCAGG - Intergenic
1199990776 X:152986551-152986573 CAGAGCAAGGAGACTTTGTCGGG - Intergenic
1200033865 X:153316025-153316047 CAGAGCAAGGAGACTTTGTCGGG - Intergenic
1201018163 Y:9625333-9625355 CAGACACAGAAGAAGTGGTCAGG - Intergenic