ID: 966854133

View in Genome Browser
Species Human (GRCh38)
Location 3:184182651-184182673
Sequence TGGCACCTCCTGCAAGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 599
Summary {0: 1, 1: 0, 2: 0, 3: 41, 4: 557}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966854129_966854133 -2 Left 966854129 3:184182630-184182652 CCTGACCACTTCTCCTTGTTCTG 0: 1
1: 0
2: 4
3: 15
4: 228
Right 966854133 3:184182651-184182673 TGGCACCTCCTGCAAGCTCCTGG 0: 1
1: 0
2: 0
3: 41
4: 557
966854131_966854133 -7 Left 966854131 3:184182635-184182657 CCACTTCTCCTTGTTCTGGCACC 0: 1
1: 0
2: 1
3: 25
4: 320
Right 966854133 3:184182651-184182673 TGGCACCTCCTGCAAGCTCCTGG 0: 1
1: 0
2: 0
3: 41
4: 557
966854125_966854133 29 Left 966854125 3:184182599-184182621 CCAAGTTTCCATAGCAAGTGGTT 0: 1
1: 0
2: 1
3: 12
4: 158
Right 966854133 3:184182651-184182673 TGGCACCTCCTGCAAGCTCCTGG 0: 1
1: 0
2: 0
3: 41
4: 557
966854128_966854133 21 Left 966854128 3:184182607-184182629 CCATAGCAAGTGGTTAGCAGGGT 0: 1
1: 0
2: 0
3: 4
4: 102
Right 966854133 3:184182651-184182673 TGGCACCTCCTGCAAGCTCCTGG 0: 1
1: 0
2: 0
3: 41
4: 557
966854124_966854133 30 Left 966854124 3:184182598-184182620 CCCAAGTTTCCATAGCAAGTGGT 0: 1
1: 0
2: 1
3: 15
4: 154
Right 966854133 3:184182651-184182673 TGGCACCTCCTGCAAGCTCCTGG 0: 1
1: 0
2: 0
3: 41
4: 557

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966854133 Original CRISPR TGGCACCTCCTGCAAGCTCC TGG Intronic
900115511 1:1026277-1026299 TGGCACCTGCTGCAGCCTCCAGG + Intronic
900722534 1:4186683-4186705 TGGCACTTGCAGCCAGCTCCTGG + Intergenic
901232203 1:7647487-7647509 GGCCCCCGCCTGCAAGCTCCAGG - Intronic
901280792 1:8033166-8033188 TGGAAACTCCTGCATGCTGCTGG - Intergenic
901459294 1:9382190-9382212 TGGCACCTCCAGCCAGGGCCAGG + Intergenic
901496996 1:9627954-9627976 TGGCACCTCCCGCAGGAGCCAGG + Intergenic
901980887 1:13033294-13033316 TGGCACCTGCTTCAAGGACCTGG + Intronic
902001201 1:13195637-13195659 TGGCACCTGCTTCAAGGACCTGG - Intergenic
902020435 1:13341341-13341363 TGGCACCTGCTTCAAGGACCTGG - Intergenic
902729548 1:18360482-18360504 GGGCACCTCCTGGCAGCACCTGG + Intronic
902931021 1:19731619-19731641 TGCCGCGTCCTGCAAGCGCCTGG + Intronic
903012071 1:20338287-20338309 TTGCACCTCCTACAAATTCCAGG + Intronic
904198999 1:28807147-28807169 TGGCTCCATCAGCAAGCTCCAGG - Intergenic
904239631 1:29135306-29135328 TGACAACTCCTGCCTGCTCCAGG - Intergenic
904906064 1:33898120-33898142 TGGCATTTCCTGCCAGCTCATGG + Intronic
905060514 1:35135781-35135803 TGGCACTTCTAGCAAGCTCCTGG + Intergenic
905499786 1:38427341-38427363 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
905852769 1:41286517-41286539 TGACACCTCCTGCTGGCTGCTGG + Intergenic
905907723 1:41630558-41630580 TGTCAGCTCCTGGAAGCTGCGGG - Intronic
907503561 1:54901311-54901333 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
907830445 1:58059943-58059965 TGGAACTTCCTGGGAGCTCCCGG + Intronic
909035480 1:70590564-70590586 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
909571940 1:77123620-77123642 TGTCCCCTCCTCCCAGCTCCTGG - Intronic
909776686 1:79492013-79492035 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
909788262 1:79642175-79642197 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
911147981 1:94570309-94570331 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
912296481 1:108475211-108475233 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
913142355 1:115954083-115954105 TGGTTCCTCCTGGAAGCTCCAGG - Intergenic
915979026 1:160408691-160408713 GGGCACCTGGTGCCAGCTCCTGG + Intronic
916904130 1:169262985-169263007 TGGGGCCTCCTGCAAGACCCAGG + Intronic
917839485 1:178966075-178966097 TGGCACCTGCTGCTTTCTCCAGG + Intergenic
918116732 1:181504284-181504306 AGGCACTTCCTGGAAACTCCTGG - Intronic
919296723 1:195710907-195710929 TGCCACCTCCTGCCAGCCTCCGG + Intergenic
919476405 1:198037053-198037075 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
920849216 1:209617436-209617458 TGGCACCTTCCGCAAGCTGCTGG + Exonic
921509263 1:216010266-216010288 TGGCACTTGTAGCAAGCTCCTGG - Intronic
922363539 1:224843907-224843929 TGGCACTTGAAGCAAGCTCCTGG + Intergenic
922695960 1:227731145-227731167 TGGGCCCCCCTGCTAGCTCCCGG - Intronic
922877089 1:228948495-228948517 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
922881509 1:228984795-228984817 TGGCACCTCCTCAGTGCTCCTGG - Intergenic
923075212 1:230603489-230603511 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
923214187 1:231833661-231833683 TGGCACTTGTAGCAAGCTCCTGG + Intronic
923770730 1:236935705-236935727 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
923952516 1:238974697-238974719 TCCTACCTCCTCCAAGCTCCTGG + Intergenic
924378006 1:243433465-243433487 TGGCAGCACCTGCCATCTCCTGG + Intronic
1063363174 10:5473371-5473393 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1063647137 10:7896371-7896393 TAGGACCTCCTCCAAGTTCCTGG - Intronic
1064347764 10:14548356-14548378 CTGCACCTCCTGCCAGCTCCAGG + Intronic
1064663806 10:17630296-17630318 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1064886988 10:20122611-20122633 TGGCACTTGTAGCAAGCTCCTGG + Intronic
1071110559 10:82150265-82150287 TTGCAACACCTGCCAGCTCCTGG - Intronic
1071925479 10:90403482-90403504 AGGTACCTCCTGCCAGCTACTGG - Intergenic
1071961117 10:90809685-90809707 TGGCACTTGTAGCAAGCTCCTGG - Intronic
1071982168 10:91014389-91014411 TGTCACCTGCTGCTGGCTCCTGG - Intergenic
1072011270 10:91304939-91304961 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1074019035 10:109564625-109564647 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1074081084 10:110168679-110168701 TGGCACCTTCTGACGGCTCCAGG - Intergenic
1074740786 10:116482913-116482935 TGGCACTTGCAGCAAGCTCCTGG - Intergenic
1075141323 10:119839199-119839221 AGGCACCTCCTGAGAGCTGCAGG - Intronic
1075248705 10:120847108-120847130 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1075921203 10:126215020-126215042 TGGCACCTGGTCCAAGCCCCTGG + Intronic
1076607902 10:131701351-131701373 TGGCTCCTCCTGGAGGCTCCAGG + Intergenic
1076875159 10:133212369-133212391 TGGCACCTCCTGCACCATCCCGG + Intronic
1077362987 11:2149036-2149058 TGGCAGCTGCCCCAAGCTCCCGG + Intronic
1077766376 11:5163736-5163758 TGGCACTTGTAGCAAGCTCCTGG + Intronic
1078188520 11:9072908-9072930 TCTCCCCTCCTGCAAGCCCCCGG - Intronic
1078320587 11:10331106-10331128 TGGCTGCTGCTCCAAGCTCCAGG - Intronic
1079230520 11:18645289-18645311 TGGCACTTGCAGCAAGCTCCTGG - Intergenic
1079727066 11:23890634-23890656 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1079847683 11:25490671-25490693 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1080027909 11:27632536-27632558 TGGCACTTGTGGCAAGCTCCTGG + Intergenic
1080047653 11:27826497-27826519 TGGCCCCTCATTCAAGCTCGGGG + Intergenic
1080749091 11:35136282-35136304 TTTCACCTCATGCAACCTCCAGG - Intergenic
1081876419 11:46411394-46411416 TGGGACCTCCTGGGACCTCCTGG - Intronic
1083584195 11:63844886-63844908 AGGAACCTCATGGAAGCTCCTGG - Intronic
1083746525 11:64740012-64740034 TCGCTCCTTCTGCAAGATCCTGG - Exonic
1084047173 11:66575878-66575900 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1084232310 11:67761943-67761965 TGGCACTTGTGGCAAGCTCCTGG - Intergenic
1084245592 11:67854860-67854882 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1084323568 11:68386638-68386660 CGGCACCTCCCGCAAGATCCTGG + Exonic
1084355560 11:68635971-68635993 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1084610126 11:70196899-70196921 TGGCTCCCTCTGGAAGCTCCGGG + Intergenic
1084853147 11:71960445-71960467 TGGGACCTCCTTCATGCTACAGG + Intronic
1085988022 11:81808474-81808496 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1086035152 11:82405649-82405671 CGGCAACTCCTGCCAGCTCCAGG + Intergenic
1086136262 11:83446355-83446377 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1087042378 11:93814374-93814396 TAGCACATCCTTCAAACTCCAGG - Exonic
1087076930 11:94134226-94134248 TGTCACCTTGTGCAAGCTGCTGG + Intronic
1087099106 11:94347979-94348001 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1087099649 11:94351912-94351934 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1087314682 11:96590184-96590206 TGGCACGTGTAGCAAGCTCCTGG - Intergenic
1087839534 11:102907531-102907553 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1088651486 11:111961120-111961142 GGGAGCCTCCTGCAAACTCCTGG - Intronic
1089045986 11:115503085-115503107 TGGCCCCTGCTGCAGGCTCCAGG - Intronic
1089182524 11:116592965-116592987 CGGCATCACCTGCAATCTCCAGG + Intergenic
1089682950 11:120129672-120129694 GGGGACCTCCTGCAGGCACCCGG + Intronic
1089867042 11:121641376-121641398 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1090107592 11:123869050-123869072 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1090189698 11:124759922-124759944 CGGCAGCACCTGCAGGCTCCAGG - Intronic
1090526801 11:127546184-127546206 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1090546482 11:127772528-127772550 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1090871951 11:130756962-130756984 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1091629673 12:2150189-2150211 GGGCTTATCCTGCAAGCTCCAGG - Intronic
1092592747 12:9966519-9966541 TGGCACTTTTAGCAAGCTCCTGG + Intronic
1092739316 12:11613147-11613169 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1092924847 12:13263423-13263445 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1093321980 12:17723730-17723752 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1093358442 12:18197210-18197232 TGGCACTTGTAGCAAGCTCCTGG - Intronic
1093578823 12:20765636-20765658 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1093584511 12:20820454-20820476 TGGCACTTGTAGCAAGCTCCTGG + Intronic
1093951077 12:25165407-25165429 TGGCACTTGTAGCAAGCTCCTGG - Intronic
1094089458 12:26631959-26631981 TGGCACATCCGGCACGCTCATGG + Exonic
1094825761 12:34267897-34267919 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1095242258 12:39875212-39875234 TGTCCCTTCCTGGAAGCTCCAGG + Intronic
1095637660 12:44452056-44452078 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1096578250 12:52568185-52568207 TGCCACCTACCGCAAGCTGCTGG - Exonic
1096606611 12:52771015-52771037 TGCCACCTACCGCAAGCTGCTGG - Exonic
1096614303 12:52823032-52823054 TGCCACCTACCGCAAGCTTCTGG - Exonic
1099081993 12:78195574-78195596 TGGCACATCCTGCTGGCACCAGG - Intronic
1099292095 12:80786529-80786551 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1099363610 12:81740034-81740056 TAGCACCTATTGCAAGTTCCAGG + Intronic
1100940303 12:99717447-99717469 TGGCACTTGTAGCAAGCTCCTGG - Intronic
1102139656 12:110604322-110604344 TGGCAACTCCTGCAAGAACTAGG - Intergenic
1102520012 12:113472236-113472258 GGGCAACTTCTGCAAGTTCCAGG - Intronic
1102527194 12:113520446-113520468 AGGCCCCTCCTGCCATCTCCTGG + Intergenic
1102648539 12:114419781-114419803 TGGCTCCTTCTCCAGGCTCCTGG - Intergenic
1103253368 12:119520202-119520224 AGGCACCTGCTGCAGGCTCCAGG - Intronic
1104976498 12:132554270-132554292 CGGCACCTCCTCCAAGTGCCGGG - Intronic
1107220289 13:37972628-37972650 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1108952941 13:56115870-56115892 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1110845348 13:80185932-80185954 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1111126038 13:83911733-83911755 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1111362101 13:87189879-87189901 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1111631696 13:90852039-90852061 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1113000095 13:105625098-105625120 TGGCTCCTCCTTTATGCTCCTGG - Intergenic
1113324343 13:109267607-109267629 TGGCACTTGCAGCAAGCTCCTGG - Intergenic
1113741894 13:112716774-112716796 TGGCAGCTCCTGCAGGGCCCAGG + Intronic
1113791587 13:113031656-113031678 CTGCTCCTCCAGCAAGCTCCAGG - Intronic
1115129089 14:30032091-30032113 TGGCACCTCATTCAATCTCTTGG + Intronic
1115240596 14:31248795-31248817 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1115946304 14:38665251-38665273 TGCCAGCTCCTGGCAGCTCCTGG + Intergenic
1116543738 14:46135601-46135623 TGGCTCCTTCTGGAAGTTCCAGG - Intergenic
1116702399 14:48258834-48258856 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1116703283 14:48265826-48265848 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1116847809 14:49881025-49881047 TGGCACCTCTAGCAAGGGCCTGG - Intergenic
1116902130 14:50371666-50371688 TCCCAGCTCCTGCCAGCTCCAGG - Intronic
1117014668 14:51506421-51506443 TGGCACCTTCTGTAATCTCTTGG - Intronic
1117801190 14:59446316-59446338 TGGCACTTGTAGCAAGCTCCTGG - Intronic
1118760843 14:68879457-68879479 TGGGACCGCCCGCAAGCCCCAGG + Intronic
1119022439 14:71126586-71126608 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1119750291 14:77072507-77072529 TGACACCTGCTGAAATCTCCAGG - Intergenic
1119776462 14:77252156-77252178 TGACACCTCCTCCAAACTGCAGG + Intronic
1119879821 14:78091428-78091450 AGGCACTTCCAGCAAGCTCAGGG - Intergenic
1120251387 14:82064533-82064555 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1120438045 14:84503657-84503679 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1120539552 14:85736425-85736447 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1120618262 14:86733609-86733631 TGGCACTTGTTGCAAGCTCTTGG - Intergenic
1120659949 14:87238489-87238511 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1121011934 14:90524786-90524808 TTGCACCACCTGAGAGCTCCAGG - Exonic
1121607644 14:95253044-95253066 TGGCACCAACTGCAAGTTCAGGG - Intronic
1121994009 14:98587607-98587629 TGGCCCCTGCTTCATGCTCCAGG + Intergenic
1122501191 14:102200930-102200952 TGGCACATCCTGCCAGCTGCAGG + Intronic
1122829212 14:104387597-104387619 TGGCACTGCCTGGGAGCTCCTGG + Intergenic
1123114330 14:105887086-105887108 AGGCACCTGCTGGCAGCTCCTGG - Intergenic
1123120767 14:105915373-105915395 TGGTACCTGCTGGCAGCTCCTGG - Intergenic
1123882487 15:24689031-24689053 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1126599832 15:50417634-50417656 TGGCAGCTGCTGCATGGTCCTGG - Intergenic
1126843754 15:52740847-52740869 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1128535766 15:68489066-68489088 TGGCACCTGCTGGGAGCTTCCGG + Intergenic
1128542532 15:68545796-68545818 TGGCAGCTCCTGCCATCCCCGGG - Intergenic
1129251079 15:74309277-74309299 TGGTGCCTCCTCCCAGCTCCAGG + Intronic
1129739109 15:77981431-77981453 TGGCAGCTTCGGCAACCTCCTGG - Intergenic
1130032463 15:80328374-80328396 TGGCACTTCCTGAATGCACCAGG - Intergenic
1130064409 15:80592437-80592459 AGGCACGTCCTGCATGCCCCAGG + Intronic
1130096687 15:80861432-80861454 TGGCACCTGCTGTATTCTCCAGG + Intronic
1131447755 15:92513771-92513793 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1132263021 15:100442547-100442569 TGGCACTTGTAGCAAGCTCCTGG - Intronic
1132340419 15:101074797-101074819 TGGCACTTGTAGCAAGCTCCTGG - Intronic
1133126953 16:3653254-3653276 TTGCGCCTCCTGGAGGCTCCGGG - Intronic
1133750769 16:8723506-8723528 TGGCAACTCCAGAAATCTCCAGG + Intronic
1133766757 16:8843532-8843554 TGGCACGTGTAGCAAGCTCCTGG + Intronic
1133819700 16:9225712-9225734 TGGTTCCTTCTGCAAGCTCTAGG - Intergenic
1134864126 16:17589784-17589806 TGGCTCCTTCTGGAAGCTCTAGG - Intergenic
1135971359 16:27074258-27074280 TGGCATAGCCAGCAAGCTCCTGG - Intergenic
1137363434 16:47840785-47840807 TGGCACTTGTGGCAAGCTCCTGG - Intergenic
1138759096 16:59521080-59521102 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1139039230 16:62982595-62982617 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1141357304 16:83359469-83359491 TTCCAACTCCTGCAAGCTGCTGG - Intronic
1141986360 16:87582810-87582832 AGGCAGCTCCTGCAAGCTCACGG - Intergenic
1143609251 17:8008128-8008150 TGTCAAATCCTGCAGGCTCCAGG + Intronic
1146664870 17:34692704-34692726 TGTGACCTCCTGCAAGTGCCTGG - Intergenic
1146821164 17:35984508-35984530 TGGCTGCTCCTGCAAGCTGAGGG + Intronic
1147018583 17:37512405-37512427 CGGCACCTCCTCCAGGCTCGTGG + Exonic
1147496929 17:40925514-40925536 TCGGTACTCCTGCAAGCTCCAGG - Exonic
1148390771 17:47270804-47270826 AAGCACCTCCTGGAAGCCCCAGG - Intronic
1148913098 17:50953858-50953880 AAGCACCTCCTTCAAGCTCCAGG + Intergenic
1149045857 17:52244591-52244613 TGGCATCTCCTCTGAGCTCCAGG + Intergenic
1150620032 17:66801297-66801319 TGGAACATCCTGCAAGGCCCAGG - Intronic
1151187343 17:72373982-72374004 TCCCACATCCTGCCAGCTCCTGG + Intergenic
1151458619 17:74241602-74241624 TGCCACTTTCTGCCAGCTCCAGG + Intronic
1151622495 17:75254835-75254857 TGGCACTTGTAGCAAGCTCCTGG - Intronic
1151656548 17:75498897-75498919 CGCCACCTCCTGCAGGCTGCTGG + Exonic
1154183151 18:12155352-12155374 TGTGGCCTCCTGCAAGTTCCTGG - Intergenic
1155173825 18:23286301-23286323 TGGCACTTGTAGCAAGCTCCTGG - Intronic
1155697010 18:28696549-28696571 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1155941554 18:31806066-31806088 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1156924047 18:42555939-42555961 TGGCACTTGTAGCAAGCTCCAGG + Intergenic
1156958185 18:42993135-42993157 TGGCACTTGTAGCAAGCTCCTGG - Intronic
1157604028 18:48914578-48914600 TGGCAGCTCCAGGCAGCTCCAGG + Intergenic
1157906385 18:51573487-51573509 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1158394638 18:57070075-57070097 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1159983980 18:74820252-74820274 TGGGGCCTGCTCCAAGCTCCTGG - Intronic
1160225130 18:77006351-77006373 TGCCAGCTCCTCCAAGCTCCAGG - Intronic
1160313133 18:77816316-77816338 TGGCACCTGATGCAAACTACAGG - Intergenic
1160536735 18:79598437-79598459 CCCCACCTCCTGCAGGCTCCAGG + Intergenic
1160835641 19:1123283-1123305 TTGCCCCTCCTGCAAGCCGCTGG - Intronic
1160846455 19:1168256-1168278 TCGCAGCTCCCCCAAGCTCCTGG + Intronic
1160956228 19:1693285-1693307 TGGTCCCTCCTGGAGGCTCCAGG + Intergenic
1161124327 19:2547333-2547355 TGGTCCCTCCTGGAGGCTCCAGG + Intronic
1161776959 19:6268901-6268923 TGGCACCTTCTCCAAGTACCTGG - Intronic
1163174699 19:15556119-15556141 AGGCAGCACCTGCAAGATCCGGG - Intergenic
1163687348 19:18719335-18719357 TGGCACCTGCTGCAGGCCCTGGG - Intronic
1165104761 19:33462299-33462321 TGGTACCACCTGGAAGCTCTGGG - Intronic
1165493006 19:36136030-36136052 AGACACCTCCTGCGAACTCCAGG - Intergenic
1165496999 19:36158866-36158888 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1165510312 19:36262932-36262954 TGGCACTTATAGCAAGCTCCTGG + Intergenic
1165835364 19:38751872-38751894 TGGCACTTGTAGCAAGCTCCTGG - Intronic
1166051726 19:40264651-40264673 TCTCACCTCCTCCAGGCTCCAGG + Intronic
1166993036 19:46704642-46704664 TGGCGCCCCCTGCAGGCTGCGGG - Exonic
1167179605 19:47892618-47892640 TCCCACCACCAGCAAGCTCCAGG - Intergenic
1167902155 19:52630033-52630055 TGGCACTTGTAGCAAGCTCCTGG - Intronic
1168227980 19:55010232-55010254 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
925359879 2:3270359-3270381 GGGTACCTCCTCCAAGCTCCAGG + Intronic
926108034 2:10164740-10164762 GGGCACCTCCTGCAGGGCCCTGG - Intronic
926407776 2:12572018-12572040 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
928827650 2:35440546-35440568 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
928857175 2:35815342-35815364 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
929793059 2:45037884-45037906 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
931026387 2:58116864-58116886 TGGCACTTGTAGCAAGCTCCTGG + Intronic
931042620 2:58315958-58315980 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
931236946 2:60419873-60419895 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
931455600 2:62407686-62407708 GGGCACCTGCTGCAGGCTTCAGG - Intergenic
931608920 2:64078618-64078640 TGGCACTTGTGGCAAGCTCCTGG + Intergenic
931948262 2:67333859-67333881 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
932081446 2:68719338-68719360 TGGCACCTGATGCTAACTCCAGG + Intronic
932358813 2:71088492-71088514 TGGCACTTGCAGCAAACTCCTGG + Intergenic
932429148 2:71663567-71663589 TGGCACCTGGTGCATGCTCAGGG - Intronic
932621665 2:73268578-73268600 TGGCCCCACATGCATGCTCCTGG + Intronic
932943747 2:76202508-76202530 AGGCACCTCTTTCAAGCTCTTGG - Intergenic
933013097 2:77090638-77090660 TGGCACTTGTAGCAAGCTCCTGG - Intronic
933079277 2:77967371-77967393 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
933163737 2:79053649-79053671 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
933179763 2:79215267-79215289 TGGCACTTGTAGCAAGCTCCTGG + Intronic
933552388 2:83792358-83792380 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
935611746 2:105032853-105032875 TGGCACCTCCTGTACCCTTCTGG + Intergenic
936090214 2:109497028-109497050 TGGTTCCTCCTGCAGGCTCTAGG - Intronic
936450631 2:112631247-112631269 TGGCTCCTCCTCCCAACTCCAGG + Intergenic
936883340 2:117281003-117281025 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
937318160 2:120945120-120945142 TGGCACTGCCTGCAGCCTCCTGG + Intronic
939083133 2:137686392-137686414 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
939307418 2:140428401-140428423 TGGCACTTGTAGCAAGCTCCTGG - Intronic
939649292 2:144741858-144741880 TGGTTCCTTCTGGAAGCTCCAGG - Intergenic
940287341 2:152045507-152045529 TTGCTCCTCCTCCCAGCTCCTGG - Intronic
940530194 2:154869583-154869605 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
940675798 2:156723517-156723539 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
941322860 2:164076969-164076991 TGGCATCTCAGGCTAGCTCCAGG + Intergenic
941340405 2:164298117-164298139 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
942597222 2:177602604-177602626 TTTCACCTCTTGTAAGCTCCAGG - Intergenic
942730286 2:179055204-179055226 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
943412926 2:187563927-187563949 TGGCACTTGTAGCAAGCTCCTGG + Intronic
943421579 2:187673926-187673948 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
943461187 2:188172653-188172675 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
943806656 2:192132685-192132707 TGGCACTTGTAGCAAGCTCCTGG - Intronic
943951282 2:194134327-194134349 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
944529048 2:200649693-200649715 TGGCTCCTCCTCCCAGATCCTGG + Intronic
944771485 2:202918468-202918490 TGGCACTCACTGCAAGCTCTCGG - Intronic
944876126 2:203965365-203965387 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
946169099 2:217883829-217883851 TGGACCCTCCTCCAAGCCCCAGG + Intronic
946215025 2:218177480-218177502 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
946781039 2:223193289-223193311 TGGCACTTGTAGCAAGCTCCTGG + Intronic
946886503 2:224227552-224227574 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
946893279 2:224298937-224298959 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
947009806 2:225553092-225553114 GGGCCCTTCCTGCAAGCTTCTGG - Intronic
947129245 2:226904398-226904420 TGGCACATCCTGCAAGCGGGGGG + Intronic
948590076 2:239043624-239043646 TGGATTCTCCTACAAGCTCCAGG - Intergenic
948729367 2:239953318-239953340 TGGTCCCTCCTGCAGGCTCCTGG - Intronic
949060079 2:241951897-241951919 TTTCTCCTCCTGCCAGCTCCTGG + Intergenic
1168851983 20:983253-983275 TGCCACCCCTTGGAAGCTCCAGG - Intronic
1168852172 20:984529-984551 TGCCACCCCTTGGAAGCTCCAGG - Intronic
1169869825 20:10238451-10238473 TGGCAGCTCCTGCAGTCTCAGGG + Intronic
1170225846 20:13991471-13991493 TAGCTCCTCCTGGAGGCTCCAGG + Intronic
1170820696 20:19754594-19754616 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1171142454 20:22755001-22755023 TGGGAAATCCTGCAGGCTCCTGG + Intergenic
1172302931 20:33862795-33862817 TGGCGCCACCTGCAGGCCCCTGG - Intergenic
1172634253 20:36399139-36399161 TGCAACCTCCAGCAACCTCCTGG - Intronic
1173763770 20:45587645-45587667 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1173845065 20:46182967-46182989 TGCCACCTGGTGTAAGCTCCGGG - Intronic
1173908327 20:46645047-46645069 TGGTTCCTCCTGGAAGCTCCAGG + Intronic
1175116127 20:56683764-56683786 TGGCTTGTCCTGCGAGCTCCGGG + Intergenic
1175472125 20:59237814-59237836 CAGCACCTCCTCCCAGCTCCAGG - Intronic
1175811496 20:61860813-61860835 GGGCTCCTCCTGCAGGATCCTGG + Intronic
1175905480 20:62377573-62377595 TGGCTCCTGGTGCAGGCTCCTGG + Intergenic
1177031167 21:15983240-15983262 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1177100629 21:16894438-16894460 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1177102679 21:16916250-16916272 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1178001206 21:28163476-28163498 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1179557660 21:42190739-42190761 TGGCGCCTGCCGCAAGCTGCTGG + Intergenic
1180039892 21:45270511-45270533 TCCCACCACCTGCAACCTCCTGG + Intronic
1180174125 21:46079252-46079274 GGGTCCCTCCTGCAAGCCCCGGG - Intergenic
1181030938 22:20148667-20148689 TGCCACCGTCTGGAAGCTCCGGG - Exonic
1181172009 22:21015180-21015202 TGCCAGCTCCTGCTAGCTGCGGG - Exonic
1181177297 22:21045020-21045042 TGCCAGCTCCTGCTAGCTGCGGG + Intergenic
1181512383 22:23394717-23394739 TGCCACCATCTGGAAGCTCCGGG + Intergenic
1182269609 22:29145194-29145216 TGCCACCTCCTCCATGCTCCTGG - Intronic
1182667883 22:31972466-31972488 TGGCACCTCCTGGAAGGGCCCGG - Intergenic
1182853012 22:33492587-33492609 AGGCACAGGCTGCAAGCTCCGGG + Intronic
1183831999 22:40423164-40423186 TGGCACCTCCTGCATGACTCTGG + Intronic
1183907738 22:41054940-41054962 TGGTTCCTCCTGGAAGCTGCAGG + Intergenic
1184519257 22:44982836-44982858 TGGCTCCTCCTGGTAGCCCCAGG - Intronic
1184805121 22:46790152-46790174 TGGTTCCTTCTGGAAGCTCCAGG + Intronic
1184865220 22:47198381-47198403 TAGCACCTCGTGCAGGCCCCTGG - Intergenic
1185068348 22:48643075-48643097 TTGCATCTGCTGCAGGCTCCAGG + Intronic
1185182935 22:49373410-49373432 TGGCCCCTCCTGCAGGGACCGGG - Intergenic
949190391 3:1243260-1243282 TGGCACTTGTAGCAAGCTCCTGG + Intronic
949827447 3:8179278-8179300 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
950926500 3:16746579-16746601 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
951332322 3:21382011-21382033 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
951611149 3:24494446-24494468 GGGCACCTCCTCCCAGATCCGGG + Intronic
951762790 3:26163818-26163840 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
951888972 3:27551576-27551598 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
952343556 3:32464858-32464880 TGGCACTTGTAGCAAGCTCCTGG + Intronic
953077129 3:39581248-39581270 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
953177197 3:40563241-40563263 TGGCACTTGTAGCAAGCTCCTGG - Intronic
953412786 3:42699595-42699617 TGGCCCCTCCTGTATCCTCCTGG - Intronic
954289692 3:49643086-49643108 ATGCACCACCTGCAGGCTCCAGG + Exonic
954422637 3:50426702-50426724 TGGGACCTCCTCCAAGATGCAGG - Intronic
954933704 3:54307366-54307388 GGTCACCTGCTGCAATCTCCTGG + Intronic
955138740 3:56247752-56247774 TGGTACAGACTGCAAGCTCCTGG + Intronic
955253370 3:57305940-57305962 TGGCACTTGTAGCAAGCTCCTGG - Intronic
955322519 3:57984489-57984511 TGGCTCCTTCTGGAGGCTCCAGG - Intergenic
956548984 3:70438311-70438333 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
956709222 3:72025250-72025272 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
957059895 3:75473480-75473502 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
958771257 3:98428641-98428663 AGGCACCTCCTGCCACCTCCTGG + Intergenic
959485770 3:106926178-106926200 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
959540016 3:107525886-107525908 TGGCACCTCCCGCCGTCTCCTGG + Intronic
959936464 3:112034382-112034404 TGGCATCTCTTGCCTGCTCCAGG - Intergenic
960310110 3:116108767-116108789 TGGCACTTGTAGCAAGCTCCTGG + Intronic
961711621 3:128832640-128832662 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
961730591 3:128961967-128961989 TGGCACTTGTAGCAAGCTCCTGG - Intronic
961774802 3:129277372-129277394 TGGCAGCTCCTCCAAACTTCTGG - Exonic
962201529 3:133404354-133404376 TGACACCTGCTCCAAGCCCCTGG + Intronic
962205570 3:133431390-133431412 TGGCACTTGAAGCAAGCTCCTGG - Intronic
962660637 3:137597735-137597757 TGGCACCTTTAGCAAGCTCCTGG - Intergenic
963456657 3:145554624-145554646 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
963663348 3:148153912-148153934 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
963684335 3:148416609-148416631 TGGCACATGTAGCAAGCTCCTGG - Intergenic
964067878 3:152599601-152599623 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
964067901 3:152599704-152599726 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
964125449 3:153230142-153230164 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
964300249 3:155278631-155278653 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
964983639 3:162714663-162714685 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
965262648 3:166504234-166504256 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
965286728 3:166827552-166827574 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
965336332 3:167433476-167433498 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
965624878 3:170675971-170675993 TGGCACTTATAGCAAGCTCCTGG + Intronic
965640036 3:170821407-170821429 TGGCACTTATAGCAAGCTCCTGG + Intronic
965861966 3:173159357-173159379 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
966085435 3:176063596-176063618 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
966105081 3:176325072-176325094 TGGCACTTGCAGCAAGCTCCTGG + Intergenic
966232844 3:177669288-177669310 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
966397657 3:179519123-179519145 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
966854133 3:184182651-184182673 TGGCACCTCCTGCAAGCTCCTGG + Intronic
967244163 3:187469720-187469742 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
967496225 3:190146766-190146788 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
967643826 3:191898818-191898840 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
967658103 3:192074534-192074556 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
968802529 4:2752648-2752670 TGTCACCTCCTGCAGGCCCTGGG - Intronic
968993387 4:3929639-3929661 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
969003808 4:4003665-4003687 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
969222618 4:5771220-5771242 TGACTCCTCCTGGAGGCTCCAGG + Intronic
969654096 4:8486231-8486253 TGGCACTTGTAGCAAGCTCCTGG + Intronic
969749059 4:9096520-9096542 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
969810119 4:9641160-9641182 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
969913503 4:10466688-10466710 TGGCTCCTTCTGCAGGCTCTAGG + Intergenic
970042094 4:11808534-11808556 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
970087551 4:12366023-12366045 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
970201538 4:13613152-13613174 TGGCACCAGTTGCAAGTTCCGGG - Intronic
970532739 4:16999923-16999945 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
973751128 4:54022064-54022086 TGGCACTTGAAGCAAGCTCCTGG - Intronic
976558574 4:86476848-86476870 TGGCACTTGTAGCAAGCTCCTGG - Intronic
976842034 4:89443184-89443206 TGGTGCCTCCTGGAGGCTCCAGG - Intergenic
977010319 4:91626348-91626370 TGGCACTTGTGGCAAGCTCCTGG - Intergenic
977012921 4:91658075-91658097 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
977062505 4:92274943-92274965 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
977217151 4:94296668-94296690 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
977812537 4:101373899-101373921 TGAGAGTTCCTGCAAGCTCCTGG - Intergenic
978001116 4:103557216-103557238 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
978031487 4:103943399-103943421 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
978438614 4:108711285-108711307 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
979146622 4:117254358-117254380 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
979895155 4:126148589-126148611 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
980111923 4:128644307-128644329 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
980388928 4:132120458-132120480 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
980611773 4:135170743-135170765 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
981040247 4:140215752-140215774 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
981525213 4:145701358-145701380 TGGCACTTGTAGCAAGCTCCTGG - Intronic
982083964 4:151816055-151816077 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
982414193 4:155111914-155111936 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
983023874 4:162711359-162711381 TGGCACTTGTGGCAAGCTCCTGG - Intergenic
983055491 4:163095346-163095368 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
983264474 4:165493517-165493539 TGGCACCACCTCCCAGCTCTGGG - Intronic
983345559 4:166522780-166522802 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
983448063 4:167878528-167878550 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
983538234 4:168880686-168880708 TGGCAGTTCCTGCAAGTTCCAGG - Intronic
983659575 4:170118712-170118734 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
983707677 4:170679750-170679772 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
984099044 4:175464887-175464909 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
984322191 4:178209380-178209402 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
984393611 4:179168342-179168364 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
984437266 4:179722704-179722726 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
985582358 5:705047-705069 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
985585963 5:734443-734465 TTCCACCTCCTGCAACATCCTGG + Intronic
985600382 5:825855-825877 TTCCACCTCCTGCAACATCCTGG + Intronic
985913073 5:2897897-2897919 TGGCTCCTTCTGGAGGCTCCGGG + Intergenic
986555039 5:9001998-9002020 TGGCACTTGCAGCAAGCTCCTGG + Intergenic
986694111 5:10336947-10336969 TTTCCCCTCCTCCAAGCTCCTGG - Intergenic
986905777 5:12492059-12492081 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
987357768 5:17080394-17080416 TGGCATCTTCTGGAAGCTCAAGG - Intronic
992159042 5:73982942-73982964 CGCCACCTCCTGCCAGCTGCTGG + Intergenic
992960833 5:81955516-81955538 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
993836710 5:92826233-92826255 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
994775687 5:104033875-104033897 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
995296679 5:110532099-110532121 TGGCACTTGTAGCAAGCTCCTGG - Intronic
997718409 5:136059076-136059098 TGGCATCTCCTGCAGGTTGCGGG - Exonic
997746404 5:136303571-136303593 TGGCACTTGTAGCAAGCTCCTGG - Intronic
998168239 5:139856582-139856604 TGGCCCCTCCTCCCAGCTCAGGG + Intronic
998337930 5:141389872-141389894 CAGCACCTCCTGCAAGCTGTCGG - Exonic
999542002 5:152584436-152584458 TGGCATCTCCAGCATGCTGCAGG - Intergenic
1000438589 5:161242225-161242247 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1000439724 5:161250750-161250772 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1000519402 5:162278829-162278851 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1000935639 5:167301340-167301362 TGGCACTTGTAGCAAGCTCCTGG + Intronic
1001331446 5:170765486-170765508 TGGCACTTGTAGCAAGCTCCTGG + Intronic
1001799239 5:174529030-174529052 TTGCATTTCCTGCAAGCTCCAGG - Intergenic
1002042030 5:176521500-176521522 TCCTGCCTCCTGCAAGCTCCAGG - Intergenic
1002074235 5:176698533-176698555 AGCCACCTCCGGCAAGCCCCAGG - Intergenic
1002083471 5:176751876-176751898 TTCCACCTCCTTCAAGCCCCTGG - Intergenic
1002589195 5:180277305-180277327 TGGCTCCTTCTGCAGGCTCTGGG + Intronic
1002610957 5:180418178-180418200 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1003384588 6:5655507-5655529 TGGCACCTTCTGGAGGCTCTAGG + Intronic
1004458038 6:15809931-15809953 GGGCTCCTCCTCCAAGCTCTGGG - Intergenic
1004507993 6:16262445-16262467 TGGCACTTGTAGCAAGCTCCTGG + Intronic
1004575225 6:16888214-16888236 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1004768571 6:18757518-18757540 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1004837005 6:19541162-19541184 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1006499932 6:34451794-34451816 TGGCTCCTTCTGACAGCTCCAGG + Intergenic
1007399463 6:41595446-41595468 TGGGGCCTCCTGCCAGCCCCTGG - Intronic
1007414239 6:41682839-41682861 TGGCGCCTCCTCCTAGTTCCAGG - Intergenic
1007421849 6:41724426-41724448 TGGCATCTCCTGCCTTCTCCAGG - Intronic
1007531598 6:42547756-42547778 GGGCGCCCCCTGCAGGCTCCCGG + Intergenic
1008613691 6:53206628-53206650 TGTCATCTCCACCAAGCTCCAGG + Intergenic
1010829687 6:80513758-80513780 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1010841311 6:80651250-80651272 TGGCACTTCTAGCAAGCTCCTGG + Intergenic
1010894542 6:81348590-81348612 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1011018467 6:82784358-82784380 TGGCACCTATTGCAACCTCTAGG + Intergenic
1012675102 6:102104214-102104236 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1013407885 6:109859208-109859230 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1013609796 6:111783851-111783873 TGACAGCTCTTACAAGCTCCTGG - Intronic
1014614670 6:123585741-123585763 TGGCACTTGTAGCAAGCTCCTGG + Intronic
1014793988 6:125705314-125705336 TGGCACATGTAGCAAGCTCCTGG + Intergenic
1014891547 6:126851011-126851033 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1015165223 6:130194601-130194623 TGGCACTTGTAGCAAGCTCCTGG - Intronic
1015269660 6:131325660-131325682 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1015801374 6:137064778-137064800 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1016114138 6:140260863-140260885 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1016204539 6:141455087-141455109 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1016360675 6:143264480-143264502 TGGGGCTTCCTGCAAGCGCCAGG - Intronic
1016650288 6:146453868-146453890 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1016853272 6:148642057-148642079 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1018077600 6:160230752-160230774 TGGCACTTGTAGCAAGCTCCTGG - Intronic
1018084493 6:160290024-160290046 TGGCACCTGTAGCAAGCTCCTGG + Intergenic
1018495400 6:164342186-164342208 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1018521466 6:164655604-164655626 TGGCACCTGTAGCAAGCTCCTGG + Intergenic
1018951441 6:168381065-168381087 TGGCCCCTTCTGGAGGCTCCAGG + Intergenic
1019129853 6:169865645-169865667 TGGCAGCAGCTGCCAGCTCCAGG - Intergenic
1019798211 7:3067757-3067779 AGGCACCCACTGCAAGCGCCAGG - Intergenic
1020323942 7:6960120-6960142 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1020541138 7:9462008-9462030 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1020794217 7:12661824-12661846 TGGCACTTGAAGCAAGCTCCTGG - Intergenic
1021326041 7:19270118-19270140 TGTCTCCTCCTGGATGCTCCAGG - Intergenic
1021429852 7:20547706-20547728 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1021977892 7:26027640-26027662 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1022372876 7:29787104-29787126 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1022710043 7:32841356-32841378 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1022840227 7:34157270-34157292 TGGCACCTCCTCCACTCTCAAGG - Intergenic
1023562176 7:41487671-41487693 TGGCACAACCTGCAAGACCCTGG + Intergenic
1025003896 7:55340773-55340795 TGGCAGCTCCCAGAAGCTCCTGG - Intergenic
1026513176 7:71044418-71044440 TGGTACCCCAGGCAAGCTCCTGG - Intergenic
1027423221 7:78037261-78037283 TAGCTCCAGCTGCAAGCTCCTGG + Intronic
1028670513 7:93396188-93396210 TGGCACTTGCAGCAAGCTCCTGG - Intergenic
1028690181 7:93642118-93642140 TGGCACTTGCAGCAAGCTCCTGG - Intronic
1029500217 7:100924427-100924449 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1029508629 7:100978670-100978692 TGTCTCCTCCTGCCACCTCCAGG - Intronic
1030441684 7:109595479-109595501 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1030751495 7:113237031-113237053 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1031296619 7:120011147-120011169 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1031399988 7:121317829-121317851 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1031422452 7:121567432-121567454 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1031685849 7:124731296-124731318 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1031727929 7:125262355-125262377 TGGCACTTATAGCAAGCTCCTGG + Intergenic
1032521101 7:132545857-132545879 AGCCACCTCCTGCAGGGTCCAGG - Intronic
1033909465 7:146246832-146246854 TGGCACTTGTAGCAAGCTCCTGG + Intronic
1035471440 7:159112398-159112420 TGGCACTGGCTGCAACCTCCTGG + Intronic
1035880661 8:3241669-3241691 TGGCACTTGTAGCAAGCTCCTGG + Intronic
1036070920 8:5440094-5440116 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1036372134 8:8170864-8170886 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1036472327 8:9062888-9062910 TGGCACTTGTAGCAAGCTCCTGG + Intronic
1036639496 8:10573526-10573548 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1036671480 8:10791435-10791457 TGGCAGCTGCTCCAGGCTCCTGG + Intronic
1036878767 8:12494777-12494799 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1037758155 8:21724742-21724764 TGCCAACTCCTGAATGCTCCTGG - Intronic
1041451307 8:58009341-58009363 TGGTACCTTCTGCAAAATCCAGG - Intronic
1042515231 8:69652197-69652219 TGGCCCCACCTGGATGCTCCAGG + Intronic
1044258612 8:90093657-90093679 TGGCACTTGTAGCAAGCTCCTGG + Intronic
1044417087 8:91950225-91950247 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1046283201 8:112060794-112060816 GTGCTCCTCCTGAAAGCTCCAGG + Intergenic
1046559284 8:115816865-115816887 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1047033970 8:120914361-120914383 GGGCACAGCCTGCAGGCTCCGGG + Intergenic
1047926944 8:129691430-129691452 TGTCACCTTCTGCATGCTTCTGG + Intergenic
1048135474 8:131742978-131743000 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1048143775 8:131821442-131821464 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1048343822 8:133561349-133561371 TGGAACCTCCAGAAAGCTCAAGG - Intronic
1048585417 8:135770594-135770616 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1048728417 8:137411728-137411750 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1048764233 8:137828269-137828291 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1049868815 8:144957712-144957734 TGGCACCTGTAGCAAGCTCCTGG + Intergenic
1050117605 9:2277824-2277846 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1050896077 9:10887024-10887046 TGGCACTTACAGCAAGCTCCTGG - Intergenic
1051849282 9:21489154-21489176 TGGCACTTGCAGCAAACTCCTGG + Intergenic
1051953403 9:22662020-22662042 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1052653337 9:31328672-31328694 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1052720638 9:32167964-32167986 TGGCACTTGCAGCAAGCTCCTGG + Intergenic
1053058035 9:35005746-35005768 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1053150109 9:35737861-35737883 TGGCCCCTCCTGCAAAGGCCTGG + Exonic
1053473440 9:38363776-38363798 TGGCACCCTCTGGAGGCTCCAGG + Intergenic
1054807485 9:69408205-69408227 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1055233065 9:74087921-74087943 TGGCACGTGTAGCAAGCTCCTGG - Intergenic
1055347715 9:75355233-75355255 TGGCACTTGTGGCAAGCTCCTGG + Intergenic
1055626725 9:78183065-78183087 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1055675469 9:78654938-78654960 TGGCTCCTTCTGCAGGCTCTAGG - Intergenic
1055881750 9:81011265-81011287 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1056061162 9:82886015-82886037 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1056721909 9:89079612-89079634 TGGGTCCTGTTGCAAGCTCCAGG - Intronic
1056905418 9:90643137-90643159 TGCCACCTACTGCATGCTCTTGG + Intergenic
1057086063 9:92211488-92211510 TGGCACCAACTGCAAGTTCCAGG - Intronic
1058149537 9:101449218-101449240 CAGCACCTCCTGCAGGCGCCGGG - Intergenic
1058612405 9:106790455-106790477 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1059574624 9:115475617-115475639 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1060318465 9:122534086-122534108 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1061363230 9:130156894-130156916 TGGCTCCTCCTCCCAGCTCATGG + Intergenic
1061589390 9:131588823-131588845 TGCCACCTCCAGCCAGCCCCTGG - Exonic
1061615116 9:131774326-131774348 TGGCCCCACCTGCAAGTACCTGG - Intergenic
1062113907 9:134797320-134797342 TGGCACCTTCTGGAAGCTCTAGG + Intronic
1062144998 9:134984217-134984239 TGGCTCCTCCTGGAAGCTTCAGG - Intergenic
1062149612 9:135010937-135010959 AGCCACCTCCTCCATGCTCCTGG + Intergenic
1062249318 9:135586338-135586360 TGGCTCCTCCCGGAGGCTCCAGG - Intergenic
1185819136 X:3184864-3184886 TGACACCTCCAGCAGGCTCCTGG - Intergenic
1185858426 X:3556576-3556598 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1185991064 X:4893850-4893872 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1186784071 X:12942081-12942103 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1187086519 X:16048139-16048161 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1187099954 X:16182609-16182631 TGGCACTTTTAGCAAGCTCCTGG + Intergenic
1188552655 X:31379763-31379785 TGGCACTTGTAGCAAGCTCCTGG - Intronic
1189112862 X:38311766-38311788 AGGCACCTCCTGCTAGCAACTGG - Intronic
1192706146 X:73529924-73529946 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1193885932 X:86984064-86984086 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1194186245 X:90776769-90776791 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1194209605 X:91055401-91055423 TTCCACCTCCTCCAAGCCCCTGG - Intergenic
1194308537 X:92276510-92276532 TGGCACTTGTAGCAAGCTCCTGG + Intronic
1194502978 X:94702270-94702292 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1194660692 X:96626285-96626307 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1195841489 X:109180680-109180702 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1195908674 X:109868666-109868688 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1196227214 X:113180251-113180273 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1196300015 X:114042242-114042264 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1196572502 X:117281418-117281440 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1196773850 X:119321216-119321238 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1196992682 X:121346440-121346462 TGGCACTTGTGGCAAGCTCCTGG + Intergenic
1197470966 X:126865362-126865384 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1197862472 X:130985108-130985130 TGTCACCTGCTCCATGCTCCTGG + Intergenic
1197945099 X:131830525-131830547 TGGGACCTCCAGCAAGCACATGG + Intergenic
1198522443 X:137466678-137466700 TGGCAAGTCCTGTCAGCTCCTGG + Intergenic
1198599396 X:138267760-138267782 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1198965927 X:142228809-142228831 TGGCACTTGTAGCAAGCTCCTGG - Intergenic
1198983753 X:142427016-142427038 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1200036941 X:153337155-153337177 TGGCACCCCTTGGAAGCTTCTGG + Intronic
1200532835 Y:4358848-4358870 TGGCACTTGTAGCAAGCTCCTGG + Intergenic
1201288991 Y:12404081-12404103 TGCCACCTCCTGCTAGCATCTGG - Intergenic