ID: 966854134

View in Genome Browser
Species Human (GRCh38)
Location 3:184182652-184182674
Sequence GGCACCTCCTGCAAGCTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 662
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 621}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966854131_966854134 -6 Left 966854131 3:184182635-184182657 CCACTTCTCCTTGTTCTGGCACC 0: 1
1: 0
2: 1
3: 25
4: 320
Right 966854134 3:184182652-184182674 GGCACCTCCTGCAAGCTCCTGGG 0: 1
1: 0
2: 1
3: 39
4: 621
966854129_966854134 -1 Left 966854129 3:184182630-184182652 CCTGACCACTTCTCCTTGTTCTG 0: 1
1: 0
2: 4
3: 15
4: 228
Right 966854134 3:184182652-184182674 GGCACCTCCTGCAAGCTCCTGGG 0: 1
1: 0
2: 1
3: 39
4: 621
966854128_966854134 22 Left 966854128 3:184182607-184182629 CCATAGCAAGTGGTTAGCAGGGT 0: 1
1: 0
2: 0
3: 4
4: 102
Right 966854134 3:184182652-184182674 GGCACCTCCTGCAAGCTCCTGGG 0: 1
1: 0
2: 1
3: 39
4: 621
966854125_966854134 30 Left 966854125 3:184182599-184182621 CCAAGTTTCCATAGCAAGTGGTT 0: 1
1: 0
2: 1
3: 12
4: 158
Right 966854134 3:184182652-184182674 GGCACCTCCTGCAAGCTCCTGGG 0: 1
1: 0
2: 1
3: 39
4: 621

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966854134 Original CRISPR GGCACCTCCTGCAAGCTCCT GGG Intronic
900136040 1:1117232-1117254 GGCCCGTCCTGCATGCGCCTTGG + Intergenic
900722535 1:4186684-4186706 GGCACTTGCAGCCAGCTCCTGGG + Intergenic
900782884 1:4629296-4629318 GGGTCCTCTTCCAAGCTCCTAGG - Intergenic
900840792 1:5047106-5047128 GGCACGTGTAGCAAGCTCCTGGG - Intergenic
900847479 1:5115381-5115403 GGCACGTGTAGCAAGCTCCTGGG - Intergenic
901451723 1:9340074-9340096 TGCATTTCCAGCAAGCTCCTGGG + Intronic
901652665 1:10752087-10752109 GGCAGCCCGTGCTAGCTCCTTGG - Intronic
901759037 1:11458895-11458917 GGCGCCTCCTGCCCCCTCCTGGG + Intergenic
902714385 1:18262374-18262396 GGCATCTGCTGCAAGCTCAGAGG + Intronic
904093975 1:27963492-27963514 CGCAGCTCCTGCACGCACCTAGG - Exonic
904237470 1:29124246-29124268 GCCTCCTCCTGGAAGCTCCCCGG - Intergenic
904484602 1:30816413-30816435 CCCCCCTCCTGCAGGCTCCTGGG - Intergenic
904656600 1:32053232-32053254 GGCAGCTCCTCCAGGCTCCCTGG - Intronic
904996476 1:34635409-34635431 GGCACGTGTAGCAAGCTCCTGGG + Intergenic
905060515 1:35135782-35135804 GGCACTTCTAGCAAGCTCCTGGG + Intergenic
905499785 1:38427340-38427362 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
906080924 1:43087767-43087789 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
906213281 1:44024171-44024193 AGGACCTCCTGCCAGCTGCTTGG - Intronic
906797340 1:48708587-48708609 GGCACCTACTGAAATCTTCTAGG + Intronic
907238891 1:53069837-53069859 GGCACCCCCTGCAGGCACCATGG + Exonic
907337627 1:53710690-53710712 AGCTCCTCCTGCAGGCTCCCTGG + Intronic
907503562 1:54901312-54901334 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
908456572 1:64310113-64310135 GGCACTTGCTCCAAACTCCTAGG - Intergenic
908852409 1:68388524-68388546 GGCACATGTAGCAAGCTCCTGGG - Intergenic
909035479 1:70590563-70590585 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
909776687 1:79492014-79492036 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
909788263 1:79642176-79642198 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
910049386 1:82957575-82957597 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
910108157 1:83653651-83653673 GGCCCCTCTTACAAGCTTCTAGG + Intergenic
911147982 1:94570310-94570332 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
911759777 1:101601486-101601508 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
912296480 1:108475210-108475232 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
912813570 1:112811698-112811720 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
913142354 1:115954082-115954104 GGTTCCTCCTGGAAGCTCCAGGG - Intergenic
914256465 1:145964063-145964085 TCCACTTCCTGCGAGCTCCTTGG - Intronic
914941102 1:152023616-152023638 GGCATCCACTGCAAGGTCCTGGG - Intergenic
915979027 1:160408692-160408714 GGCACCTGGTGCCAGCTCCTGGG + Intronic
917525143 1:175781735-175781757 TGCATCTCCAACAAGCTCCTGGG - Intergenic
918116731 1:181504283-181504305 GGCACTTCCTGGAAACTCCTGGG - Intronic
918347122 1:183615906-183615928 GGCACGTGTAGCAAGCTCCTGGG - Intergenic
918567666 1:185951751-185951773 GGCACGTGTAGCAAGCTCCTGGG + Intronic
918714400 1:187768948-187768970 GGCACGTGTAGCAAGCTCCTGGG + Intergenic
919476404 1:198037052-198037074 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
919920264 1:202163099-202163121 GCCAGCTCCTCCCAGCTCCTCGG - Intergenic
920832589 1:209478965-209478987 GGCCACTCCTGCAAACCCCTAGG - Intergenic
920849217 1:209617437-209617459 GGCACCTTCCGCAAGCTGCTGGG + Exonic
920965301 1:210696263-210696285 GGCCCCTCCTCCAGCCTCCTAGG + Intronic
921732968 1:218597244-218597266 GGCACGTGTAGCAAGCTCCTGGG + Intergenic
922363540 1:224843908-224843930 GGCACTTGAAGCAAGCTCCTGGG + Intergenic
922877088 1:228948494-228948516 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
922955301 1:229594397-229594419 GGCTCCTCCAGCGAGCTCGTGGG - Exonic
923075211 1:230603488-230603510 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
923214188 1:231833662-231833684 GGCACTTGTAGCAAGCTCCTGGG + Intronic
923244758 1:232120437-232120459 GGCACGTGTAGCAAGCTCCTGGG - Intergenic
923770731 1:236935706-236935728 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
924378007 1:243433466-243433488 GGCAGCACCTGCCATCTCCTGGG + Intronic
1063363173 10:5473370-5473392 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1063647136 10:7896370-7896392 AGGACCTCCTCCAAGTTCCTGGG - Intronic
1064347765 10:14548357-14548379 TGCACCTCCTGCCAGCTCCAGGG + Intronic
1064663807 10:17630297-17630319 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1064886989 10:20122612-20122634 GGCACTTGTAGCAAGCTCCTGGG + Intronic
1065437636 10:25718705-25718727 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1066646229 10:37612679-37612701 GGCACATGCTGCCAGTTCCTTGG + Intergenic
1067177422 10:43959932-43959954 GGCTCCTCCTCCAAGGTCATGGG + Intergenic
1067360410 10:45573471-45573493 GGCACCTGAAGCAAGTTCCTGGG - Intronic
1067697318 10:48545323-48545345 GGAAACTCCTGCAGGCTCCCTGG - Intronic
1069160322 10:65084474-65084496 GCCCCTTCCTGCAGGCTCCTAGG + Intergenic
1069569353 10:69485009-69485031 GGGAGCTCCTACCAGCTCCTAGG - Intronic
1069746325 10:70717245-70717267 AGCACCCCCTCTAAGCTCCTTGG - Intronic
1070723482 10:78772602-78772624 GGCGCTTCCAACAAGCTCCTGGG + Intergenic
1071110558 10:82150264-82150286 TGCAACACCTGCCAGCTCCTGGG - Intronic
1072011271 10:91304940-91304962 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1072580266 10:96734471-96734493 GGCACGTGTAGCAAGCTCCTGGG - Intergenic
1073124560 10:101141371-101141393 GGCAGCTCCTGCCAGTTGCTTGG - Intergenic
1073453272 10:103621960-103621982 CGCTCCTCCTGCCAGCTCCACGG - Intronic
1074019034 10:109564624-109564646 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1074740785 10:116482912-116482934 GGCACTTGCAGCAAGCTCCTGGG - Intergenic
1075248704 10:120847107-120847129 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1075921204 10:126215021-126215043 GGCACCTGGTCCAAGCCCCTGGG + Intronic
1076607903 10:131701352-131701374 GGCTCCTCCTGGAGGCTCCAGGG + Intergenic
1076875160 10:133212370-133212392 GGCACCTCCTGCACCATCCCGGG + Intronic
1077096432 11:801058-801080 GGCCCCTCCTGCAGCCACCTGGG - Exonic
1077117180 11:890425-890447 GCCAGCTCCTGCAAGCCCCGTGG - Intronic
1077343839 11:2037475-2037497 GCCACCTCTCCCAAGCTCCTGGG - Intergenic
1077612190 11:3650194-3650216 GGCACTTGTAGCAAGCTCCTGGG - Intronic
1077766377 11:5163737-5163759 GGCACTTGTAGCAAGCTCCTGGG + Intronic
1079023065 11:16924833-16924855 GGCAACGCCGGCAAGCTCCTAGG - Intronic
1079105794 11:17571550-17571572 GGCAATTCCTGAAAACTCCTTGG - Intronic
1079230519 11:18645288-18645310 GGCACTTGCAGCAAGCTCCTGGG - Intergenic
1079341380 11:19614293-19614315 GACACCTCCTGGAAACCCCTTGG + Intronic
1079727067 11:23890635-23890657 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1079847684 11:25490672-25490694 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1080027910 11:27632537-27632559 GGCACTTGTGGCAAGCTCCTGGG + Intergenic
1081876418 11:46411393-46411415 GGGACCTCCTGGGACCTCCTGGG - Intronic
1083138639 11:60703523-60703545 GGCACCTTCTGGGAGCTCATCGG - Intronic
1083203233 11:61132378-61132400 GGCATCGCCGGCCAGCTCCTGGG + Exonic
1083584194 11:63844885-63844907 GGAACCTCATGGAAGCTCCTGGG - Intronic
1084232309 11:67761942-67761964 GGCACTTGTGGCAAGCTCCTGGG - Intergenic
1084245593 11:67854861-67854883 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1084355559 11:68635970-68635992 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1084613268 11:70217730-70217752 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1085018048 11:73188266-73188288 GGCACCCCCTGCTAGTTTCTTGG - Intergenic
1085844659 11:80051385-80051407 TTCATTTCCTGCAAGCTCCTAGG + Intergenic
1085988021 11:81808473-81808495 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1086134829 11:83435034-83435056 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1086136263 11:83446356-83446378 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1086177409 11:83908067-83908089 GGCATCTCCTGAGAGCTCATTGG + Intronic
1086550218 11:88045450-88045472 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1086553453 11:88081478-88081500 GGCTCCTCCTGGAAGCTCTAAGG + Intergenic
1087076931 11:94134227-94134249 GTCACCTTGTGCAAGCTGCTGGG + Intronic
1087099105 11:94347978-94348000 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1087099648 11:94351911-94351933 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1087314681 11:96590183-96590205 GGCACGTGTAGCAAGCTCCTGGG - Intergenic
1087839535 11:102907532-102907554 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1088076916 11:105861082-105861104 GGCACCTGGTCCAAGCACCTGGG - Intronic
1088651485 11:111961119-111961141 GGAGCCTCCTGCAAACTCCTGGG - Intronic
1088977393 11:114828007-114828029 GGCTCCTCCAGCCACCTCCTAGG + Intergenic
1089348276 11:117805902-117805924 AGCATCTCCTGCAAGTGCCTAGG + Intronic
1089682951 11:120129673-120129695 GGGACCTCCTGCAGGCACCCGGG + Intronic
1089867043 11:121641377-121641399 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1090107593 11:123869051-123869073 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1090526802 11:127546185-127546207 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1090546483 11:127772529-127772551 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1090926932 11:131257942-131257964 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1202826825 11_KI270721v1_random:92664-92686 GCCACCTCTCCCAAGCTCCTGGG - Intergenic
1091831082 12:3551573-3551595 GCCTCCTCCTGACAGCTCCTTGG - Intronic
1091841199 12:3622155-3622177 AACACCTCCTTCAAGCCCCTAGG + Intronic
1091886523 12:4020789-4020811 GGCACGTGTAGCAAGCTCCTGGG - Intergenic
1092219634 12:6703976-6703998 CGCAACTCCTGCCACCTCCTGGG + Intergenic
1092416171 12:8291992-8292014 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1092592748 12:9966520-9966542 GGCACTTTTAGCAAGCTCCTGGG + Intronic
1092739317 12:11613148-11613170 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1092789715 12:12060651-12060673 GGCACTTGTAGCAAGCTCCTCGG - Intronic
1092924848 12:13263424-13263446 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1093321981 12:17723731-17723753 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1093358441 12:18197209-18197231 GGCACTTGTAGCAAGCTCCTGGG - Intronic
1093578822 12:20765635-20765657 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1093584512 12:20820455-20820477 GGCACTTGTAGCAAGCTCCTGGG + Intronic
1093812830 12:23509465-23509487 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1093951076 12:25165406-25165428 GGCACTTGTAGCAAGCTCCTGGG - Intronic
1094089459 12:26631960-26631982 GGCACATCCGGCACGCTCATGGG + Exonic
1094427193 12:30328013-30328035 GGCAGATCCTGCCTGCTCCTGGG - Intergenic
1094825760 12:34267896-34267918 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1095145364 12:38720884-38720906 GGCAGCTCCTGCCTGCTCCATGG - Intronic
1095637659 12:44452055-44452077 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1096961856 12:55587324-55587346 GACTCCTCCAGAAAGCTCCTAGG + Intergenic
1097479808 12:60108873-60108895 GACACCTCCCTCAAGCTCCCAGG + Intergenic
1098429420 12:70403275-70403297 AGCAACCCTTGCAAGCTCCTGGG - Intronic
1098919911 12:76293718-76293740 GGCACTTGAAGCAAGCTCCTTGG - Intergenic
1099188720 12:79542118-79542140 GGCACGTGTAGCAAGCTCCTGGG - Intergenic
1099292096 12:80786530-80786552 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1099537046 12:83857764-83857786 CGCTGCCCCTGCAAGCTCCTTGG - Intergenic
1099695536 12:86014388-86014410 GGCATCTGCTTGAAGCTCCTAGG - Intronic
1100940302 12:99717446-99717468 GGCACTTGTAGCAAGCTCCTGGG - Intronic
1102229463 12:111252490-111252512 GAGACCTCTTGCAAGCTCCCTGG - Intronic
1102520011 12:113472235-113472257 GGCAACTTCTGCAAGTTCCAGGG - Intronic
1102648538 12:114419780-114419802 GGCTCCTTCTCCAGGCTCCTGGG - Intergenic
1104958743 12:132478272-132478294 GGTTCCTCCTGGAGGCTCCTGGG - Intergenic
1104976497 12:132554269-132554291 GGCACCTCCTCCAAGTGCCGGGG - Intronic
1106691562 13:32122793-32122815 GACTCCTCCAGAAAGCTCCTAGG + Intronic
1107220290 13:37972629-37972651 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1107821334 13:44288519-44288541 GGCTCCTCCTTCAAGCTGCTAGG - Intergenic
1108202701 13:48058656-48058678 GGCACTTATAGCAAGCTCCTGGG - Intronic
1108952942 13:56115871-56115893 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1109499299 13:63215382-63215404 GGCACTTATAGCAAGCTCCTAGG - Intergenic
1110246396 13:73329509-73329531 TGCATCTCCAGCAAGTTCCTAGG - Intergenic
1110845347 13:80185931-80185953 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1111126039 13:83911734-83911756 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1111362102 13:87189880-87189902 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1111458835 13:88516278-88516300 GGCACGTGTAGCAAGCTCCTGGG + Intergenic
1111631697 13:90852040-90852062 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1112236833 13:97644575-97644597 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1113324342 13:109267606-109267628 GGCACTTGCAGCAAGCTCCTGGG - Intergenic
1113867467 13:113536661-113536683 TGCACCTGCTGCCAGCTGCTTGG + Intronic
1113910493 13:113839069-113839091 GCCTCCTCCTGCAAGCACATGGG - Intronic
1114441355 14:22750961-22750983 GGCACCTGCCGCCACCTCCTAGG + Intergenic
1114623824 14:24115538-24115560 GGCTCCTCCTGTCACCTCCTTGG - Exonic
1115240597 14:31248796-31248818 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1116702400 14:48258835-48258857 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1116703284 14:48265827-48265849 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1117801189 14:59446315-59446337 GGCACTTGTAGCAAGCTCCTGGG - Intronic
1119022438 14:71126585-71126607 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1119317207 14:73705750-73705772 GGCACGTGTAGCAAGCTCCTGGG - Intergenic
1120251388 14:82064534-82064556 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1120438046 14:84503658-84503680 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1120539553 14:85736426-85736448 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1120618261 14:86733608-86733630 GGCACTTGTTGCAAGCTCTTGGG - Intergenic
1120659950 14:87238490-87238512 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1121668702 14:95691862-95691884 GGCACCCCATCCAAGCTGCTGGG - Intronic
1123103908 14:105827514-105827536 GACTCCTCCAGAAAGCTCCTAGG - Intergenic
1123114329 14:105887085-105887107 GGCACCTGCTGGCAGCTCCTGGG - Intergenic
1123120766 14:105915372-105915394 GGTACCTGCTGGCAGCTCCTGGG - Intergenic
1123403480 15:20006935-20006957 GGTACCTGCTGGCAGCTCCTGGG - Intergenic
1123512818 15:21013589-21013611 GGTACCTGCTGGCAGCTCCTGGG - Intergenic
1123882488 15:24689032-24689054 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1124038403 15:26078050-26078072 TGCACTTCTAGCAAGCTCCTAGG + Intergenic
1125131511 15:36289094-36289116 GGCACGTGTAGCAAGCTCCTGGG + Intergenic
1125213212 15:37239648-37239670 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1125679375 15:41521217-41521239 GGAACTTCCTGGAGGCTCCTAGG + Intronic
1126530149 15:49702589-49702611 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1126599831 15:50417633-50417655 GGCAGCTGCTGCATGGTCCTGGG - Intergenic
1126843753 15:52740846-52740868 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1128136340 15:65266461-65266483 GACCCCACCTGCAAACTCCTAGG + Intronic
1128620056 15:69141352-69141374 GGCACATCCTCGAAGCTCCCAGG - Intergenic
1129842252 15:78751111-78751133 GGCTCCTCCTGGCAGCGCCTGGG - Intergenic
1130305587 15:82710356-82710378 GCCACCTCCAGGAAGCTCCTCGG - Intergenic
1130383739 15:83393691-83393713 GGAACCTCCTGGAGGCTCCAAGG + Intergenic
1130443175 15:83975502-83975524 GGCACTTCCTGCAGGGTCCCAGG + Intronic
1130734627 15:86535392-86535414 GGCTACTACAGCAAGCTCCTGGG + Intronic
1130882159 15:88064697-88064719 GGCTCTTCTTGAAAGCTCCTTGG - Intronic
1130937105 15:88479939-88479961 GGCAGCTCCTGCCAGGTTCTAGG - Exonic
1131311322 15:91292922-91292944 GGTTCCTCCAGAAAGCTCCTTGG + Exonic
1131447754 15:92513770-92513792 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1132263020 15:100442546-100442568 GGCACTTGTAGCAAGCTCCTGGG - Intronic
1132340418 15:101074796-101074818 GGCACTTGTAGCAAGCTCCTGGG - Intronic
1132505741 16:307809-307831 GGCACGTCCTGCTAGCTTATCGG + Intronic
1133380276 16:5324145-5324167 GGCATCACCTGGAAGCTCCTTGG + Intergenic
1133766758 16:8843533-8843555 GGCACGTGTAGCAAGCTCCTGGG + Intronic
1137930228 16:52580142-52580164 GGCGCCACCTGGAAGCTCATTGG + Intergenic
1138759097 16:59521081-59521103 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1138804955 16:60081092-60081114 GGCACGTGTAGCAAGCTCCTAGG - Intergenic
1139039231 16:62982596-62982618 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1139230596 16:65278702-65278724 GGCACGTGTAGCAAGCTCCTGGG + Intergenic
1139463024 16:67137742-67137764 GGCTCCTCCTGCTGTCTCCTGGG - Intronic
1139544836 16:67645265-67645287 GGCATCTCCTGTGAGCTCCGAGG + Exonic
1139943716 16:70624234-70624256 GGCACGTGTAGCAAGCTCCTGGG + Intronic
1140094283 16:71861654-71861676 GGCAGCTGATGCATGCTCCTTGG - Intronic
1141357303 16:83359468-83359490 TCCAACTCCTGCAAGCTGCTGGG - Intronic
1141633410 16:85301288-85301310 GGCAGCTCCTGCCAGCTGCCTGG - Intergenic
1141986359 16:87582809-87582831 GGCAGCTCCTGCAAGCTCACGGG - Intergenic
1144424015 17:15124127-15124149 GTCAAGTCCTGCAAGCTCATAGG + Intergenic
1145933597 17:28702514-28702536 GGCAGCGTGTGCAAGCTCCTTGG + Exonic
1146664869 17:34692703-34692725 GTGACCTCCTGCAAGTGCCTGGG - Intergenic
1146837579 17:36124961-36124983 GGGTCCTCCTGCAGGCTCTTTGG + Intergenic
1147189187 17:38729167-38729189 GGCTCCCCCTGCCAGCTTCTAGG + Exonic
1147469739 17:40648130-40648152 GGCACCTCCCGCCACTTCCTCGG - Exonic
1147590828 17:41682454-41682476 GGCACCTCCTCCACGCTTCCTGG + Intergenic
1148383842 17:47220389-47220411 TGCCCCTCCTGAGAGCTCCTGGG - Intronic
1148699154 17:49577519-49577541 GGCACCTCCAGGAATCTCCCAGG + Intronic
1148913099 17:50953859-50953881 AGCACCTCCTTCAAGCTCCAGGG + Intergenic
1149455604 17:56785737-56785759 GTGACCTTCTGGAAGCTCCTAGG + Intergenic
1149986565 17:61352216-61352238 GGCCCCTCCTGGGAGCCCCTTGG + Intronic
1150535907 17:66040619-66040641 GGCACATGCTGCCAGCTACTCGG - Intronic
1151187345 17:72373983-72374005 CCCACATCCTGCCAGCTCCTGGG + Intergenic
1151286193 17:73113364-73113386 GGGTCCTCCTCCAAGCCCCTGGG + Intergenic
1151622494 17:75254834-75254856 GGCACTTGTAGCAAGCTCCTGGG - Intronic
1151656549 17:75498898-75498920 GCCACCTCCTGCAGGCTGCTGGG + Exonic
1151839750 17:76609404-76609426 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1151882014 17:76901642-76901664 GTCACCTCCTTTAAGATCCTGGG + Intronic
1152579256 17:81158870-81158892 ACCACCTCCTGGAAGCTCCCTGG + Intronic
1152630859 17:81410170-81410192 GGCAGCTCGTGCAGGCTCCTAGG - Intronic
1152890770 17:82880581-82880603 GCCTCCTCCTGCCAGATCCTTGG - Intronic
1155173824 18:23286300-23286322 GGCACTTGTAGCAAGCTCCTGGG - Intronic
1155697011 18:28696550-28696572 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1155941553 18:31806065-31806087 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1156958184 18:42993134-42993156 GGCACTTGTAGCAAGCTCCTGGG - Intronic
1157906386 18:51573488-51573510 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1158394639 18:57070076-57070098 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1159983979 18:74820251-74820273 GGGGCCTGCTCCAAGCTCCTGGG - Intronic
1160536737 18:79598438-79598460 CCCACCTCCTGCAGGCTCCAGGG + Intergenic
1160786407 19:901936-901958 GGCGCCTCCTGGGGGCTCCTGGG - Intronic
1160842923 19:1154502-1154524 TGCAGCTCCTGCTACCTCCTGGG + Intronic
1161331568 19:3690907-3690929 CTCAGCTCCTGCAAGCTCCGTGG - Intronic
1161661723 19:5550731-5550753 GGCACGTGTAGCAAGCTCCTGGG - Intergenic
1162646870 19:12056419-12056441 GGCTCCTTTTGCAAACTCCTGGG - Intergenic
1165264316 19:34647361-34647383 GGCCCTTTCTGCAGGCTCCTTGG + Intronic
1165309682 19:35022644-35022666 GCCAACTCCTGCAGGCTTCTGGG - Intronic
1165497000 19:36158867-36158889 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1165510313 19:36262933-36262955 GGCACTTATAGCAAGCTCCTGGG + Intergenic
1165835363 19:38751871-38751893 GGCACTTGTAGCAAGCTCCTGGG - Intronic
1167902154 19:52630032-52630054 GGCACTTGTAGCAAGCTCCTGGG - Intronic
1168227981 19:55010233-55010255 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
926303596 2:11621126-11621148 AGCACCCCCTACAAGGTCCTTGG - Intronic
926407775 2:12572017-12572039 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
928827651 2:35440547-35440569 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
928857174 2:35815341-35815363 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
929793060 2:45037885-45037907 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
930487359 2:52025563-52025585 GGCACTTGTAGCAAGCTCCTAGG + Intergenic
931026388 2:58116865-58116887 GGCACTTGTAGCAAGCTCCTGGG + Intronic
931042619 2:58315957-58315979 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
931236945 2:60419872-60419894 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
931455599 2:62407685-62407707 GGCACCTGCTGCAGGCTTCAGGG - Intergenic
931608921 2:64078619-64078641 GGCACTTGTGGCAAGCTCCTGGG + Intergenic
931850429 2:66246192-66246214 GGCACTTGTAGCAAGCTCCTTGG - Intergenic
931948261 2:67333858-67333880 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
932358814 2:71088493-71088515 GGCACTTGCAGCAAACTCCTGGG + Intergenic
932572733 2:72946429-72946451 GACACCCACTGCATGCTCCTCGG + Intronic
933013096 2:77090637-77090659 GGCACTTGTAGCAAGCTCCTGGG - Intronic
933079276 2:77967370-77967392 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
933163736 2:79053648-79053670 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
933179764 2:79215268-79215290 GGCACTTGTAGCAAGCTCCTGGG + Intronic
933329516 2:80877916-80877938 GGCACATGTAGCAAGCTCCTGGG + Intergenic
933552389 2:83792359-83792381 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
934937993 2:98479050-98479072 GGCACTTCCTCCCGGCTCCTGGG + Intronic
935954364 2:108360994-108361016 GACTCCTCCAGAAAGCTCCTTGG + Intergenic
936794289 2:116187718-116187740 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
936883339 2:117281002-117281024 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
937231324 2:120399620-120399642 GTCACTTCCCGCAAGTTCCTCGG - Intergenic
937318161 2:120945121-120945143 GGCACTGCCTGCAGCCTCCTGGG + Intronic
939083134 2:137686393-137686415 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
939307417 2:140428400-140428422 GGCACTTGTAGCAAGCTCCTGGG - Intronic
940530193 2:154869582-154869604 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
940675799 2:156723518-156723540 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
941340404 2:164298116-164298138 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
942563462 2:177244512-177244534 GGCACCTCCTCCATGCTGCCTGG - Intronic
942730287 2:179055205-179055227 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
943412927 2:187563928-187563950 GGCACTTGTAGCAAGCTCCTGGG + Intronic
943421580 2:187673927-187673949 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
943461188 2:188172654-188172676 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
943806655 2:192132684-192132706 GGCACTTGTAGCAAGCTCCTGGG - Intronic
943951283 2:194134328-194134350 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
944876127 2:203965366-203965388 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
945301480 2:208219686-208219708 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
946215026 2:218177481-218177503 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
946427677 2:219608189-219608211 TGCACCTCCAGCCAGCTCCCAGG + Exonic
946781040 2:223193290-223193312 GGCACTTGTAGCAAGCTCCTGGG + Intronic
946886502 2:224227551-224227573 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
946893278 2:224298936-224298958 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
948193161 2:236075637-236075659 AGCAGCTCCTCAAAGCTCCTGGG - Intronic
948509901 2:238457202-238457224 GGAACCTCCTGCCAAATCCTAGG + Intergenic
948806217 2:240454358-240454380 GGCACGTCCAGCAGCCTCCTGGG - Intronic
948897270 2:240933317-240933339 CGGGCATCCTGCAAGCTCCTGGG + Intronic
1168867312 20:1098596-1098618 AGCTCCTCCAGCAAGCTCCAAGG - Intergenic
1169275049 20:4228095-4228117 TTGACCTCCTGCCAGCTCCTTGG + Intronic
1170820697 20:19754595-19754617 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1171179848 20:23084498-23084520 GTCCCCACCTGCAGGCTCCTGGG + Exonic
1172192760 20:33071856-33071878 GGCACTTCTTCCAAGCTCATGGG + Intronic
1172302930 20:33862794-33862816 GGCGCCACCTGCAGGCCCCTGGG - Intergenic
1172910993 20:38408654-38408676 GGTACCTCCTGTTTGCTCCTTGG - Intergenic
1172983690 20:38964871-38964893 GGCACCTCCTCTAAGCTCCCAGG - Intronic
1173763771 20:45587646-45587668 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1174498240 20:50964974-50964996 GCCATCTCCTTCAAGCTTCTTGG - Intergenic
1175549971 20:59811137-59811159 GGCAGCTTCTGCAAGCTACGTGG - Intronic
1175905481 20:62377574-62377596 GGCTCCTGGTGCAGGCTCCTGGG + Intergenic
1177031168 21:15983241-15983263 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1177100628 21:16894437-16894459 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1177102678 21:16916249-16916271 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1178001205 21:28163475-28163497 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1178583538 21:33855291-33855313 GGCATCTCTAGCAAGCTCCTAGG + Intronic
1179557661 21:42190740-42190762 GGCGCCTGCCGCAAGCTGCTGGG + Intergenic
1179650362 21:42804476-42804498 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1180123197 21:45767799-45767821 GGCACCACCTGCAGGGGCCTGGG - Intronic
1180210940 21:46295335-46295357 GGCACCTCCCGCCAGCCCCAAGG + Intronic
1182667882 22:31972465-31972487 GGCACCTCCTGGAAGGGCCCGGG - Intergenic
1183547023 22:38459918-38459940 CTCACCCCCTGGAAGCTCCTGGG - Intergenic
1184158261 22:42683124-42683146 GGCACCCCCTCCAAGCTTCTAGG + Intergenic
1184865219 22:47198380-47198402 AGCACCTCGTGCAGGCCCCTGGG - Intergenic
1185072942 22:48667190-48667212 GGCTCCTCCTGCAGGCCGCTCGG - Intronic
949190392 3:1243261-1243283 GGCACTTGTAGCAAGCTCCTGGG + Intronic
949827446 3:8179277-8179299 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
949949082 3:9214377-9214399 GTGACCTTCGGCAAGCTCCTTGG - Intronic
950097821 3:10340212-10340234 GGCACCTCCTGCGACCTACCAGG + Intronic
950147844 3:10664505-10664527 GGCACCTCTGGAAGGCTCCTTGG + Intronic
950926499 3:16746578-16746600 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
951332323 3:21382012-21382034 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
951611150 3:24494447-24494469 GGCACCTCCTCCCAGATCCGGGG + Intronic
951762791 3:26163819-26163841 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
951888973 3:27551577-27551599 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
952343557 3:32464859-32464881 GGCACTTGTAGCAAGCTCCTGGG + Intronic
952686097 3:36149736-36149758 GGCACCTTCTGAATGCACCTGGG + Intergenic
952827576 3:37537111-37537133 GGCCCCTTCTCCAAGCTCATAGG - Intronic
953077130 3:39581249-39581271 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
953177196 3:40563240-40563262 GGCACTTGTAGCAAGCTCCTGGG - Intronic
953412785 3:42699594-42699616 GGCCCCTCCTGTATCCTCCTGGG - Intronic
953607588 3:44421639-44421661 GGAGCCTCCTGCACACTCCTGGG + Intergenic
953825696 3:46249740-46249762 GGCACTTGTAGCAAGCTCCTCGG + Intronic
955253369 3:57305939-57305961 GGCACTTGTAGCAAGCTCCTGGG - Intronic
955509038 3:59661087-59661109 GGCACCGCATGCATGCACCTTGG - Intergenic
956548985 3:70438312-70438334 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
956709221 3:72025249-72025271 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
957059896 3:75473481-75473503 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
957295238 3:78326063-78326085 GGCACGTGTAGCAAGCTCCTGGG - Intergenic
958771258 3:98428642-98428664 GGCACCTCCTGCCACCTCCTGGG + Intergenic
959485771 3:106926179-106926201 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
959540017 3:107525887-107525909 GGCACCTCCCGCCGTCTCCTGGG + Intronic
959972264 3:112421014-112421036 GGCACGTGTAGCAAGCTCCTGGG + Intergenic
960282874 3:115796955-115796977 GGCACGTGTAGCAAGCTCCTGGG + Intergenic
960310111 3:116108768-116108790 GGCACTTGTAGCAAGCTCCTGGG + Intronic
961711622 3:128832641-128832663 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
961730590 3:128961966-128961988 GGCACTTGTAGCAAGCTCCTGGG - Intronic
962201530 3:133404355-133404377 GACACCTGCTCCAAGCCCCTGGG + Intronic
962205569 3:133431389-133431411 GGCACTTGAAGCAAGCTCCTGGG - Intronic
962660636 3:137597734-137597756 GGCACCTTTAGCAAGCTCCTGGG - Intergenic
963425220 3:145115240-145115262 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
963456658 3:145554625-145554647 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
963663347 3:148153911-148153933 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
963684334 3:148416608-148416630 GGCACATGTAGCAAGCTCCTGGG - Intergenic
964067877 3:152599600-152599622 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
964067900 3:152599703-152599725 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
964125450 3:153230143-153230165 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
964300250 3:155278632-155278654 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
964983638 3:162714662-162714684 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
965262649 3:166504235-166504257 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
965286729 3:166827553-166827575 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
965336331 3:167433475-167433497 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
965624879 3:170675972-170675994 GGCACTTATAGCAAGCTCCTGGG + Intronic
965640037 3:170821408-170821430 GGCACTTATAGCAAGCTCCTGGG + Intronic
965713411 3:171578674-171578696 GGCACGTGTAGCAAGCTCCTGGG - Intergenic
965861967 3:173159358-173159380 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
966085434 3:176063595-176063617 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
966105082 3:176325073-176325095 GGCACTTGCAGCAAGCTCCTGGG + Intergenic
966232845 3:177669289-177669311 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
966355084 3:179071551-179071573 GGCTCGTCCTGAAAGCTCCGCGG + Intronic
966397656 3:179519122-179519144 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
966854134 3:184182652-184182674 GGCACCTCCTGCAAGCTCCTGGG + Intronic
967005359 3:185377982-185378004 GGCACTTGTAGCAAGCTCCTGGG + Intronic
967244164 3:187469721-187469743 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
967496224 3:190146765-190146787 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
967643827 3:191898819-191898841 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
967658104 3:192074535-192074557 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
967740488 3:192997943-192997965 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
968974327 4:3813196-3813218 GGGTCCTCCTGGAAGCTCCCCGG - Intergenic
968993386 4:3929638-3929660 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
969003809 4:4003666-4003688 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
969654097 4:8486232-8486254 GGCACTTGTAGCAAGCTCCTGGG + Intronic
969749058 4:9096519-9096541 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
969810118 4:9641159-9641181 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
970029231 4:11657183-11657205 GGCACATGTAGCAAGCTCCTGGG + Intergenic
970042093 4:11808533-11808555 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
970068255 4:12124097-12124119 GGCCCTTCCTGCAAGATACTAGG + Intergenic
970087550 4:12366022-12366044 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
970532738 4:16999922-16999944 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
970671183 4:18398417-18398439 GGCACCTCCAGCAATCCCCATGG + Intergenic
971335644 4:25721434-25721456 GGCACTTACTGCAGGCTTCTCGG + Intergenic
973751127 4:54022063-54022085 GGCACTTGAAGCAAGCTCCTGGG - Intronic
974177923 4:58347724-58347746 TGCTCCTCCAGCAAGCTTCTTGG - Intergenic
974764342 4:66322757-66322779 GATACCTTCTCCAAGCTCCTAGG + Intergenic
976558573 4:86476847-86476869 GGCACTTGTAGCAAGCTCCTGGG - Intronic
977010318 4:91626347-91626369 GGCACTTGTGGCAAGCTCCTGGG - Intergenic
977012922 4:91658076-91658098 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
977062506 4:92274944-92274966 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
977217152 4:94296669-94296691 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
978001117 4:103557217-103557239 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
978031486 4:103943398-103943420 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
978438613 4:108711284-108711306 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
979146621 4:117254357-117254379 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
979895156 4:126148590-126148612 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
980111924 4:128644308-128644330 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
980388927 4:132120457-132120479 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
980611774 4:135170744-135170766 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
981040246 4:140215751-140215773 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
981041855 4:140230478-140230500 GGCATCTCCTCCAATCTTCTAGG + Intergenic
981236471 4:142421907-142421929 ATCACCTCCTGAAAACTCCTAGG + Intronic
981525212 4:145701357-145701379 GGCACTTGTAGCAAGCTCCTGGG - Intronic
982083965 4:151816056-151816078 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
982414194 4:155111915-155111937 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
983023873 4:162711358-162711380 GGCACTTGTGGCAAGCTCCTGGG - Intergenic
983055490 4:163095345-163095367 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
983345558 4:166522779-166522801 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
983448062 4:167878527-167878549 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
983659574 4:170118711-170118733 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
983707676 4:170679749-170679771 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
983990105 4:174108078-174108100 GGTCCCTCCTCCAAGCTTCTAGG - Intergenic
984099045 4:175464888-175464910 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
984322190 4:178209379-178209401 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
984393612 4:179168343-179168365 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
984437265 4:179722703-179722725 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
985389868 4:189482917-189482939 GGCACGTGTAGCAAGCTCCTGGG + Intergenic
985582357 5:705046-705068 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
985720451 5:1486053-1486075 GACCCCTCCTGGAAGGTCCTGGG - Intronic
985889170 5:2702255-2702277 GGCACCGCCTGGCAGCTCCACGG + Intergenic
986426758 5:7639432-7639454 GGCAGCTCCAGCCATCTCCTTGG - Intronic
986555040 5:9001999-9002021 GGCACTTGCAGCAAGCTCCTGGG + Intergenic
986905776 5:12492058-12492080 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
989217314 5:38918465-38918487 GGCTCCTCCTGCAGGGTCCCAGG + Intronic
990795861 5:59540090-59540112 TGCATCTCCAGCAAGTTCCTAGG + Intronic
992159043 5:73982943-73982965 GCCACCTCCTGCCAGCTGCTGGG + Intergenic
992394664 5:76359611-76359633 GGCACGTGTAGCAAGCTCCTGGG - Intergenic
992960832 5:81955515-81955537 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
993072393 5:83181774-83181796 GACATCTCCTGTAAGCTCATTGG - Intronic
993329084 5:86573937-86573959 GGCTCCTTCTGCAAACTCCTAGG - Intergenic
993836709 5:92826232-92826254 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
994318018 5:98357037-98357059 GGCACTTTCTGCTAGCTTCTAGG + Intergenic
994556940 5:101317193-101317215 GGCACTTGTAGCAAGCTCCTCGG - Intergenic
994775686 5:104033874-104033896 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
995296678 5:110532098-110532120 GGCACTTGTAGCAAGCTCCTGGG - Intronic
995348394 5:111147422-111147444 TGCACCTCCTCCAAGTTTCTCGG - Intergenic
996509901 5:124306050-124306072 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
997746403 5:136303570-136303592 GGCACTTGTAGCAAGCTCCTGGG - Intronic
998713846 5:144857954-144857976 GTCACTTACTGGAAGCTCCTGGG - Intergenic
1000438588 5:161242224-161242246 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1000439723 5:161250749-161250771 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1000519403 5:162278830-162278852 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1000669146 5:164039110-164039132 TGCACTTCCAGAAAGCTCCTAGG - Intergenic
1000935640 5:167301341-167301363 GGCACTTGTAGCAAGCTCCTGGG + Intronic
1000989043 5:167893114-167893136 GGCACCTCCTGTAAGTAACTGGG + Intronic
1001331447 5:170765487-170765509 GGCACTTGTAGCAAGCTCCTGGG + Intronic
1002074234 5:176698532-176698554 GCCACCTCCGGCAAGCCCCAGGG - Intergenic
1002610958 5:180418179-180418201 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1002837427 6:876730-876752 ACCGCCTCCTGCAAGCTCTTCGG - Intergenic
1003317841 6:5027776-5027798 GGCCCCTCCTGAAAACTCCATGG - Intergenic
1003451226 6:6234206-6234228 GACTCCTCCAGAAAGCTCCTAGG + Intronic
1003765248 6:9229378-9229400 GGCATCTCCTCCAAGCTCACTGG + Intergenic
1003891837 6:10570666-10570688 AGCTCCTCCTTCAAGCTCTTTGG + Intronic
1004458037 6:15809930-15809952 GGCTCCTCCTCCAAGCTCTGGGG - Intergenic
1004507994 6:16262446-16262468 GGCACTTGTAGCAAGCTCCTGGG + Intronic
1004768572 6:18757519-18757541 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1004837004 6:19541161-19541183 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1005270478 6:24158412-24158434 GCCAGCTCCTGCTACCTCCTTGG - Intergenic
1006068326 6:31478427-31478449 GTCTCCTCCTGCAGGCTGCTGGG - Intergenic
1007479789 6:42142398-42142420 GGCACCTTCAGCAAACTCTTCGG - Exonic
1008378784 6:50820315-50820337 GGCGCGGCCGGCAAGCTCCTGGG + Intronic
1008543055 6:52562394-52562416 GGCACCTCATACAAGTTACTCGG - Intronic
1010829688 6:80513759-80513781 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1010841312 6:80651251-80651273 GGCACTTCTAGCAAGCTCCTGGG + Intergenic
1010894543 6:81348591-81348613 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1012675101 6:102104213-102104235 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1013407886 6:109859209-109859231 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1014614671 6:123585742-123585764 GGCACTTGTAGCAAGCTCCTGGG + Intronic
1014793989 6:125705315-125705337 GGCACATGTAGCAAGCTCCTGGG + Intergenic
1014837308 6:126174016-126174038 TGCATGTCCAGCAAGCTCCTAGG - Intergenic
1014891546 6:126851010-126851032 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1015096588 6:129421834-129421856 GTCACCTCATGCAAGCACCGTGG - Intronic
1015165222 6:130194600-130194622 GGCACTTGTAGCAAGCTCCTGGG - Intronic
1015220024 6:130794061-130794083 GACACCTTCTCCAAGCTCCCAGG + Intergenic
1015266737 6:131297712-131297734 GGCACATGTAGCAAGCTCCTGGG - Intergenic
1015269659 6:131325659-131325681 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1015278155 6:131405069-131405091 GGCACATGTAGCAAGCTCCTGGG - Intergenic
1015801375 6:137064779-137064801 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1016114139 6:140260864-140260886 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1016204538 6:141455086-141455108 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1016650289 6:146453869-146453891 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1016853271 6:148642056-148642078 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1017519289 6:155187517-155187539 TGCACCTCCTGCAAGAGGCTTGG + Intronic
1018077599 6:160230751-160230773 GGCACTTGTAGCAAGCTCCTGGG - Intronic
1018084494 6:160290025-160290047 GGCACCTGTAGCAAGCTCCTGGG + Intergenic
1018726864 6:166619542-166619564 GTCAGCTCCTGCAGGCACCTGGG - Intronic
1019273340 7:162933-162955 GGGATCTCCTGCAGGGTCCTGGG - Intergenic
1019798210 7:3067756-3067778 GGCACCCACTGCAAGCGCCAGGG - Intergenic
1019812834 7:3177069-3177091 GGTTCCTCCTGCAAGCTCTGAGG - Intergenic
1020323943 7:6960121-6960143 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1020541139 7:9462009-9462031 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1020794216 7:12661823-12661845 GGCACTTGAAGCAAGCTCCTGGG - Intergenic
1021429851 7:20547705-20547727 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1021977893 7:26027641-26027663 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1022372875 7:29787103-29787125 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1022710044 7:32841357-32841379 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1022992314 7:35720599-35720621 GGCAGCCCTTGCAACCTCCTGGG - Intergenic
1023115015 7:36854277-36854299 GGCATCTCCAACAAGCTCCCAGG + Intergenic
1023562177 7:41487672-41487694 GGCACAACCTGCAAGACCCTGGG + Intergenic
1023643166 7:42281902-42281924 GGCACTTTCTGCAGGCTCCCTGG - Intergenic
1024849655 7:53696503-53696525 GGCACCTCCTGGGAGCTGCCTGG - Intergenic
1024980573 7:55154331-55154353 GCCACCACCTGCCCGCTCCTCGG - Intronic
1027551586 7:79604168-79604190 GGCTCATTCTGTAAGCTCCTGGG - Intergenic
1027851947 7:83461921-83461943 GGCACATGTAGCAAGCTCCTGGG - Intronic
1028670512 7:93396187-93396209 GGCACTTGCAGCAAGCTCCTGGG - Intergenic
1028690180 7:93642117-93642139 GGCACTTGCAGCAAGCTCCTGGG - Intronic
1029449549 7:100633203-100633225 AGCACCCCCTGCCCGCTCCTAGG - Intronic
1029474192 7:100773431-100773453 GGAACCTCCTGCGTGCCCCTTGG + Exonic
1029500216 7:100924426-100924448 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1030441685 7:109595480-109595502 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1030751496 7:113237032-113237054 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1031004670 7:116457740-116457762 GGCACGTGTAGCAAGCTCCTGGG - Intronic
1031364744 7:120889066-120889088 AGCACCTGTAGCAAGCTCCTGGG + Intergenic
1031399987 7:121317828-121317850 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1031422453 7:121567433-121567455 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1031685848 7:124731295-124731317 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1031727930 7:125262356-125262378 GGCACTTATAGCAAGCTCCTGGG + Intergenic
1032113667 7:129098798-129098820 TGCACCTGCTGCAAGCTGCTTGG + Intergenic
1032440826 7:131941691-131941713 GGCAGATTCTGCAAGCTCCTTGG - Intergenic
1033599300 7:142877315-142877337 GGGACCCCCTGCAGGATCCTGGG - Intronic
1033675949 7:143540676-143540698 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1033909466 7:146246833-146246855 GGCACTTGTAGCAAGCTCCTGGG + Intronic
1035568528 8:657990-658012 GGCCCCTCCTGGATGCCCCTTGG - Intronic
1035880662 8:3241670-3241692 GGCACTTGTAGCAAGCTCCTGGG + Intronic
1036070921 8:5440095-5440117 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1036372133 8:8170863-8170885 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1036472328 8:9062889-9062911 GGCACTTGTAGCAAGCTCCTGGG + Intronic
1036639495 8:10573525-10573547 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1036878768 8:12494778-12494800 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1036979608 8:13455507-13455529 AGCATCTCCTGCAAGCTATTCGG + Intronic
1037482069 8:19314100-19314122 GCCACCCCCTGCAAGCCCCCAGG - Intronic
1037758154 8:21724741-21724763 GCCAACTCCTGAATGCTCCTGGG - Intronic
1037766550 8:21775761-21775783 CCCACCACCTGCAGGCTCCTTGG + Intronic
1038437409 8:27545647-27545669 GCCACCTCCTCCAAGCCCATAGG + Intergenic
1042453559 8:68975428-68975450 GGCACGTGTAGCAAGCTCCTGGG - Intergenic
1044258613 8:90093658-90093680 GGCACTTGTAGCAAGCTCCTGGG + Intronic
1044417086 8:91950224-91950246 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1044921993 8:97177331-97177353 GGCACATGTAGCAAGCTCCTGGG - Intergenic
1045197523 8:99946126-99946148 GGCACGTGTAGCAAGCTCCTGGG - Intergenic
1046440014 8:114243593-114243615 GGCACGTGTCGCAAGCTCCTGGG - Intergenic
1047033971 8:120914362-120914384 GGCACAGCCTGCAGGCTCCGGGG + Intergenic
1047499747 8:125431657-125431679 GCCAGCTGCTCCAAGCTCCTAGG - Intronic
1047699348 8:127433984-127434006 GGCACATGTAGCAAGCTCCTGGG - Intergenic
1047926945 8:129691431-129691453 GTCACCTTCTGCATGCTTCTGGG + Intergenic
1048135473 8:131742977-131742999 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1048143774 8:131821441-131821463 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1048585418 8:135770595-135770617 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1048728418 8:137411729-137411751 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1048764234 8:137828270-137828292 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1049868816 8:144957713-144957735 GGCACCTGTAGCAAGCTCCTGGG + Intergenic
1050117604 9:2277823-2277845 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1050896076 9:10887023-10887045 GGCACTTACAGCAAGCTCCTGGG - Intergenic
1051849283 9:21489155-21489177 GGCACTTGCAGCAAACTCCTGGG + Intergenic
1051953404 9:22662021-22662043 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1052280184 9:26723927-26723949 GGCCTTTCCTCCAAGCTCCTAGG + Intergenic
1052653336 9:31328671-31328693 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1052720639 9:32167965-32167987 GGCACTTGCAGCAAGCTCCTGGG + Intergenic
1053055416 9:34990687-34990709 GGAAGCTCCGGAAAGCTCCTCGG - Exonic
1053058034 9:35005745-35005767 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1053346657 9:37383277-37383299 GGCACCTCCTGCCAGCTGCAAGG + Intergenic
1054807486 9:69408206-69408228 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1055233064 9:74087920-74087942 GGCACGTGTAGCAAGCTCCTGGG - Intergenic
1055347716 9:75355234-75355256 GGCACTTGTGGCAAGCTCCTGGG + Intergenic
1055626724 9:78183064-78183086 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1055840573 9:80498194-80498216 GGCACGTCCTGCAAAATCCAAGG + Intergenic
1055881749 9:81011264-81011286 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1056044735 9:82704165-82704187 GGCACTTGTAGCAAGCTCCTAGG + Intergenic
1056061161 9:82886014-82886036 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1056323887 9:85460903-85460925 GGCACGTGTCGCAAGCTCCTGGG - Intergenic
1057086062 9:92211487-92211509 GGCACCAACTGCAAGTTCCAGGG - Intronic
1057234848 9:93349862-93349884 GGCACGTGTAGCAAGCTCCTGGG - Intergenic
1057377995 9:94542084-94542106 GGCACTTGTAGCAAGCTCCTTGG - Intergenic
1057812579 9:98269264-98269286 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1058612404 9:106790454-106790476 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1059546156 9:115178073-115178095 GGCACTTGTAGCAAGCTCCTGGG + Intronic
1059574623 9:115475616-115475638 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1060318466 9:122534087-122534109 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1061152330 9:128835950-128835972 ACCACCCCCTGCAAGATCCTTGG - Intronic
1061234716 9:129335726-129335748 GGCACCACCTTCAAGCTTCCTGG + Intergenic
1061406827 9:130396912-130396934 GGCATCTCCAGCACCCTCCTGGG - Intronic
1061615115 9:131774325-131774347 GGCCCCACCTGCAAGTACCTGGG - Intergenic
1061903141 9:133683259-133683281 GGCCACTCCAGCAAGCTGCTGGG - Intronic
1062113908 9:134797321-134797343 GGCACCTTCTGGAAGCTCTAGGG + Intronic
1062144997 9:134984216-134984238 GGCTCCTCCTGGAAGCTTCAGGG - Intergenic
1062591207 9:137275626-137275648 GGCACCCCCTGCAGGCGCCCTGG - Intergenic
1185858427 X:3556577-3556599 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1185991063 X:4893849-4893871 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1186024765 X:5297261-5297283 GGCACCTCCAGGAAGATGCTTGG - Intergenic
1186784070 X:12942080-12942102 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1187086520 X:16048140-16048162 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1187099955 X:16182610-16182632 GGCACTTTTAGCAAGCTCCTGGG + Intergenic
1187922579 X:24219509-24219531 TGCACTTCCTGCAAGCTCCCTGG + Intergenic
1188333017 X:28896043-28896065 GGCACTTGTAGCAAGCTCCTGGG + Intronic
1188419489 X:29977535-29977557 GGCACTTGTAGCAAGCTCCTAGG - Intergenic
1188431028 X:30105601-30105623 GGCACTTGTAGCAAGCTCCTAGG - Intergenic
1188552654 X:31379762-31379784 GGCACTTGTAGCAAGCTCCTGGG - Intronic
1192706145 X:73529923-73529945 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1193885931 X:86984063-86984085 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1194186246 X:90776770-90776792 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1194308538 X:92276511-92276533 GGCACTTGTAGCAAGCTCCTGGG + Intronic
1194351292 X:92826749-92826771 GGCACGTGTAGCAAGCTCCTAGG - Intergenic
1194367109 X:93025191-93025213 GGCACTTGTAGCAAGCTCCTCGG - Intergenic
1194502979 X:94702271-94702293 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1194660691 X:96626284-96626306 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1195841488 X:109180679-109180701 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1195908675 X:109868667-109868689 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1196220983 X:113112170-113112192 GGCACTTGTGGCAAGCTCCTGGG + Intergenic
1196227215 X:113180252-113180274 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1196300014 X:114042241-114042263 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1196496867 X:116333081-116333103 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1196572501 X:117281417-117281439 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1196773851 X:119321217-119321239 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1196992683 X:121346441-121346463 GGCACTTGTGGCAAGCTCCTGGG + Intergenic
1197064919 X:122224293-122224315 GGCACTTATAGCAAGCTCCTCGG - Intergenic
1197470965 X:126865361-126865383 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1197933085 X:131714330-131714352 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1198599397 X:138267761-138267783 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1198965926 X:142228808-142228830 GGCACTTGTAGCAAGCTCCTGGG - Intergenic
1199634466 X:149802555-149802577 GGCACCTCCTGCCAGCTACAAGG + Intergenic
1200532836 Y:4358849-4358871 GGCACTTGTAGCAAGCTCCTGGG + Intergenic
1200659617 Y:5943439-5943461 GGCACGTGTAGCAAGCTCCTAGG - Intergenic