ID: 966854139

View in Genome Browser
Species Human (GRCh38)
Location 3:184182674-184182696
Sequence GCTCTCTCCTTGCTTGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 170}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966854132_966854139 8 Left 966854132 3:184182643-184182665 CCTTGTTCTGGCACCTCCTGCAA 0: 1
1: 0
2: 3
3: 21
4: 234
Right 966854139 3:184182674-184182696 GCTCTCTCCTTGCTTGAAATGGG 0: 1
1: 0
2: 0
3: 17
4: 170
966854129_966854139 21 Left 966854129 3:184182630-184182652 CCTGACCACTTCTCCTTGTTCTG 0: 1
1: 0
2: 4
3: 15
4: 228
Right 966854139 3:184182674-184182696 GCTCTCTCCTTGCTTGAAATGGG 0: 1
1: 0
2: 0
3: 17
4: 170
966854136_966854139 -8 Left 966854136 3:184182659-184182681 CCTGCAAGCTCCTGGGCTCTCTC 0: 1
1: 0
2: 2
3: 36
4: 334
Right 966854139 3:184182674-184182696 GCTCTCTCCTTGCTTGAAATGGG 0: 1
1: 0
2: 0
3: 17
4: 170
966854131_966854139 16 Left 966854131 3:184182635-184182657 CCACTTCTCCTTGTTCTGGCACC 0: 1
1: 0
2: 1
3: 25
4: 320
Right 966854139 3:184182674-184182696 GCTCTCTCCTTGCTTGAAATGGG 0: 1
1: 0
2: 0
3: 17
4: 170
966854135_966854139 -5 Left 966854135 3:184182656-184182678 CCTCCTGCAAGCTCCTGGGCTCT 0: 1
1: 0
2: 3
3: 39
4: 373
Right 966854139 3:184182674-184182696 GCTCTCTCCTTGCTTGAAATGGG 0: 1
1: 0
2: 0
3: 17
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966854139 Original CRISPR GCTCTCTCCTTGCTTGAAAT GGG Intronic
900146707 1:1161788-1161810 GCTCTCTTCTCGCTGGAAACTGG - Intergenic
900860446 1:5225323-5225345 TCTCTCTCTTTCCTTGAACTGGG + Intergenic
902092653 1:13915837-13915859 GCTCACTCCTTGCTTTGATTAGG + Intergenic
903442548 1:23399339-23399361 GCTCTCTCTTTGCTTGTGAATGG + Intronic
904051667 1:27643448-27643470 TCTCTCTCCTTCCTTGACTTTGG + Intergenic
905211157 1:36374998-36375020 GCTTTCTCCTTGCCTGATTTGGG - Intronic
905585903 1:39118110-39118132 GCACTCTCCCTGCTGGAAACTGG - Intronic
907099308 1:51813602-51813624 GCATTTTCCTTGATTGAAATAGG - Intronic
909932827 1:81517592-81517614 TCTTTCTCCTTTCCTGAAATGGG - Intronic
910096546 1:83528964-83528986 GCTCTCTGCTTGCTTGTTGTTGG + Intergenic
913423981 1:118706211-118706233 GCTCTCTGTTTGCCTGTAATTGG + Intergenic
914317369 1:146526508-146526530 TCTCTCTCCTTAATTGTAATAGG - Intergenic
914496987 1:148206852-148206874 TCTCTCTCCTTAATTGTAATAGG + Intergenic
915600415 1:156920152-156920174 GCTCTCTCCTTACTGGACAGCGG + Intergenic
916242199 1:162651217-162651239 GCTCACTCCTTGCTGGCATTTGG + Intronic
917501266 1:175587523-175587545 GTTCTCTCCTTTTTTCAAATTGG + Intronic
917583761 1:176404274-176404296 GCTCTCTCCTTGCCTGTTTTTGG + Intergenic
917673738 1:177299926-177299948 GCCCTCCCCTTGCTTGAAGATGG - Intergenic
918340292 1:183563009-183563031 ACTCTCTCCCTGCTGCAAATGGG + Intronic
919960135 1:202458843-202458865 GCTCACTAATTGTTTGAAATTGG - Intronic
921065977 1:211622078-211622100 GGTCTCTCTTTGCTTGCCATGGG + Intergenic
1066067839 10:31775045-31775067 GCTCTCTCCTTGCTCCAGAGTGG - Intergenic
1066622132 10:37367274-37367296 ACATTTTCCTTGCTTGAAATGGG - Intronic
1072306038 10:94108211-94108233 GCTCCCACCTTGCTTGTGATAGG - Intronic
1072947697 10:99825367-99825389 TCTCTATCATTGCTTTAAATCGG - Intronic
1074981163 10:118621022-118621044 GCTCTCTCCATCCTTGCAATTGG + Intergenic
1075003053 10:118811941-118811963 GCTCTCTCTTTCCTGAAAATGGG - Intergenic
1075488982 10:122849983-122850005 GATCTCTTCTTGCCTGAATTGGG - Intronic
1076483639 10:130801615-130801637 TCACTCTCCTGGCTGGAAATAGG - Intergenic
1078332140 11:10431980-10432002 GCTCTATCCATGATTGAAAGTGG - Intronic
1079032506 11:16996291-16996313 TCTCACTCCTGACTTGAAATAGG - Intronic
1079506608 11:21159818-21159840 GTTCTCCCCTTGCTTGTAATAGG + Intronic
1079969725 11:27021398-27021420 TCTCTCTCCTTACTTGAGTTGGG + Intergenic
1080085896 11:28281512-28281534 GCTCTCTGATTCCTTCAAATGGG + Intronic
1080153991 11:29086532-29086554 GCTCTTACTTTGATTGAAATAGG + Intergenic
1082281294 11:50273921-50273943 GCTCTCTAGTCGCTTGAGATGGG - Intergenic
1083686497 11:64379226-64379248 GCTCTCTCTTTCCTGGACATGGG - Intergenic
1084082214 11:66835200-66835222 TCTTTCTCCTATCTTGAAATTGG - Intronic
1084727456 11:70951060-70951082 CCTCTCTACTTCTTTGAAATGGG - Intronic
1086395241 11:86408911-86408933 ATTCTGTCTTTGCTTGAAATAGG - Intronic
1088517153 11:110649873-110649895 GTTCTCTCATTGAATGAAATAGG + Intronic
1088527177 11:110769736-110769758 GCTCTCTGCTTGCCTGTTATTGG - Intergenic
1089112636 11:116068822-116068844 GCTCTCTCCTTGCTGCAAAGTGG - Intergenic
1094423053 12:30292492-30292514 GCTCTCTCTTTGCCTGTTATTGG - Intergenic
1094696775 12:32827241-32827263 AGACTCTACTTGCTTGAAATGGG + Intronic
1099033784 12:77560470-77560492 GCTTCCTTCTTCCTTGAAATAGG + Intergenic
1100881008 12:99016849-99016871 CCTCTCCCCTTGCTGGAACTGGG + Intronic
1102555013 12:113721015-113721037 ATTCTGTCCTTGCTGGAAATGGG - Intergenic
1103631184 12:122262336-122262358 GCTCTCAGGTTGATTGAAATAGG + Intronic
1103774011 12:123351990-123352012 TCTGTCTACTTGCTTTAAATTGG - Intronic
1104055513 12:125227192-125227214 GCACTGTCCTGGCTTGAAAGGGG + Intronic
1106777767 13:33025176-33025198 TATCTCTCCTTTCTTGAAATAGG - Intronic
1107848391 13:44544309-44544331 GATCTCTCCCTTTTTGAAATTGG - Intronic
1110816996 13:79872626-79872648 GCTCTCTCCTTGCCTGGAACTGG + Intergenic
1113090926 13:106617059-106617081 GCTCTGCCCTTGCTTGAACATGG - Intergenic
1113324917 13:109271746-109271768 CCTGTCTCCTTGCTTGAGAGGGG - Intergenic
1119662155 14:76459834-76459856 GCTCCCTCCCTGCAAGAAATGGG + Intronic
1120019360 14:79510871-79510893 GCCCTCTCCCTGCTTGAGCTGGG - Intronic
1121562546 14:94885891-94885913 GCTCCCTCCTTGCCAGAAATGGG + Intergenic
1122100944 14:99409094-99409116 ACCCTGTCCTTGCTTGACATCGG - Intronic
1202901134 14_GL000194v1_random:40257-40279 GCTTTCTCCTTAAATGAAATAGG + Intergenic
1125214948 15:37261307-37261329 CCTCTTTGCTTGCTGGAAATGGG - Intergenic
1128715739 15:69906411-69906433 GCTCACCCTTTGCTTGAAAATGG + Intergenic
1129197299 15:73976469-73976491 ACTGGCTCCTTGCTTGATATGGG + Intergenic
1133866461 16:9648346-9648368 GCTGTCAGCTTCCTTGAAATCGG - Intergenic
1135584294 16:23656582-23656604 TCTCCCTCCTTCCTTGAAATTGG + Intronic
1135889353 16:26343230-26343252 GGTCTCTCTTTTCTTGAAAAAGG - Intergenic
1138877199 16:60966402-60966424 CCTCTCTCCTTGCTTGTAGGTGG - Intergenic
1141618319 16:85222388-85222410 GCCCCCTGCTTGCGTGAAATGGG + Intergenic
1144755423 17:17677539-17677561 GGGCTCTCCATGCATGAAATGGG + Intergenic
1144760051 17:17701992-17702014 GTTCTCTGCTTCCTTTAAATTGG - Intronic
1146287093 17:31581379-31581401 GCTCCTTCCTTGCTTGGCATTGG + Intergenic
1147121205 17:38336142-38336164 CCTCTCTCCTTGCTTCACAGAGG - Exonic
1153153615 18:2124369-2124391 GTTCCGTCCTTGCTTGAAGTTGG - Intergenic
1157495822 18:48156726-48156748 TCTCTTTCCTTGCTTCAACTGGG + Intronic
1159678815 18:71321116-71321138 TCTTTCTCTTTGCTTGAACTGGG - Intergenic
1161514696 19:4689985-4690007 GCTCTTTCCTAGCTTGAATTGGG + Intronic
1163026307 19:14514674-14514696 CCTCTCACCTTGATTGAATTTGG + Intergenic
1163053391 19:14701590-14701612 CCTCTCTCCTTTCTTCACATGGG - Intronic
1163447131 19:17353289-17353311 GCTCCATCTTTGCTTGAACTGGG + Intronic
1164089212 19:21933080-21933102 GCTCTCTCCATGTTTGAATGTGG - Intronic
1164193484 19:22932881-22932903 GCTCTCTCCATGTTTGAATGTGG - Intergenic
1164357395 19:27455248-27455270 GGTATTTCCTTTCTTGAAATAGG - Intergenic
927292711 2:21420396-21420418 TCTCTCTCCTTCCTTGAAAAGGG + Intergenic
928025756 2:27737144-27737166 TCTCTCTCTTTGCTGGAAGTGGG + Intergenic
928158671 2:28900550-28900572 CAACTCTCCTTGCCTGAAATAGG + Intronic
928205343 2:29279701-29279723 ACTGTCTCCTTGCTGGAGATGGG + Intronic
928226141 2:29449841-29449863 GCTCTTTACTTGTGTGAAATTGG + Intronic
928442014 2:31300255-31300277 ACTGTCTCCATGTTTGAAATGGG + Intergenic
929044410 2:37776157-37776179 GCTCTCTCTTTCCTTAAAACAGG - Intergenic
932906612 2:75760421-75760443 GCTCTCTCATTGCTCCACATTGG - Intergenic
933286786 2:80393469-80393491 ACTGTCTCCTTGCTTGCAACTGG - Intronic
933474268 2:82768858-82768880 GTTCTATCCTTTGTTGAAATTGG - Intergenic
934625321 2:95844115-95844137 GATCTTTCCATGGTTGAAATTGG - Intronic
934808251 2:97257183-97257205 GATCTTTCCATGGTTGAAATTGG + Intronic
934829258 2:97500003-97500025 GATCTTTCCATGGTTGAAATTGG - Intronic
934931860 2:98432939-98432961 GCTCTTGCTTTGCTTGATATTGG - Intergenic
935821980 2:106902343-106902365 CCTCTCTCCTCCCTTGAAACAGG + Intergenic
937503614 2:122511430-122511452 GCTCTCTCCTTTCTGGAATTTGG + Intergenic
938017006 2:127875729-127875751 TCTCATGCCTTGCTTGAAATAGG + Intronic
938195434 2:129323388-129323410 GCTCTCTCTTTTCTTGATTTAGG - Intergenic
938872647 2:135496719-135496741 GTCCTTTCCTTTCTTGAAATTGG - Intronic
939179773 2:138790685-138790707 GCTCTCTGCTTGCCTGTTATTGG + Intergenic
939975797 2:148716014-148716036 GCTCTCTGATTGCTTGTTATTGG + Intronic
941510664 2:166405094-166405116 GCTCTCTCCCTTCTTCCAATTGG + Exonic
941845442 2:170127131-170127153 GCTCTTACCTTCCTTGAATTGGG - Intergenic
947173390 2:227335601-227335623 GCCTTCTCCTTTCTTGAGATAGG - Intronic
1168908018 20:1422338-1422360 GCCATCTCCTTCCTTGAAAGCGG + Intergenic
1169984424 20:11427195-11427217 TCTCTCTCTGTTCTTGAAATTGG - Intergenic
1171893249 20:30736333-30736355 GCTTTCTCCTTAAATGAAATAGG - Intergenic
1172808412 20:37630007-37630029 GCTCTCTTCTTGCTTGCTTTTGG + Intergenic
1173641266 20:44603769-44603791 GCTGTCTCCCTGCTGGAGATAGG + Intronic
1173942806 20:46926457-46926479 CCTGTCTCATTGCTTGAACTGGG - Intronic
1175072996 20:56350379-56350401 GCTCTGTCCCTGTTTGAACTTGG - Intergenic
1176620508 21:9055035-9055057 GCTTTCTCCTTAAATGAAATAGG + Intergenic
1176964913 21:15201770-15201792 CCTCTCTCCTTGCTTGCAGACGG + Intergenic
1177210647 21:18066895-18066917 CCTCTCTCCTTGCTTGTAGGTGG - Intronic
1179334432 21:40437244-40437266 AGTCTCCCCTTGCTTGAAAATGG - Intronic
1180859038 22:19066617-19066639 CCTCTCACCTTGCCTGAGATAGG - Intronic
949998636 3:9639458-9639480 GCTCTTTCCAAGCTTGAAATTGG - Intergenic
950587561 3:13905587-13905609 GCTCTCTGCTTGCTTGTTATTGG - Intergenic
954012795 3:47657182-47657204 CCTCTCTCCTTTATTGAAAGTGG - Intronic
954662404 3:52233079-52233101 GCTAGCTCCTTGGCTGAAATGGG + Intronic
954955034 3:54511313-54511335 GCACTCTCCTCCCTTGAACTTGG + Intronic
956295305 3:67705526-67705548 TTTCTCTACTTGCTTGAATTTGG - Intergenic
957040395 3:75331686-75331708 GGCTTCTCCTTGCTTCAAATGGG - Intergenic
957141180 3:76359945-76359967 GCTTTGTTCTTGCTTGAAACTGG - Intronic
957797099 3:85023549-85023571 CCTCTCTCCTTCCTTGAATTGGG + Intronic
959379417 3:105624327-105624349 GTACTATCATTGCTTGAAATAGG - Intergenic
959463308 3:106653003-106653025 GCTCTCGACTTGGTTGATATTGG - Intergenic
959580322 3:107976738-107976760 GCATTATCCTGGCTTGAAATTGG + Intergenic
960538797 3:118842739-118842761 TCTATCTTCTTGCTAGAAATTGG + Intergenic
961045186 3:123703265-123703287 GGCTTCTCCTTGCTTCAAATGGG - Intronic
962771853 3:138618739-138618761 GCTCTCTCCTGGTTAAAAATGGG - Intronic
963787024 3:149545291-149545313 TCTCTTCCCTGGCTTGAAATAGG - Intronic
966652596 3:182317719-182317741 GCTCTCTGCTTGTTTGTTATTGG + Intergenic
966854139 3:184182674-184182696 GCTCTCTCCTTGCTTGAAATGGG + Intronic
970099193 4:12501750-12501772 GCTCTCTCCATGCCTGAACCTGG - Intergenic
970260885 4:14223390-14223412 GGTCTCTCCTTGCTCAATATGGG + Intergenic
970331718 4:14993257-14993279 TCTCAATCCTGGCTTGAAATGGG - Intergenic
971484437 4:27144874-27144896 GCTCTCACATTGCATGAAGTAGG - Intergenic
971809478 4:31405574-31405596 GCTTTCTCTTTTCTTGAAAAGGG + Intergenic
972818394 4:42670593-42670615 GCTGTCTCCTGGCTGGAAAAGGG + Intergenic
979389033 4:120105433-120105455 CCTCTCACAATGCTTGAAATAGG - Intergenic
980604835 4:135076435-135076457 GCTCTCTGCTTGCCTGTTATTGG + Intergenic
987074432 5:14367387-14367409 GCTCTCTGCTTGGTTGAGGTTGG - Intronic
989710196 5:44388746-44388768 GCTCTCTCCTTGCCTTGCATCGG - Exonic
992875878 5:81054917-81054939 GCTCTCTGTTTGCTTGTTATTGG + Intronic
993034875 5:82745730-82745752 TCTCTTTCCTTACTTTAAATTGG + Intergenic
993781226 5:92067322-92067344 GCCCTCTCCTTGCCTGAGGTGGG + Intergenic
994378481 5:99041970-99041992 GCTCTCTGTTTGCTTGTCATTGG - Intergenic
994567069 5:101462962-101462984 GCTCTCTAGATGCTTTAAATTGG + Intergenic
994742741 5:103642034-103642056 ATTCTCTCCTTGCTTGGAATGGG + Intergenic
995985387 5:118164665-118164687 CCTCTCTTCTTTGTTGAAATTGG + Intergenic
996126922 5:119736485-119736507 TCTCTCTCCTTACTTGAAACTGG - Intergenic
997715915 5:136042725-136042747 GCTGTCACTTTGCTAGAAATGGG - Intronic
997807199 5:136930076-136930098 GCTCTCTGTTTGTTTGATATTGG + Intergenic
999719774 5:154391038-154391060 TCTCTCTCCTGGCTTGGAAAAGG + Intronic
999991174 5:157051473-157051495 GATCTCTGTTAGCTTGAAATAGG - Intronic
1000090681 5:157927263-157927285 GCTCTCACCACGCTTGGAATAGG - Intergenic
1000777346 5:165437026-165437048 TCTCTTTCTTTGCTTTAAATTGG - Intergenic
1006868851 6:37232017-37232039 GCTTTCTCCTTACCTGAAACTGG + Intronic
1015178184 6:130334205-130334227 CCACGCTCATTGCTTGAAATTGG + Intronic
1016338134 6:143031017-143031039 ACTCTCTATTTGCTTGTAATTGG + Intergenic
1017295063 6:152784030-152784052 GTTTTTTCCTTTCTTGAAATAGG + Intergenic
1021190953 7:17619163-17619185 GCTCCCTCCTTTCTTATAATGGG - Intergenic
1021895953 7:25235875-25235897 CCTGTTTCCTTGCTTGGAATTGG - Intergenic
1024378274 7:48664047-48664069 GCTGTTTCCCTGCTTGAAATGGG - Intergenic
1031255781 7:119446494-119446516 GCTCTCAGCTTGCATGTAATTGG + Intergenic
1037233110 8:16684317-16684339 CCTCTCTCCTTGCTTTGAATTGG - Intergenic
1039379148 8:37068490-37068512 GCTCTCTTCTTGCTGGACAGGGG - Intergenic
1041280745 8:56209800-56209822 GCTCCCTCCTTTCTTTAAACTGG - Intronic
1043093218 8:75930514-75930536 GCTCTCTACTTGCCTGATGTTGG - Intergenic
1047218075 8:122895171-122895193 GCTCTCTCCCTTCTTTAAAGGGG + Intronic
1051281690 9:15447809-15447831 GCTCTCTCCTTGTTGGGTATTGG - Intronic
1055300294 9:74875698-74875720 TCTCTCTACTTGCTTGACCTTGG + Intronic
1057464915 9:95304266-95304288 CTTCTCTCCTTTCTTGATATTGG - Intronic
1059501223 9:114755860-114755882 GCCTTCTCCTTGCTTAAAACAGG + Intergenic
1059884418 9:118729288-118729310 GCTCTCTCCATCCTTAAAACAGG + Intergenic
1203566391 Un_KI270744v1:94051-94073 GCTTTCTCCTTAAATGAAATAGG - Intergenic
1188617343 X:32174782-32174804 CTTCTGTTCTTGCTTGAAATTGG - Intronic
1189927044 X:45966782-45966804 GCTCTCTCCATTGTTGAAAGTGG + Intergenic
1190590047 X:51990845-51990867 GCTCTCTGCTTGCCTGTTATTGG + Intergenic
1191037264 X:56040016-56040038 GCTCTCTGCTTGCCTGTTATTGG + Intergenic
1191651352 X:63541385-63541407 GCTCTCTGCTTGTCTGTAATTGG - Intergenic
1195062596 X:101210804-101210826 GCTCTCTACTTTCCTGAAGTGGG - Intergenic
1197304325 X:124822165-124822187 CCTTTCTCCTTGCTAGAATTAGG + Intronic
1201974673 Y:19835890-19835912 GCTCTCTCTTTGCCTGTTATTGG + Intergenic