ID: 966855832

View in Genome Browser
Species Human (GRCh38)
Location 3:184193357-184193379
Sequence ATGTAGAAGTTGGGGCTGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 377}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966855832_966855845 27 Left 966855832 3:184193357-184193379 CCTTCCAGCCCCAACTTCTACAT 0: 1
1: 0
2: 1
3: 39
4: 377
Right 966855845 3:184193407-184193429 CATGGAGACCATTGAGGCTCTGG 0: 1
1: 0
2: 0
3: 6
4: 159
966855832_966855844 21 Left 966855832 3:184193357-184193379 CCTTCCAGCCCCAACTTCTACAT 0: 1
1: 0
2: 1
3: 39
4: 377
Right 966855844 3:184193401-184193423 CCTGGACATGGAGACCATTGAGG 0: 1
1: 0
2: 1
3: 20
4: 531
966855832_966855839 9 Left 966855832 3:184193357-184193379 CCTTCCAGCCCCAACTTCTACAT 0: 1
1: 0
2: 1
3: 39
4: 377
Right 966855839 3:184193389-184193411 ACCCACAAACCACCTGGACATGG 0: 1
1: 0
2: 1
3: 14
4: 168
966855832_966855838 3 Left 966855832 3:184193357-184193379 CCTTCCAGCCCCAACTTCTACAT 0: 1
1: 0
2: 1
3: 39
4: 377
Right 966855838 3:184193383-184193405 GGATGAACCCACAAACCACCTGG 0: 1
1: 0
2: 2
3: 9
4: 101
966855832_966855846 28 Left 966855832 3:184193357-184193379 CCTTCCAGCCCCAACTTCTACAT 0: 1
1: 0
2: 1
3: 39
4: 377
Right 966855846 3:184193408-184193430 ATGGAGACCATTGAGGCTCTGGG 0: 1
1: 0
2: 0
3: 12
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966855832 Original CRISPR ATGTAGAAGTTGGGGCTGGA AGG (reversed) Exonic
902479073 1:16702240-16702262 CTGTAGAGGTAAGGGCTGGAAGG - Intergenic
907968658 1:59358905-59358927 ATGAAGAAATTGAGGATGGAGGG + Intronic
907971595 1:59388139-59388161 ACATAGGAGTTGGGGCAGGAAGG + Intronic
907976261 1:59434317-59434339 TTGTACCAGTGGGGGCTGGAGGG + Intronic
908998204 1:70184740-70184762 TTGTACAATTTGGGGCTGGTGGG - Intronic
909060038 1:70869303-70869325 ATGTAGGAGATGGGGCCTGATGG - Intronic
909361991 1:74771385-74771407 ATGTACAAGATGAGCCTGGAAGG - Intergenic
909503749 1:76363952-76363974 ATGTGGGAGGTGGGGCTGGTGGG - Intronic
910195762 1:84638116-84638138 TTGTGGAAGTAGGGGTTGGAAGG + Intergenic
910443465 1:87276777-87276799 ATGTATATGCTGGGGATGGAGGG + Intergenic
911204811 1:95081372-95081394 ATCTAGAAGATTGGGCAGGATGG + Intergenic
911512866 1:98828440-98828462 ATGTTGGAGATGGGGCTTGATGG + Intergenic
911608325 1:99933403-99933425 CAGTAGAAGTTGGGGCTGACTGG + Intergenic
911830236 1:102541405-102541427 ATGTTGGAGTTGGGGCTTGTGGG - Intergenic
912137855 1:106683181-106683203 ATGCAGGAGATGGGGCTTGATGG + Intergenic
915719077 1:157970882-157970904 ATGTTGAAGGTGGGCCTGGTGGG - Intergenic
916934014 1:169609237-169609259 ATGAAGAAGATGGGGCTTGGGGG - Intronic
918123063 1:181556703-181556725 GGGAAGAAGTTGGGGCAGGAGGG + Intronic
918165394 1:181941179-181941201 ACGTAGAAGTTGGTGATCGAGGG - Intergenic
919777163 1:201201824-201201846 CTGTATAAGGTGAGGCTGGAGGG + Exonic
920076733 1:203342592-203342614 GGGTGGAAGTTGGGGATGGAGGG + Intronic
922150465 1:222998734-222998756 ATGTAGAAGTTGGAGCTCTGAGG + Intronic
923087663 1:230713716-230713738 GTGCAGGAATTGGGGCTGGAGGG - Intronic
923502936 1:234581349-234581371 ATGTTTGAGTTGGGACTGGAGGG - Intergenic
1063176250 10:3553165-3553187 AGGTAGATGTGGGAGCTGGACGG - Intergenic
1063913074 10:10852427-10852449 GTGCTGGAGTTGGGGCTGGAAGG + Intergenic
1067201117 10:44172859-44172881 ATGAAGAAGCAGGGGCTGGCGGG - Intergenic
1067530701 10:47069476-47069498 ATGTAGACGCTGGGGCTAGTTGG + Intergenic
1068117314 10:52749447-52749469 ATGCAGAAGCTGGAGCTGAATGG - Intergenic
1069036327 10:63649366-63649388 AGTTAGAATTTGGGGCTGAAGGG + Intergenic
1074237198 10:111597614-111597636 TTGTAGAAGATGGGGCTAAAAGG - Intergenic
1074364224 10:112845252-112845274 CTGCACAAGTTGGGGCAGGACGG + Intergenic
1074654688 10:115571507-115571529 ATGTAGTAGTAGTGTCTGGATGG - Intronic
1074940866 10:118235001-118235023 ATGGAGTTGTTTGGGCTGGAAGG + Intergenic
1075151246 10:119934724-119934746 AGGTAGAAGATGAGGCTGAAGGG - Intronic
1076826075 10:132970113-132970135 ATGTAGAATTTGGGGTTGAAGGG + Intergenic
1077501174 11:2910391-2910413 AAGTAGAACTGGGGGCTCGATGG + Intronic
1078151616 11:8764475-8764497 ATGAAGAAGCTGAGGCTGAAAGG + Intronic
1078398558 11:11002768-11002790 AAGTAGAAGATGGGGCAGGTTGG - Intergenic
1078753500 11:14187264-14187286 ATGTTGGAGTTGGGTCTGGTGGG - Intronic
1079024299 11:16933945-16933967 ATGCAGAGGATGGGGCTGGGAGG - Intronic
1079582716 11:22086422-22086444 ATGAACAACTAGGGGCTGGATGG - Intergenic
1080056505 11:27912111-27912133 ATGTTGATGTTGGGGGAGGATGG + Intergenic
1080174430 11:29344702-29344724 ATGTTGAAGGTGGGGCTGGTGGG + Intergenic
1081372845 11:42325190-42325212 ATGTGGAATATGAGGCTGGATGG + Intergenic
1081678569 11:44985881-44985903 AGGGAGAACTTGGGGCTGGAGGG + Intergenic
1082660283 11:55900833-55900855 CTCTAGAAGTTGTGTCTGGAAGG + Intergenic
1082837590 11:57663003-57663025 CTGTACAAGATGAGGCTGGAGGG + Intergenic
1082853085 11:57782751-57782773 ATGGAGAAGTTGGGCCTAGCAGG + Intronic
1083551403 11:63592846-63592868 CTGTAGAAATTAGAGCTGGAAGG - Intronic
1084767338 11:71321246-71321268 ATGTTGAAGTTGGGGCCTGGTGG + Intergenic
1084956325 11:72693549-72693571 ATGGAGAGGCTGGGGCAGGATGG - Intronic
1085171684 11:74454857-74454879 ATTTGGAAGTTTGGGCTGGGTGG + Exonic
1085427202 11:76415196-76415218 ATGCAGGAGATGGGGCTGGCTGG + Intergenic
1086028499 11:82324279-82324301 AAGTATAAGTTGGGAATGGAAGG + Intergenic
1089353569 11:117835396-117835418 TCTTAGAAGTTGGGGCTGGAAGG + Intronic
1089365992 11:117921487-117921509 ATGGGGCAGCTGGGGCTGGATGG - Intronic
1089496663 11:118911495-118911517 ATGGAGAAGCTGGGGGTGGCGGG - Intronic
1090522370 11:127493015-127493037 ATGTAGAAATCACGGCTGGATGG + Intergenic
1092753473 12:11740922-11740944 ATGTAGAAATTGAGGTTGAAGGG - Intronic
1092811631 12:12276255-12276277 ATGTTGGAGTTGGGGCTGGGTGG - Intergenic
1093047171 12:14460711-14460733 CTGTAGAAGCTGAGGCTGGGAGG - Exonic
1097101057 12:56589847-56589869 ATGTGGAATTTGGGGTTGGGGGG + Exonic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1099225994 12:79969842-79969864 TTGTGGAAGTTGAGACTGGAAGG + Intergenic
1099796543 12:87408057-87408079 ATGTTGGAGATGGGGCTGGTGGG + Intergenic
1099924083 12:88996245-88996267 GTATAGAAGATGGAGCTGGAGGG + Intergenic
1100145718 12:91675021-91675043 ATGTATAAGTGGGAGCTGAATGG - Intergenic
1100623644 12:96306782-96306804 ATGTGAAAGTTAGGGATGGATGG - Intronic
1103722353 12:122981563-122981585 AGGGAGAAGGTGAGGCTGGAAGG - Exonic
1103938356 12:124488609-124488631 AGGGAGAAGACGGGGCTGGAGGG + Intronic
1105396914 13:20044556-20044578 AAGTAGATGTTGGGGCAAGATGG - Intronic
1105458910 13:20566289-20566311 AAGTAAATGTTGGGGATGGAGGG - Intergenic
1105734695 13:23255582-23255604 ATGTAGGAGTTGGGGCCTGATGG + Intronic
1105927702 13:25022033-25022055 ATGGGGAAGATGGGGCTGGATGG - Intergenic
1106005228 13:25763594-25763616 ATATAGAATTTGGGGTTGGGAGG - Intronic
1106620990 13:31370641-31370663 ATGTAAAAGTTTGGGATCGAAGG + Intergenic
1106843548 13:33712293-33712315 GGTTAGAAGTTGAGGCTGGAGGG - Intergenic
1107898286 13:44987904-44987926 TTGTAGAAGATGGGGGAGGAGGG - Intronic
1108355188 13:49623769-49623791 ATGTACAAGATGGGGCTGGGTGG - Intergenic
1108678876 13:52762447-52762469 ATGGTGAAGTTGGGGGAGGAAGG + Intergenic
1110418591 13:75279206-75279228 AAGTAGAAGGTGGGGCTGAATGG - Intergenic
1110434698 13:75465937-75465959 ATGTAGAAGTGGGGGCTTCCAGG - Intronic
1112055406 13:95685656-95685678 ATGTTGGAGTTGGGGCTTGGTGG + Intronic
1113615275 13:111676125-111676147 ATGTTGGAGTTGGGCCTGGTGGG - Intergenic
1114796864 14:25725776-25725798 ATGGAGTGGATGGGGCTGGAGGG + Intergenic
1115897890 14:38110523-38110545 AGGTAGAAGTTGGGGAGGGAAGG + Intergenic
1116153345 14:41170304-41170326 ATGTTTAATTTGGGGATGGAGGG - Intergenic
1116417061 14:44691196-44691218 ATGAAGTACTGGGGGCTGGAGGG + Intergenic
1116504934 14:45666155-45666177 ATGTAGAAGGTGGGGCAAGATGG - Intergenic
1116536859 14:46042033-46042055 ATGTAGACACTGGGGCTGAAAGG - Intergenic
1117095707 14:52295270-52295292 ATGCAGAAGTTGCAGCTGGGTGG - Intergenic
1117287171 14:54297438-54297460 ATGTAGAAATTGAGGGTGGAGGG - Intergenic
1117627649 14:57656134-57656156 TAGTAGAAGATGGGGCTGGCAGG - Intronic
1117851276 14:59972564-59972586 ATGCAGAAGTTTGGGGTGGTGGG - Intronic
1118320419 14:64749289-64749311 AAGTAGCAGGTGGGGCTGGCGGG - Exonic
1118861632 14:69668708-69668730 GTGTTGAAGTTGGGGCTTGGTGG + Intronic
1119048023 14:71338106-71338128 ATGAAGAAGGTGGGTCTTGAAGG - Intronic
1119274141 14:73338111-73338133 CTGTAGAGGTTGGGGGTGGGGGG - Intronic
1119395928 14:74326530-74326552 ATGAGGGACTTGGGGCTGGAAGG - Intronic
1119911161 14:78350439-78350461 ATGTAGGAGTTGGGGCTTTGGGG + Intronic
1120044521 14:79791051-79791073 ATGTTGGAGGTGGGGCTGGTGGG - Intronic
1120115387 14:80610996-80611018 ATGTATAAGTTATGCCTGGAAGG + Intronic
1121173616 14:91874211-91874233 GTGTGGGAGGTGGGGCTGGATGG - Intronic
1121246292 14:92463189-92463211 CTGAAGAAGATGGGGGTGGATGG - Intronic
1121309971 14:92930388-92930410 ATGTAGAAGATGGGCCGGTAAGG + Intronic
1124008139 15:25810973-25810995 ATAATGAAGCTGGGGCTGGAAGG + Intronic
1125466549 15:39958787-39958809 GTGTAGATGTTGGGGCAGGAGGG - Intronic
1126372648 15:47963531-47963553 ATTAAGAAGGTGGGGCTGAAAGG - Intergenic
1129605647 15:77023759-77023781 ATGAAGGAGGCGGGGCTGGAGGG + Intronic
1129671066 15:77607895-77607917 TTGTGGAAGTTGGGGGAGGAGGG - Intergenic
1129694706 15:77734136-77734158 TTGAAGTAGTGGGGGCTGGAGGG - Intronic
1132090815 15:98946744-98946766 ATGGAGCAGTTGGGCCGGGAGGG + Intronic
1132105876 15:99062268-99062290 ATGTAAAAGTTGGTGCTGGTGGG + Intergenic
1132549318 16:547844-547866 GTGGTGAAGTCGGGGCTGGAGGG - Exonic
1133260037 16:4543173-4543195 ACGTTTAAGTTGGGGCTTGAAGG + Intergenic
1133558078 16:6924505-6924527 ATGTTGGAGGTGGGCCTGGAGGG - Intronic
1134208119 16:12253956-12253978 ATGTGGATGCTGGAGCTGGAAGG + Intronic
1134398354 16:13886218-13886240 ATGAAGAAGCTGAGGCTTGATGG + Intergenic
1135591299 16:23706765-23706787 ATGTAGAGGCGGGGGGTGGAGGG + Exonic
1135723346 16:24835379-24835401 ATGGAGGATTAGGGGCTGGAGGG - Intergenic
1135965312 16:27030391-27030413 AGGCAGAAGCAGGGGCTGGAAGG + Intergenic
1136223641 16:28844647-28844669 CTGCAGAGGGTGGGGCTGGATGG - Intronic
1136462499 16:30420426-30420448 ATGTTTAAGTTGGGTCTGGAAGG + Intronic
1137237428 16:46626969-46626991 TTGTAGAAGCTGGTGCTGGTGGG - Intergenic
1137563788 16:49520754-49520776 ACACAGAAGCTGGGGCTGGAAGG - Intronic
1137789746 16:51165132-51165154 CTGTAAAAGTTGGGGGTGGGGGG - Intergenic
1139478080 16:67213155-67213177 TTCCAGAAGTAGGGGCTGGAAGG - Intronic
1139559026 16:67730022-67730044 ATCCAGAAGCTGGTGCTGGAGGG - Exonic
1140115677 16:72039413-72039435 TTGGAGAAGCTGCGGCTGGAGGG + Intergenic
1140300692 16:73754519-73754541 ATGTGGCAGCTGGGGCTGCAAGG - Intergenic
1140556232 16:75924674-75924696 ATGTTGAAGGTGGGGCTTGGTGG + Intergenic
1141068728 16:80934274-80934296 ATGTGGAAGATGGGTTTGGAGGG - Intergenic
1143566124 17:7721871-7721893 ATGGAGAAGTTGGGGCTCATAGG - Intronic
1143985341 17:10908474-10908496 ATATAAAAGGTGGGGCAGGAGGG - Intergenic
1146471465 17:33128325-33128347 ATGCAGCAATTGGGGCTTGAAGG - Intronic
1146787158 17:35730696-35730718 AAGTAGATTTTGGGGCTGGGTGG - Intronic
1147395744 17:40141017-40141039 ATTCAGAAGTCGGGGCTGGAGGG + Intronic
1148763443 17:50021727-50021749 ATGAAGAGGATGGGGGTGGAGGG - Intergenic
1149000472 17:51752364-51752386 ATGGAGAAGTTGAAGCTGCAGGG + Intronic
1149448861 17:56733905-56733927 ATGAATGAGTTGGGGCTGGATGG - Intergenic
1149543948 17:57489315-57489337 ATGTAGCAGCTGGGGAGGGATGG + Intronic
1149644731 17:58232077-58232099 TTTTAGAACTTGGGGCTGGAGGG + Intronic
1151285182 17:73105772-73105794 AAGTAGAAGTTCTGGATGGAGGG + Intergenic
1151700146 17:75738451-75738473 ATGGAGAAATTGGGGCTGAGAGG + Intronic
1151817008 17:76476312-76476334 AAGAAGAAGCTGGGGCTGGGAGG - Intronic
1152814416 17:82398989-82399011 TTGTAGAGGTTGGGGCGGGGTGG + Intronic
1153527944 18:6015353-6015375 TTGCAGAAGGTGGGGGTGGATGG + Intronic
1153641148 18:7158269-7158291 AGGTAGCAGTGGCGGCTGGAGGG + Intergenic
1153712381 18:7812776-7812798 ATGGAGAAATTGGGTCTGGATGG + Intronic
1153883047 18:9437361-9437383 ATGCAGAAGTTGCAGCTGCATGG - Intergenic
1154303693 18:13216364-13216386 ATGACGAAGTTGAGGCTAGAAGG - Intergenic
1155012363 18:21792413-21792435 GGGCAGGAGTTGGGGCTGGATGG - Intronic
1156464995 18:37343032-37343054 AGGTAGATGTGGGAGCTGGAAGG + Intronic
1156508920 18:37618587-37618609 ATATAGAAGTCGAGGATGGAAGG - Intergenic
1158009008 18:52706993-52707015 AGGTAGAAGCTGGGGTTGGAGGG + Intronic
1159074377 18:63664009-63664031 AGGATGAAGTAGGGGCTGGACGG + Intronic
1159616279 18:70583716-70583738 ATGTAGAGGTGGGGCCTGGTGGG + Intergenic
1159960061 18:74548233-74548255 ATGTTGGAGTTGGGGCTTGGTGG + Intronic
1160532435 18:79573425-79573447 ATCTAGAAGAGGAGGCTGGAAGG + Intergenic
1161473843 19:4473819-4473841 ATGTAGAAGCTGGTTTTGGAGGG + Intronic
1162529489 19:11227689-11227711 AGGTAGAAGCTGGGGCCTGAGGG + Intronic
1162545551 19:11326967-11326989 ATGTGGCAGGTGGGGCTGCATGG - Exonic
1163015420 19:14451404-14451426 CTGTGGAAGGTGGGGCTGGCTGG - Intronic
1163446057 19:17347216-17347238 ATCAACAAATTGGGGCTGGAGGG + Intergenic
1163764644 19:19156032-19156054 ATGTAGACGCAGAGGCTGGATGG + Intronic
1164741053 19:30575885-30575907 ATGTAGAAGAGGGGGAGGGACGG + Intronic
1165191355 19:34066434-34066456 ATGTTGGAGGTGGGGCTGGGTGG + Intergenic
1166040503 19:40199609-40199631 ATGTAGGAGAGGGAGCTGGAAGG + Intronic
1166518892 19:43466100-43466122 GTCTAGAAGTGGGGGCTGGTCGG + Intergenic
1167606365 19:50482792-50482814 ATGAAAGAGTCGGGGCTGGATGG + Exonic
1167856883 19:52249058-52249080 ATGTAGAAGGTTTGGGTGGATGG + Intergenic
1202713114 1_KI270714v1_random:28147-28169 CTGTAGAGGTAAGGGCTGGAAGG - Intergenic
925108548 2:1313750-1313772 AGGTACAAGTTGGGGCTCCATGG - Intronic
925549875 2:5061550-5061572 ATGTTGGAGGTGGGGCTGGCTGG - Intergenic
926181948 2:10652530-10652552 TTACAGAAGTTGGGGCAGGAAGG - Intronic
926430557 2:12781004-12781026 AGGATGAAGCTGGGGCTGGAAGG - Intergenic
927970950 2:27306223-27306245 ATGTCGAAGGTGGAGCTGGCAGG + Exonic
929288201 2:40159982-40160004 CTGTAGAAGATGAGCCTGGAGGG + Intronic
929687019 2:44043846-44043868 CTGTAGAAGTTAGGTCTGCATGG + Intergenic
929768826 2:44874349-44874371 TGGCAGAAGTTGGGGGTGGATGG - Intergenic
929879101 2:45821173-45821195 ATTTAGAAGTTGGTGATTGATGG + Intronic
929925199 2:46201816-46201838 CTGAAGAAGGTGGGGGTGGAGGG + Intergenic
931182948 2:59921648-59921670 TGGTAGAATTTGGGGCAGGATGG - Intergenic
931867655 2:66429878-66429900 ATGTAGCAGTTTGGGGGGGAGGG + Intergenic
932387795 2:71353532-71353554 GTCTAGAAGTTGGGGTGGGATGG + Intronic
934663424 2:96154923-96154945 GTGTGGAAGTTGGGGTTGCAGGG - Intergenic
935126534 2:100228704-100228726 ATGTAGAATTTGTGGCTGGCAGG - Intergenic
935504080 2:103877892-103877914 ATGTATATGTTGGGGATAGATGG - Intergenic
935629528 2:105201556-105201578 ATGTCGAAGGTGGGCCAGGAGGG + Intergenic
935839255 2:107091234-107091256 TTGTAGCATTTGAGGCTGGATGG + Intergenic
936651756 2:114435769-114435791 ATGTAGTAATTGGGGATGGCAGG + Intergenic
936702741 2:115033476-115033498 AGGAAGGAGTTGGAGCTGGAGGG - Intronic
937117646 2:119420105-119420127 GTGTTGAAGGTGGGGCTGGTGGG - Intergenic
937791768 2:125969571-125969593 ATGTTGGAGGTGGGCCTGGAGGG + Intergenic
937897592 2:126990361-126990383 CTGTACAAGTTGGTGCTGCAGGG - Intergenic
938578622 2:132626444-132626466 ATGTAGAACTCAGGGATGGAAGG - Intronic
939985963 2:148830139-148830161 ATGTTGGAGGTGGGGCTGGTGGG + Intergenic
942302199 2:174572636-174572658 CTGTAGAAGTTGGGACTCGCAGG - Intronic
942463182 2:176183648-176183670 CTGTAGGAGTTGGGGTGGGAGGG - Intergenic
942549981 2:177105238-177105260 TGGGGGAAGTTGGGGCTGGAAGG - Intergenic
942594097 2:177575767-177575789 ATGAAGAGGTTGGGCCTTGATGG + Intergenic
943292660 2:186094091-186094113 GTGTTGAAGATGGGGCTGAATGG - Intergenic
943746049 2:191463711-191463733 ATGTAGAAGGGGTAGCTGGATGG - Intergenic
944031230 2:195237142-195237164 ATGTAAGAGTTGGTGCTTGAAGG - Intergenic
944858580 2:203792284-203792306 AACTAGGAGTTGGGGCTGGGAGG + Intergenic
945791868 2:214315484-214315506 ATAAAAAAGATGGGGCTGGAGGG - Intronic
945850646 2:215002657-215002679 ATGTAGATGTTGGTGGGGGAGGG + Intronic
946276695 2:218636975-218636997 TTGAGGAAGTTGGGGATGGAGGG - Exonic
1168836879 20:883522-883544 GTGTAGAAGAGAGGGCTGGATGG - Intronic
1169163726 20:3405471-3405493 ATGTAGAAGTGGGGAAAGGAGGG + Intronic
1169989998 20:11491757-11491779 ATGTACAAGTTGAGGCTAGCTGG - Intergenic
1170495432 20:16919560-16919582 AGGTAGAACTTGGGGTGGGATGG + Intergenic
1171037403 20:21726817-21726839 ATGCAGAACTTGAGGCTTGAAGG - Intergenic
1173219093 20:41116579-41116601 ATCTTGAAGTTGGGGTGGGAAGG - Intronic
1173314790 20:41933293-41933315 ATTTTTCAGTTGGGGCTGGAAGG + Intergenic
1173912212 20:46678801-46678823 GTGTAGGAGGTGGGGCTGGTGGG + Intronic
1174342292 20:49905584-49905606 ATGTAGCCCTTGGAGCTGGAAGG + Exonic
1174577475 20:51546824-51546846 ATGTTTAAGCTGGGACTGGAAGG + Intronic
1174844102 20:53926950-53926972 ATTTAGAAGATGGGGCGGGTGGG - Intergenic
1175081215 20:56421966-56421988 ATGTAGATTTTGCAGCTGGATGG + Intronic
1175522818 20:59613067-59613089 ATGTTGGAGGTGGGGCTGGGTGG - Intronic
1175817608 20:61891612-61891634 AGGCACATGTTGGGGCTGGAGGG + Intronic
1177448553 21:21233312-21233334 ATGTAAAAGTTGGAGCTTTATGG - Intronic
1177529577 21:22342022-22342044 ATGTTGGAGTTGGGGCTGGTGGG - Intergenic
1177625250 21:23651155-23651177 ATGTAAAAGATGTGGCCGGATGG + Intergenic
1178511758 21:33211297-33211319 ATGAAGAAGTTCGGCCTCGATGG + Intergenic
1179523488 21:41960444-41960466 ATGTAGAAGTTGAGTTTGTAAGG + Intergenic
1179638891 21:42733891-42733913 ATGTTGGAGGTGGGGCTGGTGGG + Intronic
1179946705 21:44683024-44683046 ATGTCGACGTGGGGACTGGAGGG - Intronic
1181027145 22:20132749-20132771 GTGAAGAAGTTGAGGCTGGAGGG - Intronic
1182830335 22:33299878-33299900 AAGTAGATGAAGGGGCTGGAAGG + Intronic
1182831339 22:33307026-33307048 TTGGAGAGATTGGGGCTGGAGGG - Intronic
1183197740 22:36364998-36365020 ATGCAGAAGTAGGGGCTGGTGGG - Intronic
1183617181 22:38953098-38953120 ATGTAGGAGTCTGGGCTGGGAGG - Intronic
1184626706 22:45739130-45739152 ATGAAGAAGGTGGGGCAGGCAGG + Intronic
949126232 3:448095-448117 ATGCAGGTGTTAGGGCTGGAAGG + Intergenic
949705735 3:6814379-6814401 ATGTTGGAGTTGGGGCTTAATGG - Intronic
950627178 3:14255981-14256003 ATGGAGAAATTGAGGCTGGAGGG - Intergenic
950936156 3:16841634-16841656 AAGTATCAGTGGGGGCTGGAAGG + Intronic
951698521 3:25470538-25470560 AAGTTGAAGATGGGGCTGGAAGG + Intronic
952875931 3:37944475-37944497 AAGTAGCAGCTGGGGCTGGAAGG + Intronic
954455688 3:50598567-50598589 ATGGTGAAGTGGGAGCTGGAGGG + Intergenic
955073093 3:55588270-55588292 AAGGAGGGGTTGGGGCTGGAAGG - Intronic
955167128 3:56525826-56525848 ATGTTGAAGGTGGGCCTGGTGGG + Intergenic
955560881 3:60189224-60189246 ATTTAGAAGCTGGGGGTGGGGGG + Intronic
955634216 3:61008254-61008276 AAGCACAAGTTGGGGATGGAGGG + Intronic
955920377 3:63948500-63948522 ATGTAGAAGTTTGGGATGCGTGG + Intronic
957459115 3:80494517-80494539 TGGAAGAAGTTGGGGGTGGAGGG - Intergenic
958888240 3:99753057-99753079 ATATAAAGGTTGGTGCTGGAAGG - Intronic
959874039 3:111360826-111360848 ATGTTGGAGGTGGGGCTTGATGG + Intronic
960516035 3:118603895-118603917 ATGTTGGAGGTGGGGCTGGTGGG + Intergenic
960586881 3:119328301-119328323 TTGTGGAATTTGGGGTTGGAAGG + Intronic
962263875 3:133931871-133931893 AAGTAGACGCTGGGGCTGGGTGG + Intergenic
963825847 3:149952496-149952518 TTGTTGAAGTTGGCTCTGGAAGG + Intronic
964183947 3:153920121-153920143 ATGTAGGAGGTGGGGCCTGATGG + Intergenic
964552816 3:157903906-157903928 ATGTTGAAGGTGGGGCTTGTGGG + Intergenic
966855832 3:184193357-184193379 ATGTAGAAGTTGGGGCTGGAAGG - Exonic
967932032 3:194696892-194696914 AAGTGGAATTGGGGGCTGGATGG + Intergenic
968312619 3:197696544-197696566 ATGTAGAACTTTGGGCTGGGAGG + Intronic
968537473 4:1143518-1143540 GGATAGAAGGTGGGGCTGGAAGG - Intergenic
969308884 4:6340670-6340692 AGGTAGAAGTGGGGGCTGGCTGG - Intronic
969462695 4:7337149-7337171 TTGCAGAAGGTGGGGCTGGAAGG + Intronic
970628469 4:17915900-17915922 ATGTTGAAGTTGGGGTCTGATGG + Intronic
971525388 4:27611026-27611048 AAATAGAGGTTGGGCCTGGATGG + Intergenic
972011498 4:34189107-34189129 ATGTTGAAGTGGGGCCTGGTGGG + Intergenic
974372983 4:61041836-61041858 CTGTGGAAGTGGGGGCTGGTAGG - Intergenic
974660058 4:64875579-64875601 AAGTAGAAGTTGCGGTTGGTAGG + Intergenic
975273486 4:72466265-72466287 ATGTAGAAGAAGAGGCTAGAGGG + Intronic
975357986 4:73430694-73430716 ATCTAGAAGCTGGGTCTGGATGG + Intergenic
975512775 4:75211706-75211728 ATGTAGAAATTGAGGAGGGAAGG - Intergenic
975538456 4:75477120-75477142 ATGTGGAGGTTGGGCCTGGTGGG - Intergenic
975607016 4:76165063-76165085 AATTAGAAGTTGGGGGTGGAGGG + Intronic
976262867 4:83162600-83162622 ATGTAGTACTTGGCCCTGGAGGG + Intergenic
977063423 4:92284223-92284245 ATGGAGAAGTAGGGGGTGGTAGG - Intergenic
977804925 4:101286017-101286039 ATGTACAAGGCGGGGGTGGATGG + Intronic
978983537 4:114981888-114981910 ATGTTGAAGGTGGGGCTTGGTGG + Intronic
982018980 4:151184803-151184825 ATGTGGAAGTTGGGGCGGCTAGG - Intronic
982346006 4:154360314-154360336 AGGAAGAAATTGAGGCTGGAAGG - Intronic
982678313 4:158400767-158400789 ATGTAGAAGTGGGTGAGGGAGGG + Intronic
982720128 4:158850619-158850641 GAGTAGCAGTGGGGGCTGGAGGG + Intronic
983793914 4:171836004-171836026 ATGTAGTATTTGGAGCTGAAGGG + Intronic
983987950 4:174082707-174082729 ATGTGGGAGATGGGGCTTGATGG - Intergenic
985046511 4:185946278-185946300 ATGTAGAAGTTGGAGGAGGCAGG + Intronic
985118498 4:186616018-186616040 ATGTAGAAAGTCGGGCTCGATGG + Intronic
985351419 4:189066942-189066964 AAGAAGAAGTTGGGGCAAGATGG - Intergenic
986302402 5:6488500-6488522 ATGTAGAAATTGATGCTGGCCGG + Intronic
986395585 5:7326328-7326350 ATTTTGAATTTGGTGCTGGAAGG - Intergenic
989584671 5:43065553-43065575 ATGTAGAAGTTGGGGTACGTCGG - Intronic
990951876 5:61306417-61306439 TTTTAGAAGTTGAGGGTGGAAGG + Intergenic
991583666 5:68181706-68181728 ATGCTGAAGTTGGGGTTGGATGG - Intergenic
993340777 5:86722761-86722783 ATGTTGGAGGTGGGGCTGGTGGG - Intergenic
993677593 5:90835727-90835749 ATATAGAATTTAGGGCTGGAGGG - Intronic
995986054 5:118175484-118175506 ATGTAGAATTTAGGACTGTAGGG - Intergenic
997481444 5:134188061-134188083 ATGTGGAAGTTTTGGCTAGAAGG + Intronic
998950528 5:147389210-147389232 ATGTGGAAGTTGGGACGGGTGGG - Intergenic
1000120636 5:158194662-158194684 ACGTAGCAGAAGGGGCTGGAGGG - Intergenic
1000727754 5:164792851-164792873 TTGTAGAGGTTGGGGGTGGAAGG - Intergenic
1000851170 5:166341620-166341642 ATTGAGAAGTGGGGGCCGGAGGG + Intergenic
1001584836 5:172826823-172826845 CTGGAGAGGTAGGGGCTGGATGG - Intergenic
1001850822 5:174963424-174963446 ATGAAGCAGTTGGGGCTGGTTGG - Intergenic
1002052849 5:176581406-176581428 AAGGAGAAGTTGTGGCTGTAGGG - Exonic
1004066239 6:12247283-12247305 GTGTAAATGTTGGTGCTGGAGGG + Intergenic
1004330652 6:14717529-14717551 ATGTAGAGGGCTGGGCTGGAAGG - Intergenic
1005801075 6:29425685-29425707 ATGTTGATGTTGAAGCTGGATGG + Exonic
1007274444 6:40663053-40663075 ATGTGGAGGTGGGGTCTGGAGGG - Intergenic
1007450677 6:41939038-41939060 TTGGAGGGGTTGGGGCTGGAAGG - Intronic
1009344833 6:62600562-62600584 ATGAAGAAGTTGGAGGAGGAAGG - Intergenic
1011621461 6:89247280-89247302 ATGTGGAAATTGGGGATGAAAGG + Intergenic
1011645656 6:89455535-89455557 ATGTTGGAGGTGGGGCTGGGTGG + Intronic
1011726263 6:90213351-90213373 TTGTAGGAGTTGGGTCTGGTTGG + Intronic
1012265691 6:97139207-97139229 ATGTAAAATATGGAGCTGGAAGG - Exonic
1012651756 6:101762521-101762543 AGAAAGAAATTGGGGCTGGATGG - Intronic
1013133878 6:107261254-107261276 ATGCAGGAGGTGGGGCTGGTGGG + Intronic
1013268607 6:108524723-108524745 ATGCAGAAAGTGGGGCTAGAAGG + Exonic
1013779044 6:113710293-113710315 ATGTTTAAGGTGGGGCTGAAAGG + Intergenic
1014318618 6:119897668-119897690 ATGTAGAAATTAGAGCTGGTAGG + Intergenic
1014822798 6:126011532-126011554 ATGAAGAAGCTGGGGGTAGATGG - Intronic
1015389731 6:132668014-132668036 ATGTGGAATTTGGGGCTGGCAGG + Intergenic
1016580353 6:145622756-145622778 GTGTAGAAGTTGGAGATGAAAGG - Intronic
1016606265 6:145931697-145931719 ATGTTGAAGTGGTGGCTGTAGGG + Intronic
1016609242 6:145969836-145969858 ATGTAACAGTTGGGTATGGAGGG - Intergenic
1016758069 6:147708632-147708654 ATGTGGAAGTTAGGTTTGGAAGG + Intronic
1017484922 6:154893627-154893649 ATGTGGAAGTTGGGGGCGGGGGG + Intronic
1017629730 6:156384707-156384729 ATGTTGAAGGTGGGGCCTGATGG + Intergenic
1017762889 6:157584709-157584731 ATGAAGAAATTGGGGCTGTGCGG - Intronic
1018883475 6:167909367-167909389 ATGGAGAAGGTGAGGATGGAGGG + Intronic
1018962259 6:168457347-168457369 GTGTTGAAGGTGGGGTTGGATGG - Intronic
1019284019 7:215299-215321 ATGGAGAGGATGGGGCTGGGTGG + Intronic
1019284038 7:215343-215365 ATGGAGAGGATGGGGCTGGGTGG + Intronic
1019284056 7:215387-215409 ATGGAGAGGATGGGGCTGGGTGG + Intronic
1019284073 7:215431-215453 ATGGAGAGGATGGGGCTGGGTGG + Intronic
1019284105 7:215517-215539 ATGGAGAGGATGGGGCTGGGTGG + Intronic
1019284123 7:215561-215583 ATGGAGAGGATGGGGCTGGGTGG + Intronic
1019284140 7:215605-215627 ATGGAGAGGATGGGGCTGGGTGG + Intronic
1019284186 7:215733-215755 ATGGAGAGGATGGGGCTGGGTGG + Intronic
1019284203 7:215777-215799 ATGGAGAGGATGGGGCTGGGTGG + Intronic
1019284221 7:215821-215843 ATGGAGAGGATGGGGCTGGGTGG + Intronic
1019284281 7:215993-216015 ATGGAGAGGATGGGGCTGGGTGG + Intronic
1019284299 7:216037-216059 ATGGAGAGGATGGGGCTGGGTGG + Intronic
1019284378 7:216257-216279 ATGGAGAGGATGGGGCTGGGTGG + Intronic
1019284396 7:216301-216323 ATGGAGAGGATGGGGCTGGGTGG + Intronic
1019284429 7:216389-216411 ATGGAGAGGATGGGGCTGGGTGG + Intronic
1019284449 7:216433-216455 ATGGAGAGGATGGGGCTGGGTGG + Intronic
1019662431 7:2232447-2232469 GTGGAGAAGTCGGGGCTGCAGGG - Intronic
1020826400 7:13034820-13034842 ATGTGGGAGTTGGGCCTGGTGGG + Intergenic
1021659587 7:22906918-22906940 TTGCAGAAGTTGGGGTTGGAAGG + Intergenic
1022175755 7:27870301-27870323 GTGAGCAAGTTGGGGCTGGAGGG - Intronic
1023410786 7:39887119-39887141 ATGTCCAAGGTGGGGCTGCAGGG + Intergenic
1024704143 7:51938823-51938845 ATGTGGAGCTTGGGGCTGTAGGG + Intergenic
1024725389 7:52188994-52189016 GTGTAGAAGCTGGGGTGGGATGG - Intergenic
1027139669 7:75648254-75648276 TTGGAGTAGTTGGGGCTGGTTGG + Intronic
1030142413 7:106318728-106318750 CTGGAGAAGTTGGGGCTCCATGG + Intergenic
1030468822 7:109937823-109937845 GGGTAGAAGTTCAGGCTGGAAGG + Intergenic
1032428638 7:131842792-131842814 GTGTAGAGGCAGGGGCTGGAAGG - Intergenic
1032463831 7:132131040-132131062 ATGTAGAATTTGGGGCCTCAAGG - Intronic
1032536517 7:132669104-132669126 ATGTTGGAGGTGGGGCTGGTGGG - Intronic
1032594800 7:133228630-133228652 ATGTTGGAGTTGGGGCTTAATGG - Intergenic
1032651414 7:133882786-133882808 TGGTAGGAGATGGGGCTGGAAGG + Intronic
1033056278 7:138057896-138057918 ATGCAGAAGTAGTGGATGGAAGG - Intronic
1033437510 7:141346887-141346909 ATGTTGAAGGTGGGGCCTGATGG + Intronic
1034093107 7:148382158-148382180 AGCCAGAAGCTGGGGCTGGATGG - Intronic
1034293195 7:149948515-149948537 ATGGAGAGGGTGGGGCAGGAAGG - Intergenic
1034812879 7:154148364-154148386 ATGGAGAGGGTGGGGCAGGAAGG + Intronic
1036420274 8:8588972-8588994 ATGTAGAATTTGTGGGGGGAGGG + Intergenic
1036914559 8:12792898-12792920 ATGTTGGAGTTGGGCCTGGTGGG - Intergenic
1037147600 8:15592094-15592116 ATGTAGAAGATGAGGAAGGAAGG + Intronic
1037682199 8:21106805-21106827 ATGCAGAAGTTGGGACTGTGGGG + Intergenic
1039905917 8:41786258-41786280 CTGTAGGAGTCAGGGCTGGAGGG + Intronic
1040024971 8:42773230-42773252 ATTTAGCAAATGGGGCTGGAGGG - Intronic
1042184706 8:66125001-66125023 ATTTACATGTTGGGGCTGGGCGG - Intergenic
1043916552 8:85929321-85929343 ATGTCCATGTGGGGGCTGGAAGG + Intergenic
1044257897 8:90087251-90087273 ATGTAGAAGTAGAAGCTGAATGG + Intronic
1044755180 8:95454162-95454184 ATGTAGGAGTTGGGGGTGGAAGG - Intergenic
1045326187 8:101119409-101119431 ATGTGGATTCTGGGGCTGGAGGG + Intergenic
1045716205 8:105048652-105048674 AGGTAGAAGTTGGGCTTGAAGGG - Intronic
1046092572 8:109520524-109520546 ATGTAGAAGTTAGGGATGGTGGG + Intronic
1047332484 8:123904393-123904415 ATTTAGGAGTGGGGGCTGGCGGG - Intronic
1047514880 8:125545197-125545219 ATGTGGATGTTAGGGCAGGAAGG + Intergenic
1048516288 8:135114427-135114449 ATGTTGGAGGTGGGGCTGGGGGG + Intergenic
1048523894 8:135183444-135183466 ATGTTGGAGGTGGGCCTGGAGGG + Intergenic
1048973399 8:139657625-139657647 CTGCAGAAGTGGGGGATGGATGG + Intronic
1049464572 8:142744955-142744977 ATGGATAAGTGGGGGATGGATGG + Intergenic
1049541752 8:143211828-143211850 ATGAAGAGTTTGGGGCTGGCGGG + Intergenic
1050181469 9:2927420-2927442 ATGTAGATGATGGGGGTTGATGG + Intergenic
1050715628 9:8521911-8521933 ATGCAGAAAAGGGGGCTGGAAGG + Intronic
1051015308 9:12467604-12467626 ATGTAGAAGTTGGGGGGAGGGGG + Intergenic
1051653314 9:19352542-19352564 ATGAAGAAATTATGGCTGGATGG + Exonic
1053665498 9:40314788-40314810 ATGTTGAAGTTGGGGCCTGGGGG + Intronic
1053915085 9:42939835-42939857 ATGTTGAAGTTGGGGCCTGGAGG + Intergenic
1054376653 9:64454818-64454840 ATGTTGAAGTTGGGGCCTGGGGG + Intergenic
1054519116 9:66061496-66061518 ATGTTGAAGTTGGGGCCTGGGGG - Intergenic
1056527465 9:87456671-87456693 ATGTTGGAGGTGGGGCTGGTGGG - Intergenic
1057325586 9:94060822-94060844 ATGTTGAAGGTGGGGCTTGGTGG - Intronic
1057742504 9:97724227-97724249 ATGGAGGAGTTGGGGCAAGAAGG + Intergenic
1058354748 9:104071138-104071160 TTGTTGAAGATGGGGTTGGAGGG + Intergenic
1061967579 9:134025050-134025072 ATGGAGGAGGAGGGGCTGGATGG - Intergenic
1062480324 9:136748036-136748058 CTGTAGAACTGGAGGCTGGAGGG - Intronic
1185672623 X:1824807-1824829 ATGTTGGAGGTGGGGCTGGGTGG - Intergenic
1186698222 X:12060591-12060613 ATGTAAAAGTTAGTGCTGAATGG + Intergenic
1186983121 X:14979638-14979660 ATGTTGAAGTTGGGGCCTAATGG - Intergenic
1187631899 X:21182500-21182522 GTGTAGGAGTTAGGTCTGGATGG - Intergenic
1188504163 X:30863452-30863474 ATGTTGGAGTTGGGGCCTGATGG + Intronic
1188596413 X:31906803-31906825 AAGTAGAAGGTGAGGTTGGAGGG - Intronic
1189426831 X:40909411-40909433 GTGGAAAAGTGGGGGCTGGAGGG + Intergenic
1189646402 X:43137513-43137535 CTGTTGAAGTTGGGGGTGGGGGG - Intergenic
1190777899 X:53568806-53568828 CTGTAGAAGCTGGAGGTGGAGGG + Exonic
1192563911 X:72146822-72146844 AGGAATAAGTTGGGGCTGGTGGG - Intergenic
1194120013 X:89950265-89950287 ATGTTGAAGGTGGGGCCTGATGG - Intergenic
1197700823 X:129598213-129598235 GTGGAGAGGTGGGGGCTGGAGGG - Intergenic
1198129575 X:133680262-133680284 ATACAGCAGTTGGGGTTGGAGGG - Intronic
1198215954 X:134554976-134554998 ATAAAGAAGGTGTGGCTGGAGGG - Intergenic
1198277859 X:135113140-135113162 CTGTGGATGTTTGGGCTGGAAGG - Intergenic
1198746953 X:139900824-139900846 ATTAAGAACTTGGGGTTGGAGGG - Intronic
1200138903 X:153887664-153887686 TTGCAGAAGTTGGGGCTTGGAGG - Intronic
1200144693 X:153920612-153920634 GTGGAGAAGGTGGGCCTGGAGGG - Exonic
1200316991 X:155144774-155144796 ATGTAGATGATGGGGGTTGATGG + Intronic
1200472876 Y:3607782-3607804 ATGTTGAAGGTGGGGCCTGATGG - Intergenic