ID: 966860796

View in Genome Browser
Species Human (GRCh38)
Location 3:184230114-184230136
Sequence GCTGTCGGAAGCGGCGCGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 108}

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966860796_966860815 11 Left 966860796 3:184230114-184230136 CCACCCGCGCCGCTTCCGACAGC 0: 1
1: 0
2: 1
3: 14
4: 108
Right 966860815 3:184230148-184230170 GGGGGCCCCGGGGGGCCGGCAGG 0: 1
1: 1
2: 8
3: 100
4: 937
966860796_966860814 7 Left 966860796 3:184230114-184230136 CCACCCGCGCCGCTTCCGACAGC 0: 1
1: 0
2: 1
3: 14
4: 108
Right 966860814 3:184230144-184230166 CGCGGGGGGCCCCGGGGGGCCGG 0: 1
1: 1
2: 11
3: 84
4: 777
966860796_966860803 -10 Left 966860796 3:184230114-184230136 CCACCCGCGCCGCTTCCGACAGC 0: 1
1: 0
2: 1
3: 14
4: 108
Right 966860803 3:184230127-184230149 TTCCGACAGCTGGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 6
4: 59
966860796_966860811 2 Left 966860796 3:184230114-184230136 CCACCCGCGCCGCTTCCGACAGC 0: 1
1: 0
2: 1
3: 14
4: 108
Right 966860811 3:184230139-184230161 GCGGCCGCGGGGGGCCCCGGGGG 0: 1
1: 0
2: 4
3: 90
4: 630
966860796_966860817 16 Left 966860796 3:184230114-184230136 CCACCCGCGCCGCTTCCGACAGC 0: 1
1: 0
2: 1
3: 14
4: 108
Right 966860817 3:184230153-184230175 CCCCGGGGGGCCGGCAGGTACGG 0: 1
1: 0
2: 0
3: 9
4: 166
966860796_966860821 18 Left 966860796 3:184230114-184230136 CCACCCGCGCCGCTTCCGACAGC 0: 1
1: 0
2: 1
3: 14
4: 108
Right 966860821 3:184230155-184230177 CCGGGGGGCCGGCAGGTACGGGG 0: 1
1: 0
2: 1
3: 9
4: 130
966860796_966860819 17 Left 966860796 3:184230114-184230136 CCACCCGCGCCGCTTCCGACAGC 0: 1
1: 0
2: 1
3: 14
4: 108
Right 966860819 3:184230154-184230176 CCCGGGGGGCCGGCAGGTACGGG 0: 1
1: 0
2: 1
3: 13
4: 138
966860796_966860807 -7 Left 966860796 3:184230114-184230136 CCACCCGCGCCGCTTCCGACAGC 0: 1
1: 0
2: 1
3: 14
4: 108
Right 966860807 3:184230130-184230152 CGACAGCTGGCGGCCGCGGGGGG 0: 1
1: 0
2: 0
3: 7
4: 116
966860796_966860812 3 Left 966860796 3:184230114-184230136 CCACCCGCGCCGCTTCCGACAGC 0: 1
1: 0
2: 1
3: 14
4: 108
Right 966860812 3:184230140-184230162 CGGCCGCGGGGGGCCCCGGGGGG 0: 1
1: 1
2: 7
3: 58
4: 527
966860796_966860808 -1 Left 966860796 3:184230114-184230136 CCACCCGCGCCGCTTCCGACAGC 0: 1
1: 0
2: 1
3: 14
4: 108
Right 966860808 3:184230136-184230158 CTGGCGGCCGCGGGGGGCCCCGG 0: 1
1: 0
2: 4
3: 68
4: 535
966860796_966860810 1 Left 966860796 3:184230114-184230136 CCACCCGCGCCGCTTCCGACAGC 0: 1
1: 0
2: 1
3: 14
4: 108
Right 966860810 3:184230138-184230160 GGCGGCCGCGGGGGGCCCCGGGG 0: 1
1: 0
2: 6
3: 102
4: 781
966860796_966860804 -9 Left 966860796 3:184230114-184230136 CCACCCGCGCCGCTTCCGACAGC 0: 1
1: 0
2: 1
3: 14
4: 108
Right 966860804 3:184230128-184230150 TCCGACAGCTGGCGGCCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 66
966860796_966860806 -8 Left 966860796 3:184230114-184230136 CCACCCGCGCCGCTTCCGACAGC 0: 1
1: 0
2: 1
3: 14
4: 108
Right 966860806 3:184230129-184230151 CCGACAGCTGGCGGCCGCGGGGG 0: 1
1: 0
2: 0
3: 13
4: 158
966860796_966860809 0 Left 966860796 3:184230114-184230136 CCACCCGCGCCGCTTCCGACAGC 0: 1
1: 0
2: 1
3: 14
4: 108
Right 966860809 3:184230137-184230159 TGGCGGCCGCGGGGGGCCCCGGG 0: 1
1: 0
2: 4
3: 34
4: 465
966860796_966860825 30 Left 966860796 3:184230114-184230136 CCACCCGCGCCGCTTCCGACAGC 0: 1
1: 0
2: 1
3: 14
4: 108
Right 966860825 3:184230167-184230189 CAGGTACGGGGGTGGCTGCGAGG 0: 1
1: 0
2: 0
3: 12
4: 262
966860796_966860823 22 Left 966860796 3:184230114-184230136 CCACCCGCGCCGCTTCCGACAGC 0: 1
1: 0
2: 1
3: 14
4: 108
Right 966860823 3:184230159-184230181 GGGGCCGGCAGGTACGGGGGTGG 0: 1
1: 0
2: 1
3: 37
4: 414
966860796_966860822 19 Left 966860796 3:184230114-184230136 CCACCCGCGCCGCTTCCGACAGC 0: 1
1: 0
2: 1
3: 14
4: 108
Right 966860822 3:184230156-184230178 CGGGGGGCCGGCAGGTACGGGGG 0: 1
1: 0
2: 1
3: 6
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966860796 Original CRISPR GCTGTCGGAAGCGGCGCGGG TGG (reversed) Intronic