ID: 966862016

View in Genome Browser
Species Human (GRCh38)
Location 3:184235878-184235900
Sequence GAGGTATACATGACTGTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 2, 2: 6, 3: 19, 4: 242}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966862016 Original CRISPR GAGGTATACATGACTGTGTG TGG (reversed) Intronic
901504022 1:9672862-9672884 GAGGTATATAGGACTCTGTGCGG - Intronic
901632467 1:10654645-10654667 GAGGTCGACACCACTGTGTGTGG + Intronic
901825015 1:11855576-11855598 GAGGTCTATATGACTGTGCCTGG + Intergenic
904430112 1:30458954-30458976 GAGGGGTACCTGGCTGTGTGAGG + Intergenic
904557480 1:31374636-31374658 GAGGTATAAATGAATTTCTGAGG + Intronic
905331796 1:37208174-37208196 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
905939489 1:41851929-41851951 GAGATTTACATGACTTTTTGAGG - Intronic
906643365 1:47455278-47455300 GAGGTTCACATGAGTGTGTGTGG + Intergenic
907388331 1:54140073-54140095 GAGGTATACATGGCCATGCGGGG - Exonic
908872381 1:68628514-68628536 AACATATACATGACTGGGTGCGG + Intergenic
910785982 1:90998315-90998337 GAGGGGTACCTGGCTGTGTGAGG - Intronic
912751154 1:112288747-112288769 GAGGGGTACCTGGCTGTGTGAGG - Intergenic
917383120 1:174436838-174436860 GAGGAGTACCTGGCTGTGTGAGG - Intronic
917710202 1:177677172-177677194 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
918826436 1:189330657-189330679 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
921184636 1:212658775-212658797 GAGGAGTACCCGACTGTGTGAGG - Intergenic
921680469 1:218025090-218025112 GAGGTATGTATCACTGTGGGGGG - Intergenic
1067010894 10:42712793-42712815 AATGTATACATGACAGTGAGAGG + Intergenic
1068366932 10:56063724-56063746 AAGGTATTCATGTGTGTGTGTGG + Intergenic
1071192254 10:83114980-83115002 GAGGTATACATGTGTATGAGAGG + Intergenic
1073856741 10:107684664-107684686 GAGCTATAATTGTCTGTGTGAGG - Intergenic
1075371271 10:121937427-121937449 TAGGCACACATCACTGTGTGTGG - Intergenic
1075484723 10:122812917-122812939 GAGGTAGAGGTGACTGTCTGGGG - Intergenic
1076745957 10:132514480-132514502 GTGGTGTATATGACTGTGTATGG + Intergenic
1076988125 11:253935-253957 GATGTACACATGAGTGTCTGAGG - Intergenic
1080059288 11:27939829-27939851 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1080747748 11:35123922-35123944 GAGGTATGCATAATGGTGTGAGG + Intergenic
1082754788 11:57063508-57063530 GAGGGTTACCTGGCTGTGTGAGG - Intergenic
1082956571 11:58876661-58876683 GAGGAGTACCTGGCTGTGTGAGG + Intronic
1083498235 11:63078326-63078348 GAGGACTACCTGGCTGTGTGAGG + Intergenic
1084314578 11:68337700-68337722 GAGGTAGACCTGACTATGGGTGG - Intronic
1086544467 11:87951769-87951791 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1089237197 11:117039980-117040002 GTGGTAGAGATGAGTGTGTGGGG - Intronic
1091215986 11:133902508-133902530 GTGGTGTGCATGTCTGTGTGTGG - Intergenic
1092772488 12:11909910-11909932 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1092967681 12:13660230-13660252 GTGTTATTCATGCCTGTGTGTGG - Intronic
1093660914 12:21755497-21755519 GAGGAATAAATGTATGTGTGTGG + Intronic
1095428973 12:42111906-42111928 GAGGAGTACCTGGCTGTGTGAGG - Intronic
1095483360 12:42658740-42658762 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1095816264 12:46426299-46426321 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1095873715 12:47057480-47057502 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1096926774 12:55156817-55156839 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1096962977 12:55598832-55598854 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1100656968 12:96657218-96657240 GAGGTATACACAAATGTGTCAGG + Intronic
1103477074 12:121226717-121226739 GAGGTACACAGGTGTGTGTGTGG + Intronic
1104472618 12:129042917-129042939 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1104655397 12:130570715-130570737 GAGTCCTATATGACTGTGTGTGG - Intronic
1105072790 12:133245694-133245716 GAGGGGTACCTCACTGTGTGAGG - Intergenic
1108115476 13:47122859-47122881 GATGCATCCATGAGTGTGTGAGG + Intergenic
1109320568 13:60805247-60805269 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1111637103 13:90919655-90919677 CAGGTAGGCATGTCTGTGTGTGG - Intergenic
1114386483 14:22260940-22260962 GAGGGATACCTGGCCGTGTGAGG + Intergenic
1114691517 14:24587058-24587080 GAGGAGTACCTGACTGTGTGAGG + Intergenic
1115587130 14:34825489-34825511 GATGTATAAATGACTGAATGAGG + Intronic
1115968808 14:38922428-38922450 GAGGGATACCTGGCCGTGTGAGG - Intergenic
1117104606 14:52384931-52384953 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1118067089 14:62204479-62204501 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1118553764 14:66989018-66989040 GAGATACACATGACTATGTGTGG - Intronic
1118958190 14:70502069-70502091 GAGGGGTACCTGGCTGTGTGAGG - Intergenic
1119349731 14:73954320-73954342 TAGGTACACATGACTGTGCCTGG - Intronic
1122979782 14:105186309-105186331 GGGGTGTACATGAGTGTGTGGGG + Intergenic
1126248720 15:46541626-46541648 GAGGAGTACCCGACTGTGTGAGG + Intergenic
1126450539 15:48803901-48803923 GAGGTATTCATGACTGGGCTTGG - Intronic
1127307195 15:57719022-57719044 AAGATATTCATGACTGTGTGAGG + Intronic
1128854101 15:70992755-70992777 GAGGGGTACCTGGCTGTGTGAGG + Intronic
1130922323 15:88357826-88357848 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1133759472 16:8786786-8786808 CAGGCATACAAGACTGGGTGTGG + Intronic
1134246917 16:12547067-12547089 GAGGCAGACATGCCTATGTGAGG + Intronic
1134765032 16:16750406-16750428 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1134981021 16:18608805-18608827 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1135185055 16:20308460-20308482 TGGGTATACAGGCCTGTGTGGGG + Intergenic
1136606643 16:31338638-31338660 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1138375542 16:56561289-56561311 GAGGCAGACAAGACTGTGGGAGG + Intergenic
1139594700 16:67950854-67950876 GAGCTATATATGAGTGTGTGGGG + Intronic
1140476348 16:75241135-75241157 GACGTACACGTGTCTGTGTGTGG + Intronic
1140539186 16:75740200-75740222 GAGGCATACCTGGCCGTGTGAGG + Intronic
1142538636 17:639772-639794 GAGGGGTACGTGGCTGTGTGAGG + Intronic
1142765706 17:2063045-2063067 GTGGTATGCAGGGCTGTGTGGGG + Intronic
1143592014 17:7890864-7890886 TAGGTAGACAGGCCTGTGTGCGG + Intronic
1145731231 17:27188298-27188320 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1145954072 17:28842605-28842627 GAAGGATACATGACTTTGTGGGG - Intronic
1146739998 17:35275124-35275146 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1150971813 17:70036776-70036798 GAGGTATATATTATTATGTGAGG + Intergenic
1153582919 18:6593652-6593674 GAGGTACACATGACTGGGGGAGG - Intergenic
1154320604 18:13348444-13348466 GAGGAGTACCTGGCTGTGTGAGG + Intronic
1155361605 18:25008652-25008674 GATGTATTCATGTTTGTGTGTGG + Intergenic
1156206889 18:34895535-34895557 GAGGAATACCTGGCCGTGTGAGG - Intergenic
1157280969 18:46346075-46346097 GTGGGATGCATGACTGGGTGAGG + Intronic
1158054261 18:53260575-53260597 GAGGAGTACCTGGCTGTGTGAGG + Intronic
1158287038 18:55895285-55895307 CAGGAATATATGACTGTGTACGG + Intergenic
1159761111 18:72428684-72428706 GAGATAGACATGGCTGGGTGTGG + Intergenic
1162972372 19:14188437-14188459 GAAGTATACATGGCTCTGGGGGG - Intronic
1163326364 19:16605926-16605948 AAGCTCTACATCACTGTGTGCGG + Intronic
1164265662 19:23614165-23614187 GAGGGCTACCTGGCTGTGTGAGG - Intronic
1167404630 19:49297016-49297038 GAGGTAAACAGAACTGTCTGAGG + Intronic
1167498777 19:49834203-49834225 CAGGTATCCGTGACTGTCTGGGG + Intronic
1168126805 19:54288495-54288517 GTGGGAAACATGACTGTGGGGGG + Intergenic
927239708 2:20910839-20910861 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
929303133 2:40328976-40328998 GAGGGATACATTAATGTGTCTGG - Intronic
930922742 2:56777220-56777242 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
931818587 2:65929559-65929581 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
933203612 2:79479630-79479652 GAGGAATACCTGGCTGGGTGTGG + Intronic
933420150 2:82034503-82034525 GAGGTATATATGAATGTGAGAGG + Intergenic
943125354 2:183789378-183789400 GAGGGGTACCTGGCTGTGTGGGG - Intergenic
944447928 2:199810440-199810462 GAGGTTTATAAGTCTGTGTGAGG - Intronic
946099842 2:217310675-217310697 AAGGTTTAAATGAGTGTGTGTGG - Intronic
947090778 2:226508919-226508941 TAGTTATACATGACTGAGTCTGG - Intergenic
1169888739 20:10431281-10431303 GTGGGATACATGACTGTGTTTGG - Intronic
1170082542 20:12492356-12492378 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1173265913 20:41480576-41480598 GTTGTATACATGACGGTATGAGG + Intronic
1175832302 20:61972491-61972513 GAGGTCTTCATGACTGGGAGTGG - Intronic
1176366841 21:6038344-6038366 GTGGTATGCATGTGTGTGTGAGG + Intergenic
1178345117 21:31819596-31819618 GAGGGGTACCTGGCTGTGTGAGG + Intergenic
1178732015 21:35112761-35112783 CATGTATACTTGAGTGTGTGAGG + Intronic
1179756677 21:43500200-43500222 GTGGTATGCATGTGTGTGTGAGG - Intergenic
1180108472 21:45635521-45635543 GTGATATACATGTATGTGTGTGG + Intergenic
1181262935 22:21611620-21611642 GTGGTGCACATGTCTGTGTGTGG + Intronic
1182180169 22:28339263-28339285 GAGGAGTACCTGGCTGTGTGAGG + Intronic
1183274687 22:36886329-36886351 GAGGTAGACAGGACTATGTGTGG - Intergenic
1185401577 22:50621094-50621116 TACGTGTACATGCCTGTGTGAGG + Intergenic
949342585 3:3045398-3045420 GAGGGGTACCTGGCTGTGTGAGG - Intronic
953914281 3:46908707-46908729 GAGGCAAACCTGAGTGTGTGCGG + Intergenic
955630239 3:60965811-60965833 GAGGGGTACCTGGCTGTGTGAGG + Intronic
955637310 3:61043746-61043768 GAGGGGTACTTGGCTGTGTGAGG - Intronic
955789806 3:62576875-62576897 GAGGTACACATGTCTGGGTTTGG + Intronic
955964827 3:64378486-64378508 GAAGGTTACATGAATGTGTGTGG - Intronic
959117685 3:102196908-102196930 GTGGTTGACATGCCTGTGTGTGG - Intronic
959148412 3:102577734-102577756 GAATGATACAGGACTGTGTGGGG - Intergenic
959473075 3:106776556-106776578 GAGGTTTACATGAGTGTCTTGGG - Intergenic
959569288 3:107866191-107866213 GAGGTAAACAAGCCTGTATGAGG + Intergenic
961956100 3:130805390-130805412 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
962023421 3:131524162-131524184 TTGGTATTCATAACTGTGTGTGG - Intergenic
964243249 3:154620112-154620134 GAGGGGTACCTGGCTGTGTGAGG - Intergenic
964496240 3:157293344-157293366 GAGGTACACATGACTATATGAGG + Intronic
964564528 3:158034898-158034920 GAGGGGTACCTGCCTGTGTGAGG - Intergenic
964860416 3:161195682-161195704 GAGGGGTACCTGGCTGTGTGAGG + Intronic
966024398 3:175258404-175258426 TATGTATACTTGCCTGTGTGGGG + Intronic
966495072 3:180570871-180570893 TAAGTATACATGTATGTGTGTGG + Intergenic
966861979 3:184235640-184235662 GAGGTACACATGGCTGTGTGTGG - Intronic
966861984 3:184235670-184235692 GAGGTACACATGGCTGTGTGTGG - Intronic
966861989 3:184235700-184235722 GAGGTACACATGGCTGTGTGTGG - Intronic
966861994 3:184235730-184235752 GAGGTACACATGGCTGTGTGTGG - Intronic
966861999 3:184235760-184235782 GAGGTGTACATGGCTGTGTGTGG - Intronic
966862004 3:184235790-184235812 GAAGTACACATGACTGTGTGTGG - Intronic
966862012 3:184235848-184235870 GAGGTGTACATGACTGTGTGTGG - Intronic
966862016 3:184235878-184235900 GAGGTATACATGACTGTGTGTGG - Intronic
966862024 3:184235936-184235958 GAGGTACACATGACTGTGTGTGG - Intronic
967884936 3:194326774-194326796 GTGGTATGTGTGACTGTGTGTGG - Intergenic
968914159 4:3489859-3489881 GAGGCATCCATGCATGTGTGGGG + Intronic
969061506 4:4438997-4439019 GTGGTATATATGTGTGTGTGTGG - Intronic
970020124 4:11558206-11558228 GAGGTGTACCCGGCTGTGTGAGG - Intergenic
970328965 4:14959115-14959137 GAGGGAAACAGGACGGTGTGTGG - Intergenic
970828300 4:20305256-20305278 GGTGTATATATGTCTGTGTGGGG - Intronic
973859006 4:55042045-55042067 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
974821072 4:67067739-67067761 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
974937065 4:68420947-68420969 GAGGGATACCTGGCTGTATGAGG - Intergenic
975426936 4:74240579-74240601 TGTGTATGCATGACTGTGTGTGG - Intronic
976143753 4:82020321-82020343 GAGGAGTACCTGGCTGTGTGAGG - Intronic
977074292 4:92433258-92433280 GAGGTGTACATGACATAGTGAGG - Intronic
977580929 4:98724034-98724056 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
978336315 4:107672830-107672852 GAGGAGTACCTGGCTGTGTGAGG - Intronic
978694923 4:111565893-111565915 GAGGGGTACCTGGCTGTGTGAGG - Intergenic
979592255 4:122493673-122493695 GAGGAGTACCCGACTGTGTGAGG - Intergenic
980231464 4:130051569-130051591 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
980282651 4:130740159-130740181 GAGGTCTACATGAGAGTGTTTGG - Intergenic
981538537 4:145824915-145824937 TAGTTTTACATGACTGTGTTAGG + Intronic
981878482 4:149578512-149578534 GAGGAATAAATAACTGTGTTGGG - Intergenic
985418758 4:189762109-189762131 GTTATATACACGACTGTGTGAGG + Intergenic
986878400 5:12139406-12139428 TAGGTGTTCATCACTGTGTGCGG + Intergenic
987554065 5:19422836-19422858 GAGGTATAAATGTTTGTGTATGG + Intergenic
988690751 5:33569366-33569388 GAGGAGTACCTGACCGTGTGAGG - Intronic
988871652 5:35396848-35396870 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
989232678 5:39103965-39103987 GAGGAATACATGTGTGGGTGGGG + Intergenic
989284877 5:39687895-39687917 GAGGGGTACCTGGCTGTGTGAGG + Intergenic
990437536 5:55808689-55808711 GAGGAGTACCTGGCTGTGTGAGG + Intronic
990768302 5:59213177-59213199 GAGGAAGACAAGACTGTGTCTGG - Intronic
992235777 5:74707061-74707083 GAGGAATACCCGGCTGTGTGAGG - Intronic
992811801 5:80396490-80396512 GAGGGGTACCTGGCTGTGTGAGG + Intergenic
994266512 5:97723153-97723175 GAGGAGTACCTGACTGTGTGAGG + Intergenic
994572275 5:101529644-101529666 GAGGGGTACCTGGCTGTGTGAGG - Intergenic
994781203 5:104093201-104093223 AAATTATACATGACTCTGTGTGG - Intergenic
995348111 5:111144003-111144025 GAGTTTTAAATGTCTGTGTGTGG + Intergenic
995364881 5:111347279-111347301 GAGGTCTACATGACAGTGGTTGG + Intronic
995570135 5:113471543-113471565 GAGGAGTACCTGGCTGTGTGAGG + Intronic
997112256 5:131087910-131087932 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
999053020 5:148544341-148544363 TGGGTTTACATGAGTGTGTGTGG - Intronic
1000587836 5:163122203-163122225 GAGGGATACCTGGCTGTGTGAGG + Intergenic
1001324849 5:170715553-170715575 TAGGTATTCATCACTGTGTGAGG + Intronic
1001983412 5:176052511-176052533 GAGGGGTACCTGGCTGTGTGAGG - Intronic
1002234057 5:177791541-177791563 GAGGGGTACCTGGCTGTGTGAGG + Intronic
1004676050 6:17843413-17843435 TAGGTAAACATTACTGGGTGGGG + Intronic
1009903370 6:69837417-69837439 AAGGAATCCATGACTGGGTGTGG - Intergenic
1010271277 6:73918274-73918296 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1010463744 6:76143097-76143119 GAGGGATACTTGGCCGTGTGAGG + Intergenic
1012220082 6:96638509-96638531 GAGGAGTACATGGCCGTGTGAGG - Intergenic
1012595145 6:101030689-101030711 GAGGGGTACCTGGCTGTGTGAGG + Intergenic
1012925249 6:105261053-105261075 GAGCTATCCATAACTGTGAGAGG + Intergenic
1014345795 6:120268111-120268133 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1014849810 6:126327359-126327381 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1014928185 6:127300119-127300141 AAGCAATACATGACTGTATGTGG + Intronic
1016838599 6:148504364-148504386 GTGGAATATGTGACTGTGTGCGG - Intronic
1017653610 6:156605452-156605474 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1019282734 7:208563-208585 GGTGTGTACATGGCTGTGTGGGG + Intronic
1020799494 7:12716402-12716424 GTGCTATACATGGATGTGTGGGG - Intergenic
1021345250 7:19519483-19519505 TAGGTAACCATGACTGTGTCTGG - Intergenic
1023411995 7:39897020-39897042 AAGGTATACTTGGCTGGGTGCGG + Intergenic
1023794191 7:43778530-43778552 GAGGAGTACCTGGCTGTGTGAGG + Intronic
1024588546 7:50861358-50861380 GAGGTATACCTGGCTGTCTGGGG - Intergenic
1025868395 7:65407178-65407200 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1027330689 7:77089911-77089933 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1027856452 7:83518026-83518048 CAGGTAAACATGTCTGTGTGTGG + Intronic
1028919714 7:96297712-96297734 GAGGTATACATGCCTGTTCATGG - Intronic
1030510113 7:110472973-110472995 GAGGGGTACCTGGCTGTGTGAGG - Intergenic
1031366035 7:120901470-120901492 GAGGGATACCTGCCTGTATGAGG - Intergenic
1031772914 7:125868421-125868443 GAAGTATACAGGACTTTGTCAGG + Intergenic
1038870536 8:31489184-31489206 GAGGGGTACCTGGCTGTGTGAGG + Intergenic
1039423096 8:37461042-37461064 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1039593445 8:38769791-38769813 GGTGTGTATATGACTGTGTGTGG + Intronic
1040364779 8:46704633-46704655 GAGGAGTACACGGCTGTGTGAGG + Intergenic
1040389989 8:46941466-46941488 GAGGGGTACCTGGCTGTGTGAGG - Intergenic
1040438978 8:47421981-47422003 GAGGAGTACCTGGCTGTGTGAGG + Intronic
1040909911 8:52507227-52507249 GAGGGGTACCTGGCTGTGTGAGG - Intergenic
1041244060 8:55874339-55874361 GAGCTTTACATCACTCTGTGGGG - Intergenic
1041562620 8:59237240-59237262 GAGGTATACATGGGGTTGTGGGG - Intergenic
1041845322 8:62321701-62321723 GAGGAGTACCTGGCTGTGTGAGG + Intronic
1042534434 8:69844053-69844075 GAGGTGTACCCGGCTGTGTGAGG - Intergenic
1042641823 8:70944459-70944481 GAGGAGTACATGAGAGTGTGAGG + Intergenic
1043535954 8:81204796-81204818 GAGGGGTACCTGGCTGTGTGAGG + Intergenic
1043835808 8:85044392-85044414 GAGGAGTACATGACAGTGAGTGG - Intergenic
1045293495 8:100853077-100853099 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1045360336 8:101426515-101426537 GAGGAATACCCGGCTGTGTGAGG - Intergenic
1045709224 8:104964065-104964087 GAGGGGTACCTGGCTGTGTGAGG + Intronic
1045963899 8:108001225-108001247 GGGGTATTCATGACTGTTTTTGG - Intronic
1046812670 8:118549300-118549322 GAGGAGTACCTGGCTGTGTGAGG - Intronic
1048090653 8:131237010-131237032 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1049907776 9:235269-235291 GAGGAGTACCTGGCTGTGTGAGG + Intronic
1050139038 9:2498220-2498242 GGGGTGTGGATGACTGTGTGAGG - Intergenic
1050439364 9:5644730-5644752 TTTGTATACATGTCTGTGTGTGG + Intronic
1051739171 9:20235098-20235120 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1056697910 9:88875747-88875769 GAGGTATACATGAATGTTCATGG - Intergenic
1056757276 9:89389646-89389668 AAACTACACATGACTGTGTGTGG + Intronic
1056913610 9:90725815-90725837 GATGACTTCATGACTGTGTGGGG - Intergenic
1057082215 9:92181428-92181450 GGGGTACAGATGACTCTGTGAGG + Intergenic
1057924576 9:99132889-99132911 GATGTATATATGACTGTGGCTGG + Intronic
1058207951 9:102131573-102131595 GAGGGATACCTGGCCGTGTGAGG - Intergenic
1058222072 9:102314651-102314673 TAGGAATGCATGAGTGTGTGAGG + Intergenic
1058697997 9:107576096-107576118 GAGGTATGAAAGCCTGTGTGGGG + Intergenic
1060306109 9:122414015-122414037 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1061632969 9:131885179-131885201 GGGGATTACATGAGTGTGTGTGG - Intronic
1062510115 9:136900518-136900540 GAGGTAAAGATGCCTGCGTGTGG + Exonic
1186571131 X:10715814-10715836 GAGGAGTACCTGGCTGTGTGAGG - Intronic
1187191131 X:17036485-17036507 GAGATATACTGGAGTGTGTGTGG + Intronic
1187624001 X:21089936-21089958 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1188371870 X:29379237-29379259 CATGTATACATTCCTGTGTGGGG + Intronic
1191631023 X:63322345-63322367 GAGGCATACACAACTGTGGGTGG - Intergenic
1192101113 X:68265298-68265320 GAGGAGTACCTGGCTGTGTGAGG - Intronic
1192683783 X:73282117-73282139 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1192993506 X:76487917-76487939 GAGGGGTACCTGGCTGTGTGAGG + Intergenic
1193735139 X:85147592-85147614 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1195557055 X:106238773-106238795 GTGGTCTACATGACAGTGGGGGG + Intergenic
1195934285 X:110110220-110110242 AAGGTATACATGAATATTTGTGG - Intronic
1196527679 X:116745945-116745967 GAGGTGTACATAACAGTCTGAGG + Intergenic
1197543027 X:127789538-127789560 GAGGAATACCTGGCCGTGTGAGG - Intergenic
1197919130 X:131571668-131571690 GATGTATACATTAATGTGTTTGG + Intergenic
1198474437 X:136982496-136982518 GAGGGGTACCCGACTGTGTGAGG + Intergenic
1199849968 X:151718708-151718730 GAGGTAGACCTGACTGTTTTAGG + Intronic
1200879183 Y:8194225-8194247 GAGGAGTACCTGACTGTGTGAGG - Intergenic
1201599642 Y:15713750-15713772 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1202344325 Y:23905737-23905759 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1202526443 Y:25764346-25764368 GAGGAGTACCTGGCTGTGTGAGG - Intergenic