ID: 966862024

View in Genome Browser
Species Human (GRCh38)
Location 3:184235936-184235958
Sequence GAGGTACACATGACTGTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 6, 2: 5, 3: 12, 4: 221}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966862024_966862029 10 Left 966862024 3:184235936-184235958 CCACACACAGTCATGTGTACCTC 0: 1
1: 6
2: 5
3: 12
4: 221
Right 966862029 3:184235969-184235991 CACAGTCTCTCACACACACTTGG 0: 1
1: 0
2: 6
3: 66
4: 661
966862024_966862032 13 Left 966862024 3:184235936-184235958 CCACACACAGTCATGTGTACCTC 0: 1
1: 6
2: 5
3: 12
4: 221
Right 966862032 3:184235972-184235994 AGTCTCTCACACACACTTGGGGG 0: 1
1: 1
2: 0
3: 13
4: 190
966862024_966862033 21 Left 966862024 3:184235936-184235958 CCACACACAGTCATGTGTACCTC 0: 1
1: 6
2: 5
3: 12
4: 221
Right 966862033 3:184235980-184236002 ACACACACTTGGGGGCTCACTGG 0: 1
1: 0
2: 2
3: 8
4: 141
966862024_966862030 11 Left 966862024 3:184235936-184235958 CCACACACAGTCATGTGTACCTC 0: 1
1: 6
2: 5
3: 12
4: 221
Right 966862030 3:184235970-184235992 ACAGTCTCTCACACACACTTGGG 0: 1
1: 0
2: 0
3: 28
4: 325
966862024_966862031 12 Left 966862024 3:184235936-184235958 CCACACACAGTCATGTGTACCTC 0: 1
1: 6
2: 5
3: 12
4: 221
Right 966862031 3:184235971-184235993 CAGTCTCTCACACACACTTGGGG 0: 1
1: 0
2: 2
3: 24
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966862024 Original CRISPR GAGGTACACATGACTGTGTG TGG (reversed) Intronic
900734753 1:4291563-4291585 GAGGTACACATGCATAGGTGGGG + Intergenic
901504022 1:9672862-9672884 GAGGTATATAGGACTCTGTGCGG - Intronic
901632467 1:10654645-10654667 GAGGTCGACACCACTGTGTGTGG + Intronic
902392675 1:16115538-16115560 GAGCTACACTGGTCTGTGTGGGG - Intergenic
906508917 1:46400222-46400244 GAGGTGCACATGAGTCTGAGAGG + Intronic
906643365 1:47455278-47455300 GAGGTTCACATGAGTGTGTGTGG + Intergenic
912704175 1:111899689-111899711 CAGGTACACATGTGAGTGTGTGG + Intronic
913261592 1:117003354-117003376 TAGGTACATATGATAGTGTGAGG + Intronic
917464280 1:175261620-175261642 GAGGGACACCTGCCTGTATGAGG + Intergenic
917579126 1:176356599-176356621 GAGGGACACCTGCCTGTATGAGG - Intergenic
920878937 1:209862572-209862594 CATGTGCTCATGACTGTGTGTGG + Intergenic
1063230723 10:4063346-4063368 GTGTTACACATCAGTGTGTGAGG + Intergenic
1064682301 10:17822916-17822938 GAGGTACTGATGACTGTGCCTGG - Intronic
1065989986 10:30999549-30999571 CAGGAACACATGACTCAGTGTGG - Intronic
1066755121 10:38703726-38703748 GAGGGACACTTGGCTGTATGAGG - Intergenic
1069453199 10:68533821-68533843 GAGGAACAGAAGACTGTGAGTGG + Intergenic
1070433067 10:76360677-76360699 GAGGTACAAATGTATTTGTGGGG + Intronic
1072000748 10:91193520-91193542 GAGGTACACCTGCGTGTTTGAGG + Intronic
1072370127 10:94757807-94757829 GAGGGGCACCTGGCTGTGTGAGG + Intronic
1072847368 10:98846847-98846869 CAGGTACACATCACTGTGCCCGG + Intronic
1073745940 10:106467989-106468011 GAGGGACACCTGCCTGTATGAGG - Intergenic
1075371271 10:121937427-121937449 TAGGCACACATCACTGTGTGTGG - Intergenic
1075484723 10:122812917-122812939 GAGGTAGAGGTGACTGTCTGGGG - Intergenic
1076590891 10:131581351-131581373 GAGGGGCACCTGGCTGTGTGAGG + Intergenic
1076988125 11:253935-253957 GATGTACACATGAGTGTCTGAGG - Intergenic
1081413656 11:42788208-42788230 GAGGCCCACAGGTCTGTGTGGGG + Intergenic
1082657151 11:55869560-55869582 GAGGTGCACAGGCCTGTGGGGGG - Intergenic
1083531637 11:63428543-63428565 GAGGGACACCTGCCTGTATGAGG - Intergenic
1084237066 11:67795047-67795069 TAGGTACTCATAACTATGTGTGG + Intergenic
1084314578 11:68337700-68337722 GAGGTAGACCTGACTATGGGTGG - Intronic
1085298859 11:75446690-75446712 TGGGTCCACATGTCTGTGTGTGG - Intronic
1085800773 11:79586826-79586848 GAGGGACACCTGCCTGTATGAGG - Intergenic
1087077836 11:94142107-94142129 GCGGGACACAGGACTGCGTGGGG + Intronic
1088968960 11:114754630-114754652 GAGGTCCTCAGGGCTGTGTGTGG + Intergenic
1089237197 11:117039980-117040002 GTGGTAGAGATGAGTGTGTGGGG - Intronic
1089670218 11:120051636-120051658 GAGGTCCAAGTGTCTGTGTGAGG - Intergenic
1091023439 11:132121674-132121696 GAGGGACACAGAGCTGTGTGAGG - Intronic
1091652829 12:2322616-2322638 GAGGAACACCTGACTTTGGGAGG - Intronic
1091922363 12:4315648-4315670 GAGGTACACATGAATTGTTGGGG - Intergenic
1092560824 12:9611074-9611096 GAGGGACACCTGGCTGTATGAGG - Intergenic
1092562617 12:9632646-9632668 GAGGGACACCTGGCTGTATGAGG + Intergenic
1095706389 12:45241951-45241973 GAGGGACACCTGCCTGTATGAGG + Intronic
1095805254 12:46312431-46312453 GAGGGACACCTGGCCGTGTGAGG + Intergenic
1099733883 12:86540918-86540940 GAGGTACACAAGGGTGGGTGAGG + Intronic
1100965799 12:100011452-100011474 GAGGGGCACCTGGCTGTGTGAGG - Intergenic
1103477074 12:121226717-121226739 GAGGTACACAGGTGTGTGTGTGG + Intronic
1103997918 12:124842048-124842070 GGGGCACACAGGACTGTGGGAGG - Intronic
1105688975 13:22816661-22816683 AAGGAACATATGACTGGGTGCGG + Intergenic
1111637103 13:90919655-90919677 CAGGTAGGCATGTCTGTGTGTGG - Intergenic
1112192210 13:97188925-97188947 GAGGGACAGATGAGTCTGTGTGG - Intergenic
1112389190 13:98967299-98967321 GAACTACACATAACTATGTGTGG - Intronic
1112951370 13:105001155-105001177 GAGACACACCTGACTGTGGGAGG - Intergenic
1113145965 13:107207786-107207808 CAGGTGCACATAACTGTGTCTGG + Intronic
1114691517 14:24587058-24587080 GAGGAGTACCTGACTGTGTGAGG + Intergenic
1114744280 14:25131065-25131087 GAGATACACATCACTGGGTACGG + Intergenic
1118553764 14:66989018-66989040 GAGATACACATGACTATGTGTGG - Intronic
1118559828 14:67067334-67067356 GAGGGACACCTGCCTGTATGAGG + Intronic
1118935886 14:70287831-70287853 GAGGTACATATGCATGTCTGGGG + Intergenic
1119349731 14:73954320-73954342 TAGGTACACATGACTGTGCCTGG - Intronic
1119854729 14:77891036-77891058 TGGGTACAGATGAGTGTGTGGGG + Intronic
1122597362 14:102902721-102902743 GAGGGACACATGGGAGTGTGAGG + Intronic
1122979782 14:105186309-105186331 GGGGTGTACATGAGTGTGTGGGG + Intergenic
1123412518 15:20072370-20072392 GACGTACATGTGTCTGTGTGTGG + Intergenic
1123521860 15:21079483-21079505 GACGTACATGTGTCTGTGTGTGG + Intergenic
1125657049 15:41366580-41366602 GAGGTACATATACCTGGGTGCGG - Intronic
1127307195 15:57719022-57719044 AAGATATTCATGACTGTGTGAGG + Intronic
1134246917 16:12547067-12547089 GAGGCAGACATGCCTATGTGAGG + Intronic
1135765686 16:25176102-25176124 AAGGTGCACATGCCTGTCTGTGG + Intronic
1136683883 16:31983128-31983150 GACGCCCACATGACTTTGTGTGG - Intergenic
1136727559 16:32373118-32373140 GAGGGACACCTGGCTGTATGAGG + Intergenic
1136784512 16:32926680-32926702 GATGCCCACATGACTTTGTGTGG - Intergenic
1136885271 16:33927126-33927148 GATGCCCACATGACTTTGTGTGG + Intergenic
1137608289 16:49801532-49801554 GAAGTGCACATCACAGTGTGTGG - Intronic
1138375542 16:56561289-56561311 GAGGCAGACAAGACTGTGGGAGG + Intergenic
1139556991 16:67718819-67718841 GCGGACCACCTGACTGTGTGAGG - Intronic
1139594700 16:67950854-67950876 GAGCTATATATGAGTGTGTGGGG + Intronic
1140476348 16:75241135-75241157 GACGTACACGTGTCTGTGTGTGG + Intronic
1141119414 16:81340391-81340413 GAGGGGCACCTGCCTGTGTGAGG - Intronic
1202998874 16_KI270728v1_random:144632-144654 GAGGGACACCTGGCTGTATGAGG - Intergenic
1203087171 16_KI270728v1_random:1190686-1190708 GATGCCCACATGACTTTGTGTGG - Intergenic
1203130472 16_KI270728v1_random:1681040-1681062 GAGGGACACCTGGCTGTATGAGG - Intergenic
1143474441 17:7194616-7194638 GAGGAACCCAAAACTGTGTGGGG + Intronic
1143592014 17:7890864-7890886 TAGGTAGACAGGCCTGTGTGCGG + Intronic
1145954072 17:28842605-28842627 GAAGGATACATGACTTTGTGGGG - Intronic
1146486736 17:33249209-33249231 GAGATACAGAAGACTGTGGGTGG + Intronic
1147141651 17:38463785-38463807 GTGGTGCACATGACGGTGGGTGG - Intronic
1147144811 17:38478831-38478853 GACGCCCACATGACTTTGTGTGG - Intronic
1151595678 17:75076953-75076975 CAGGCACACAAGACTGAGTGGGG - Intergenic
1151601909 17:75110979-75111001 CAGGTGCACACCACTGTGTGCGG - Intronic
1152815852 17:82407377-82407399 CAGGGACACATGACTGTGACTGG - Intronic
1153441333 18:5122745-5122767 GAGGGGCACCTGACTGTTTGAGG - Intergenic
1153582919 18:6593652-6593674 GAGGTACACATGACTGGGGGAGG - Intergenic
1155271097 18:24141888-24141910 AAGGTACAAATGACAGTGGGTGG + Intronic
1155325134 18:24657401-24657423 GAGGTACAAATGACAGCCTGAGG + Intergenic
1157561527 18:48649715-48649737 GAGGTGCACCTGCCTGTATGAGG - Intronic
1159761111 18:72428684-72428706 GAGATAGACATGGCTGGGTGTGG + Intergenic
1160826350 19:1082253-1082275 GAGGCACACCTGACGCTGTGCGG + Intronic
1162280891 19:9697005-9697027 CAGGTGCACACCACTGTGTGGGG + Intronic
1167404630 19:49297016-49297038 GAGGTAAACAGAACTGTCTGAGG + Intronic
1168126805 19:54288495-54288517 GTGGGAAACATGACTGTGGGGGG + Intergenic
1168229104 19:55017588-55017610 GAGCTTCAAGTGACTGTGTGTGG + Intronic
925924318 2:8659486-8659508 GAGCCACACATGACTGGGTTGGG - Intergenic
928492269 2:31796081-31796103 GAGGGGCACCTGGCTGTGTGAGG - Intergenic
928823336 2:35390032-35390054 GAGGATCACCTGACTCTGTGAGG + Intergenic
931305230 2:61021782-61021804 GAGGGACACCTGCCTGTTTGAGG - Intronic
933420150 2:82034503-82034525 GAGGTATATATGAATGTGAGAGG + Intergenic
933880489 2:86664422-86664444 GAGGGGCACCTGTCTGTGTGAGG - Intronic
934318413 2:91947959-91947981 GAGGGACACCTGGCTGTATGAGG - Intergenic
934531661 2:95093470-95093492 GAGGGACACCTGGCTGTATGAGG - Intronic
938376897 2:130813869-130813891 GAGGCTCACATGACTGTTTCTGG + Intergenic
939300311 2:140329157-140329179 GAGGTACCCATGAGTATGTAGGG - Intronic
939882532 2:147646560-147646582 GAGGTACAAATGTCTGGCTGTGG - Intergenic
942983522 2:182110932-182110954 GAGGGGCACATGACTGTGGAGGG + Intronic
948736409 2:240009280-240009302 GAGGTACACAAGACAGAGTAGGG - Intronic
1169619230 20:7486538-7486560 GAGGTACACCTGACTCTAAGAGG - Intergenic
1169888739 20:10431281-10431303 GTGGGATACATGACTGTGTTTGG - Intronic
1171434153 20:25105999-25106021 GAGGGACACCTGGCCGTGTGAGG - Intergenic
1174187074 20:48713593-48713615 CAGGTGCACATCACTGTGTCTGG - Intronic
1175461392 20:59154324-59154346 AAGGTACACATAACCGTGTTGGG + Intergenic
1178358917 21:31932148-31932170 TAAGTACACATGAGTTTGTGTGG - Intronic
1180306597 22:11131641-11131663 GAGGGACACCTGGCTGTATGAGG - Intergenic
1180545115 22:16493824-16493846 GAGGGACACCTGGCTGTATGAGG - Intergenic
1181262935 22:21611620-21611642 GTGGTGCACATGTCTGTGTGTGG + Intronic
1183274687 22:36886329-36886351 GAGGTAGACAGGACTATGTGTGG - Intergenic
1184962712 22:47943298-47943320 TAGGTACACATGACACAGTGAGG - Intergenic
1185416041 22:50710908-50710930 GCGGCACACATGTCTGTGCGTGG + Intergenic
1185416051 22:50711022-50711044 GTGGCACACATGTCTGTGCGTGG + Intergenic
950297761 3:11846748-11846770 GAGGGACACAAGGCTGAGTGTGG + Exonic
951833723 3:26959075-26959097 GAGGTGCACCTGCCTGTATGAGG + Intergenic
953914281 3:46908707-46908729 GAGGCAAACCTGAGTGTGTGCGG + Intergenic
954168957 3:48784530-48784552 TAGGTACAGATGTCTGTGTTTGG - Intronic
955789806 3:62576875-62576897 GAGGTACACATGTCTGGGTTTGG + Intronic
956993354 3:74794832-74794854 GAGGGGCACCTGACTGTATGAGG - Intergenic
957594259 3:82240914-82240936 AAATTTCACATGACTGTGTGAGG - Intergenic
957748357 3:84375523-84375545 CATGTACACATAAGTGTGTGAGG + Intergenic
957835915 3:85589130-85589152 GAGAGACACATGTTTGTGTGTGG + Intronic
958423096 3:93950451-93950473 GAGGGACACCTGGCTGTATGAGG - Intronic
958835733 3:99142634-99142656 CAGGTACACATCACTGTGCCCGG - Intergenic
959117685 3:102196908-102196930 GTGGTTGACATGCCTGTGTGTGG - Intronic
959293825 3:104510293-104510315 CAGGTTCACAGAACTGTGTGTGG - Intergenic
959569288 3:107866191-107866213 GAGGTAAACAAGCCTGTATGAGG + Intergenic
960579168 3:119259600-119259622 GATGACCACATGGCTGTGTGAGG + Intergenic
963616449 3:147544385-147544407 GAGGTACACATTGATGGGTGAGG + Intergenic
963915241 3:150853553-150853575 GAGGTACAAAGCACTTTGTGAGG - Intergenic
964496240 3:157293344-157293366 GAGGTACACATGACTATATGAGG + Intronic
966861979 3:184235640-184235662 GAGGTACACATGGCTGTGTGTGG - Intronic
966861984 3:184235670-184235692 GAGGTACACATGGCTGTGTGTGG - Intronic
966861989 3:184235700-184235722 GAGGTACACATGGCTGTGTGTGG - Intronic
966861994 3:184235730-184235752 GAGGTACACATGGCTGTGTGTGG - Intronic
966861999 3:184235760-184235782 GAGGTGTACATGGCTGTGTGTGG - Intronic
966862004 3:184235790-184235812 GAAGTACACATGACTGTGTGTGG - Intronic
966862012 3:184235848-184235870 GAGGTGTACATGACTGTGTGTGG - Intronic
966862016 3:184235878-184235900 GAGGTATACATGACTGTGTGTGG - Intronic
966862024 3:184235936-184235958 GAGGTACACATGACTGTGTGTGG - Intronic
966930308 3:184671649-184671671 GAGGTACCCATGATGGTGTATGG + Intronic
967327519 3:188256856-188256878 GAGGTACACATGCATACGTGTGG + Intronic
969758165 4:9163592-9163614 TAGGTACTCATAACTATGTGTGG - Intergenic
970328965 4:14959115-14959137 GAGGGAAACAGGACGGTGTGTGG - Intergenic
970791936 4:19868211-19868233 GAGGGTCACCTGCCTGTGTGAGG + Intergenic
971351110 4:25856958-25856980 CATGTACACATGTCTGTGGGTGG + Intronic
971576981 4:28287004-28287026 CAGTTCCACATGGCTGTGTGGGG - Intergenic
972212415 4:36854965-36854987 GAGGGGCACATGCCTGTATGAGG - Intergenic
973013805 4:45110507-45110529 GAGGGACACCTGCCTGTATGAGG + Intergenic
975449356 4:74506071-74506093 GAGGGACACCTGCCTGTTTGAGG - Intergenic
977299963 4:95256345-95256367 GAGGTGCATAAGACTGTGAGAGG - Intronic
977633537 4:99269983-99270005 GAGGGGCACATGGCTGTATGAGG + Intergenic
980835098 4:138181708-138181730 GAGCTACAAAAGACTGTATGAGG - Intronic
981382843 4:144093468-144093490 GACGTTCAGATGAGTGTGTGTGG + Intergenic
984057850 4:174951104-174951126 CAGGTACATATGTTTGTGTGTGG - Intronic
986656311 5:10016403-10016425 GAGGGGCACCTGCCTGTGTGAGG + Intergenic
987949749 5:24660124-24660146 GAGGGGCACCTGGCTGTGTGAGG + Intergenic
990589116 5:57243825-57243847 CAGGTGCACATCACTGTGTCTGG + Intronic
990768302 5:59213177-59213199 GAGGAAGACAAGACTGTGTCTGG - Intronic
990913789 5:60881233-60881255 GAGGTGCACCTGGCTCTGTGAGG + Intronic
990927286 5:61041369-61041391 GAGGTACTAATGACTATTTGAGG + Intronic
992781668 5:80133738-80133760 CCCGTACAGATGACTGTGTGTGG - Intronic
992863216 5:80933043-80933065 CAGGTGCACATGACAGTGTTTGG + Intergenic
994266512 5:97723153-97723175 GAGGAGTACCTGACTGTGTGAGG + Intergenic
994528460 5:100935461-100935483 GAGGGACACCTGGCTGTATGAGG + Intergenic
995225437 5:109695169-109695191 CAGATACTCATGACTGTCTGTGG + Intronic
995642913 5:114278230-114278252 GAGGGACACCTGCCTGTATGAGG + Intergenic
996520853 5:124423887-124423909 GAGGGGCACCTGGCTGTGTGAGG - Intergenic
996644855 5:125800987-125801009 AAGGTCCACATGACAGTGTTTGG - Intergenic
998390803 5:141785944-141785966 CAGGTACACCTGACTGTGGTTGG - Intergenic
1000412263 5:160946463-160946485 GAGGTGCACCTGGCTGTATGAGG + Intergenic
1000587836 5:163122203-163122225 GAGGGATACCTGGCTGTGTGAGG + Intergenic
1001324849 5:170715553-170715575 TAGGTATTCATCACTGTGTGAGG + Intronic
1002366594 5:178717327-178717349 GAGGTACAGATGACTATGCCAGG + Intronic
1003831926 6:10021323-10021345 GAGGTGCACCTGCCTGTATGAGG + Intronic
1004676050 6:17843413-17843435 TAGGTAAACATTACTGGGTGGGG + Intronic
1005936041 6:30521561-30521583 GAGGGGCACCTGCCTGTGTGAGG - Intergenic
1006723662 6:36179597-36179619 CAGGTACACACTACTGTGCGTGG - Intergenic
1007071041 6:39038282-39038304 GAGCTCCACATGGCTGGGTGTGG - Intergenic
1007271891 6:40644074-40644096 GAGGTACACCCCACTGTTTGTGG + Intergenic
1008890369 6:56481848-56481870 CAGGTACACATACATGTGTGTGG + Intronic
1010297968 6:74222683-74222705 GAGGGACACCTGCCTGTTTGAGG + Intergenic
1011227593 6:85124890-85124912 GGCTTGCACATGACTGTGTGAGG - Intergenic
1014899600 6:126946712-126946734 TATGTACACATGAGTGTATGGGG - Intergenic
1014924622 6:127255798-127255820 GAGGGGCACCTGCCTGTGTGAGG - Intergenic
1015203821 6:130612909-130612931 GAGATGCAAAGGACTGTGTGCGG - Intergenic
1018175731 6:161178023-161178045 GAGGGGCACCTGACTGTATGTGG + Intronic
1020320092 7:6933553-6933575 TAGGTACTCATAACTATGTGTGG + Intergenic
1021345250 7:19519483-19519505 TAGGTAACCATGACTGTGTCTGG - Intergenic
1022010149 7:26301671-26301693 GAAGTACCCAGGACAGTGTGTGG - Intronic
1022498984 7:30870950-30870972 GAGGCACACTTGACTCTGGGAGG - Intronic
1023238094 7:38112303-38112325 GAGGTACCCACGGCTCTGTGAGG - Intergenic
1024429308 7:49267533-49267555 GAGGTACACACCTCTGTGTTTGG - Intergenic
1024588546 7:50861358-50861380 GAGGTATACCTGGCTGTCTGGGG - Intergenic
1025034157 7:55582567-55582589 GAGGGACACCTGGCTGTATGAGG + Intergenic
1027300622 7:76829685-76829707 CAGGTCCACATGGCTGTGGGGGG + Intergenic
1027856452 7:83518026-83518048 CAGGTAAACATGTCTGTGTGTGG + Intronic
1027871768 7:83716759-83716781 GAGGGGCACATGGCCGTGTGAGG + Intergenic
1034898203 7:154891086-154891108 CAGGTACACATGACTACGTCCGG - Intronic
1034956891 7:155340362-155340384 GAGGCACACGGGACAGTGTGAGG + Intergenic
1038819400 8:30938437-30938459 CAGGTACACATCACTGTGCCTGG + Intergenic
1041031345 8:53738578-53738600 TAGGTGCACATGACTAAGTGTGG - Intronic
1041217639 8:55616474-55616496 GAGGGACACTTGACTATATGAGG - Intergenic
1042645223 8:70979639-70979661 GAGGGGCACCTGGCTGTGTGAGG + Intergenic
1043133170 8:76487641-76487663 AAGCTACACATGACTGTATTGGG - Intergenic
1043927928 8:86059080-86059102 CAGGCACACATCACTATGTGTGG + Intronic
1043930623 8:86087027-86087049 GAAGGACTCATGACTGTTTGAGG - Intronic
1044681370 8:94781602-94781624 GAGTTACACATGTGTGTGTTGGG - Intronic
1045520022 8:102895416-102895438 GACATACACCTCACTGTGTGAGG + Intronic
1046609873 8:116411077-116411099 GAGGGGCACCTGACTGTATGAGG - Intergenic
1051196414 9:14566715-14566737 GATATTCACATGATTGTGTGGGG - Intergenic
1056757276 9:89389646-89389668 AAACTACACATGACTGTGTGTGG + Intronic
1056869866 9:90267460-90267482 GAGGTACACATGAATTGGTAGGG + Intergenic
1057082215 9:92181428-92181450 GGGGTACAGATGACTCTGTGAGG + Intergenic
1057418299 9:94885204-94885226 CAGGTACACATCACTGTGCCTGG - Intronic
1057528450 9:95823306-95823328 GAGGGACACAAAGCTGTGTGAGG - Intergenic
1062198198 9:135286366-135286388 CATGTGCACATGCCTGTGTGTGG - Intergenic
1062510115 9:136900518-136900540 GAGGTAAAGATGCCTGCGTGTGG + Exonic
1062526991 9:136981926-136981948 CAGGGGCACACGACTGTGTGGGG - Intronic
1188050023 X:25473380-25473402 AATGTCCACATGCCTGTGTGTGG - Intergenic
1190117375 X:47635447-47635469 GTGACACGCATGACTGTGTGTGG - Intergenic
1190399119 X:50014083-50014105 CAGGTACCCATGTCTGTGGGAGG - Intronic
1190970708 X:55344413-55344435 GAGGGACACCTGCCTGTATGAGG - Intergenic
1191850555 X:65582888-65582910 GATGAACAGATGTCTGTGTGTGG + Intergenic
1198529783 X:137540670-137540692 GGGGTACACCTGGATGTGTGTGG - Intergenic
1198968960 X:142258524-142258546 GAGGTACACATGTCAGGGAGAGG + Intergenic
1199292402 X:146119596-146119618 GAGGGACACCTGTCTGTATGAGG - Intergenic
1199849968 X:151718708-151718730 GAGGTAGACCTGACTGTTTTAGG + Intronic
1200879183 Y:8194225-8194247 GAGGAGTACCTGACTGTGTGAGG - Intergenic
1201185966 Y:11403041-11403063 GAGGGACACCTGGCTGTATGAGG - Intergenic
1201952952 Y:19585828-19585850 GAGGGACACCTGGCTGTTTGAGG + Intergenic