ID: 966863216

View in Genome Browser
Species Human (GRCh38)
Location 3:184241969-184241991
Sequence GGTCCCAGTGGCGCAGTAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966863216_966863221 27 Left 966863216 3:184241969-184241991 CCTGCTACTGCGCCACTGGGACC 0: 1
1: 0
2: 1
3: 8
4: 127
Right 966863221 3:184242019-184242041 ACAGCCCAGCGAACGTGTGAAGG 0: 1
1: 0
2: 0
3: 3
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966863216 Original CRISPR GGTCCCAGTGGCGCAGTAGC AGG (reversed) Exonic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
901220288 1:7579909-7579931 TGTCCCAGTGACGCAGGAGAAGG - Intronic
902292451 1:15444423-15444445 GGTCCCAGAGGGTCAGGAGCAGG - Intronic
906476669 1:46173912-46173934 GGTCCCAGGGCCGCAGGGGCAGG + Intronic
908167029 1:61468784-61468806 GATCCCACTGGCGGAGAAGCAGG + Intergenic
915525270 1:156472228-156472250 GGCCCCAGAGGCCCAGTGGCAGG + Intronic
917920916 1:179749046-179749068 AGTCACAGTGACACAGTAGCTGG - Intronic
920336989 1:205251449-205251471 GGTCCCAGTGGTGGGGTATCTGG - Intronic
920659442 1:207902844-207902866 GGCCCCAGTGGGTCAGTAGCTGG - Intronic
924093334 1:240524962-240524984 GGTCACGGTGTCTCAGTAGCTGG - Intronic
1077755271 11:5021881-5021903 TGTCTCAGTGGGGCAGAAGCTGG + Intergenic
1081657271 11:44865797-44865819 GGTCTCAGTGGAGCAGGAACAGG + Intronic
1083903322 11:65654475-65654497 GCCCCCAGTGGAGCAGGAGCTGG + Exonic
1084034027 11:66497177-66497199 GGTCCCAGTTGCCCATTAACTGG - Intronic
1085310585 11:75514285-75514307 GGTCCCAGAGGGGGAGAAGCAGG + Intronic
1091074947 11:132606654-132606676 GGTCCCATTGGCCCAGAAGTGGG - Intronic
1097080219 12:56424841-56424863 GGTGCCAGTGGAGGAGCAGCGGG - Exonic
1102970876 12:117165212-117165234 GGCCCCAGTGGTTGAGTAGCGGG + Intronic
1112595082 13:100800456-100800478 GGACCCTGTGGCCCAGAAGCAGG - Intergenic
1112604591 13:100891332-100891354 AGTCCCAGCGGCTCAGGAGCCGG + Intergenic
1113456118 13:110450208-110450230 GGGCCCACTGGGGCACTAGCGGG - Intronic
1113456426 13:110452279-110452301 GGTCCCAGCTGCGCGGTGGCGGG - Intronic
1114362540 14:21990928-21990950 GCTCTAAGTGGCACAGTAGCTGG + Intergenic
1117842091 14:59870556-59870578 GGTCCCAGTGGCTCAGGCACCGG - Exonic
1118385352 14:65251626-65251648 GGTCCCAGGGGCAAAGGAGCAGG - Intergenic
1121536618 14:94695435-94695457 GGACACAGTAGCGCAGCAGCGGG - Intergenic
1122799717 14:104223458-104223480 GGTCCCCCTGGCGCAGTTCCAGG - Intergenic
1123032529 14:105458657-105458679 GCTCCCAGTGGCCCAGGAGTGGG - Intronic
1202910734 14_GL000194v1_random:114778-114800 GGTTCCAGAGGCGCAGGAGTGGG - Intergenic
1129051228 15:72783543-72783565 GGTCCCGGGGGCGCAGGCGCGGG + Exonic
1129947204 15:79549532-79549554 GGGGCCACTGGAGCAGTAGCTGG - Intergenic
1132751203 16:1458529-1458551 GGTCCCCGTGGCCAAGGAGCGGG - Intronic
1141813002 16:86388745-86388767 GGTCTCAGTGGAGCACTGGCTGG - Intergenic
1142670196 17:1484511-1484533 GGTCCCAGTGTGGCAGCAGAGGG + Intronic
1143089344 17:4439804-4439826 GGACCCAGTGGGGCTGGAGCTGG - Intronic
1145976842 17:28988744-28988766 GCTCCAAGTGGGGCAGTGGCTGG + Intronic
1146905955 17:36618042-36618064 GGTCCCAGTGGAGCAGCAGCTGG + Intergenic
1147508215 17:41041341-41041363 GGTCCCACTGGTGGAGCAGCTGG + Exonic
1148068710 17:44893469-44893491 GCTCCCAGTGCAGCTGTAGCTGG + Intronic
1148376989 17:47157009-47157031 GTTCCCAGTGGGACAGTATCAGG + Exonic
1150267822 17:63842458-63842480 GGGCCCCGCGGCGCAGTACCAGG - Exonic
1151354128 17:73548547-73548569 GGTCCAACTGGCACAGAAGCTGG + Intronic
1151787046 17:76280115-76280137 GGACCCAGTGAAGCAGTTGCTGG - Exonic
1151999281 17:77635262-77635284 GGTCACAGTGGCCCAGGAGCTGG + Intergenic
1156264937 18:35479383-35479405 GGCCACGGTGGCGCAGTAGCTGG - Exonic
1160449677 18:78953807-78953829 GCTCGCAGTGGCGGAGTGGCAGG + Intergenic
1160793287 19:932777-932799 GGCCCCACTGGCCCAGGAGCAGG - Intronic
1162137645 19:8565605-8565627 GGGCCTAGTGGGGCAGGAGCAGG + Intronic
1162841508 19:13359729-13359751 GGTCCCATTGGGGCAGGTGCGGG + Exonic
1167576569 19:50320560-50320582 GGTCCCAGGGGATCAGTAGGGGG + Intronic
1168510894 19:56972903-56972925 GGTGCCAGTGGCTCAGTCCCTGG + Intergenic
925559114 2:5168827-5168849 GGTCCCAGTGTAGCAGAAGCAGG + Intergenic
931025275 2:58106512-58106534 GGTCCTAATGGGGCAGTAGATGG + Intronic
933946609 2:87291755-87291777 ACTCCCAGTGGGGCAGTTGCTGG + Intergenic
936094934 2:109524136-109524158 GGGCCTAGTGGCGCAAGAGCAGG + Intergenic
936333583 2:111569786-111569808 ACTCCCAGTGGGGCAGTTGCTGG - Intergenic
938186110 2:129233383-129233405 GCTCCCAGTGTGGCAGCAGCTGG - Intergenic
946302348 2:218831708-218831730 GGTCCCAGGGGAGCCGGAGCCGG - Intronic
948640934 2:239375667-239375689 GGCTCCAGTGGCGCAGCAGAAGG + Intronic
1171444729 20:25195607-25195629 GGACCCAGTTGCGCAGGCGCGGG - Intergenic
1171811460 20:29746902-29746924 GTTCCCAGTGGGACAGTATCAGG - Intergenic
1171867015 20:30493696-30493718 GTTCCCAGTGGGACAGTATCAGG - Intergenic
1172317461 20:33967298-33967320 GGCCCCAGTGGCGGGGGAGCTGG - Intergenic
1172591403 20:36120670-36120692 GGACCCAGTGGAGGAGCAGCTGG - Intronic
1174298226 20:49563775-49563797 GGTCACTGTGGCCCAGTGGCTGG - Intronic
1174373766 20:50112314-50112336 GGTCCGAGTGGGGCAGTTGGTGG - Intronic
1175926085 20:62472292-62472314 GGTCCCAGTGGAGCAGGTGGTGG - Intronic
1176553529 21:8242281-8242303 GTTCCCAGTGGGACAGTATCAGG + Intergenic
1176572451 21:8425305-8425327 GTTCCCAGTGGGACAGTATCAGG + Intergenic
1176580360 21:8469865-8469887 GTTCCCAGTGGGACAGTATCAGG + Intergenic
1176630087 21:9129475-9129497 GGTTCCAGAGGCGCAGGAGTGGG - Intergenic
1176643191 21:9325286-9325308 GGTTCTAGAGGCGCAGGAGCAGG + Intergenic
1177212939 21:18092143-18092165 GTTCCAAGTGGCTCAGTAGATGG + Intronic
1180376495 22:12098175-12098197 GGTTCTAGAGGCGCAGGAGCGGG + Intergenic
1181849952 22:25742938-25742960 GGTCCCAGTGGCCCCATAGTGGG + Intronic
1182861253 22:33561336-33561358 GCTCCCAGTGGCAGAGTAGTTGG + Intronic
1183948109 22:41338278-41338300 GGCCACAGTGGCGCTGTGGCTGG - Intronic
1184210713 22:43034043-43034065 GTTCTCAGTGGCCCAGTAGGGGG - Intergenic
1184804923 22:46788557-46788579 GGTCCCAGTGGGGCTGGTGCTGG - Intronic
1203258527 22_KI270733v1_random:159309-159331 GTTCCCAGTGGGACAGTATCAGG + Intergenic
950680223 3:14580109-14580131 GGTCCCTGTGGGGCAGGGGCTGG + Intergenic
950742768 3:15063420-15063442 GGTCCCAGTGGGGCAGCTGAAGG + Intronic
951501145 3:23389094-23389116 GGTCCCACAGGGGCAGTGGCAGG + Intronic
953094229 3:39759092-39759114 GGTCACAGTGGCTAAGCAGCTGG - Intergenic
954519812 3:51214857-51214879 GGTCCCAGTAGGTCAGTATCAGG + Intronic
954610407 3:51941989-51942011 GGACCCAATGGAGCAGTAGGAGG - Intergenic
957096889 3:75785299-75785321 GGTTCTAGAGGCGCAGGAGCGGG - Intronic
962927090 3:140004933-140004955 GGTCCCAGTGGACCAATAGAAGG - Intronic
964767436 3:160192410-160192432 AGTGCCAGTGGCTCAGAAGCTGG - Intergenic
965968414 3:174524664-174524686 GGTCCCAGCTGCCCAGTAGGAGG - Intronic
966863216 3:184241969-184241991 GGTCCCAGTGGCGCAGTAGCAGG - Exonic
967823441 3:193859465-193859487 GGTCCCAGTGTCTCACTGGCTGG - Intergenic
1202743693 3_GL000221v1_random:79743-79765 GGTTCTAGAGGCGCAGGAGCAGG - Intergenic
970491822 4:16582797-16582819 GGTCCCAGTGGAGCTGTGGCTGG - Intronic
973602915 4:52559755-52559777 GGTCCCATTGTCGCTGTACCTGG - Intergenic
1202758095 4_GL000008v2_random:83608-83630 GGTTCTAGAGGCGCAGGAGCGGG + Intergenic
990488449 5:56281136-56281158 GGGCCCACTGGAGCAGGAGCTGG - Intergenic
995417587 5:111927182-111927204 GGCCTCAGTGGCGCAGGAGAGGG - Intronic
1002340951 5:178516262-178516284 GGTACCAGAGACGCAGGAGCTGG - Intronic
1015035053 6:128643867-128643889 GGTCCCACTGACACAGTAGTTGG - Intergenic
1019329826 7:456534-456556 GGTCCCAGTGTTGGAGTAGGAGG - Intergenic
1022525644 7:31035316-31035338 GGTCCCAGAGGCACAGCAGCAGG + Intergenic
1022794660 7:33722537-33722559 GGTCACACTGGGGCAGCAGCAGG - Intergenic
1023081927 7:36534135-36534157 GTTCCCAGTGTCACAGGAGCAGG - Intronic
1023608361 7:41950050-41950072 GGTAGCAGTGGAGCAGCAGCAGG + Intergenic
1023821219 7:43981655-43981677 GGTCTCAGTGGTGCAGTCCCTGG - Intergenic
1023843533 7:44109210-44109232 GGTCCCTGTGGGGCAGCATCTGG + Intronic
1026574454 7:71560569-71560591 GGTCCTAGTGGCGCAGGCACAGG + Intronic
1026908533 7:74078667-74078689 GGTCCCATAAGCGCAGAAGCAGG + Intergenic
1027185045 7:75965984-75966006 GGGCCCAGTGGCCCAGCACCCGG - Intronic
1029749488 7:102535079-102535101 GGTCTCAGTGGTGCAGTCCCTGG - Intergenic
1029767435 7:102634182-102634204 GGTCTCAGTGGTGCAGTCCCTGG - Intronic
1031528539 7:122850244-122850266 GCCCCCAGTGGAGCAGGAGCTGG - Intronic
1036131792 8:6121603-6121625 GTTCCCACTGGCTCAGGAGCTGG - Intergenic
1036708021 8:11059587-11059609 GGTGCCAGTGGAGGAGGAGCAGG + Intronic
1039380941 8:37084735-37084757 GGTCCCAGTGGCTCAGTGGTTGG + Intergenic
1039527743 8:38231681-38231703 GCTCCCAGTGGGCGAGTAGCGGG - Exonic
1053299099 9:36936204-36936226 GGACCCAGTGGCCCAGGACCCGG + Intronic
1060402385 9:123356311-123356333 GGGCCCAGAGCAGCAGTAGCAGG - Exonic
1060593682 9:124835125-124835147 GGTGCCAGTGGCACTGTAGAGGG + Intergenic
1061160960 9:128893485-128893507 GGCCCCAGTGAGGCAGTAGTGGG + Intronic
1061209537 9:129182804-129182826 GGAGCCAGTGGCGCTGTAGCTGG + Intergenic
1061612410 9:131755917-131755939 GGTGCCAGTGGCATAGGAGCAGG - Intergenic
1203752922 Un_GL000218v1:97160-97182 GGTTCCAGAGGCGCAGGAGTGGG - Intergenic
1203474722 Un_GL000220v1:141325-141347 GTTCCCAGTGGGACAGTATCAGG + Intergenic
1203362088 Un_KI270442v1:224768-224790 GTTCCCAGTGGGACAGTATCAGG - Intergenic
1203712327 Un_KI270742v1:109707-109729 GGTTCTAGAGGCGCAGGAGCAGG - Intergenic
1203538884 Un_KI270743v1:68480-68502 GGTTCTAGAGGCGCAGGAGCGGG + Intergenic
1185737353 X:2503638-2503660 GGTCCCAGTGTTGCAGGAGAGGG - Intergenic
1190300400 X:49053851-49053873 GGTCCCCGCGCCGCAGTAGGCGG - Intronic
1196734717 X:118973962-118973984 GGTCCCACCGGCGCAGAAGTTGG - Intergenic
1197093797 X:122571142-122571164 TGTCCCAGTGCCTCAGTGGCAGG - Intergenic
1197117415 X:122850124-122850146 GGTCCCAGTAGCAAAGGAGCTGG + Intergenic
1198867465 X:141139548-141139570 GTTGCCAGTGGCTCAGTGGCGGG + Intergenic
1201166564 Y:11214730-11214752 GGTTCCAGAGGCGCAGGAGTGGG - Intergenic
1201761436 Y:17543583-17543605 GTACCCAGTGGTGGAGTAGCTGG - Intergenic
1201840116 Y:18362407-18362429 GTACCCAGTGGTGGAGTAGCTGG + Intergenic