ID: 966863549

View in Genome Browser
Species Human (GRCh38)
Location 3:184243805-184243827
Sequence GAGGGCAAACAGCAGGAGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 567
Summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 518}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966863535_966863549 29 Left 966863535 3:184243753-184243775 CCCCCAACTCTGCCCATGGCACT 0: 1
1: 0
2: 3
3: 23
4: 290
Right 966863549 3:184243805-184243827 GAGGGCAAACAGCAGGAGCAGGG 0: 1
1: 0
2: 4
3: 44
4: 518
966863540_966863549 16 Left 966863540 3:184243766-184243788 CCATGGCACTACTGCCTTTTCTC 0: 1
1: 0
2: 0
3: 31
4: 336
Right 966863549 3:184243805-184243827 GAGGGCAAACAGCAGGAGCAGGG 0: 1
1: 0
2: 4
3: 44
4: 518
966863541_966863549 2 Left 966863541 3:184243780-184243802 CCTTTTCTCACCTGTGCCACCTG 0: 1
1: 0
2: 3
3: 38
4: 440
Right 966863549 3:184243805-184243827 GAGGGCAAACAGCAGGAGCAGGG 0: 1
1: 0
2: 4
3: 44
4: 518
966863539_966863549 17 Left 966863539 3:184243765-184243787 CCCATGGCACTACTGCCTTTTCT 0: 1
1: 0
2: 1
3: 17
4: 190
Right 966863549 3:184243805-184243827 GAGGGCAAACAGCAGGAGCAGGG 0: 1
1: 0
2: 4
3: 44
4: 518
966863536_966863549 28 Left 966863536 3:184243754-184243776 CCCCAACTCTGCCCATGGCACTA 0: 1
1: 0
2: 0
3: 13
4: 189
Right 966863549 3:184243805-184243827 GAGGGCAAACAGCAGGAGCAGGG 0: 1
1: 0
2: 4
3: 44
4: 518
966863538_966863549 26 Left 966863538 3:184243756-184243778 CCAACTCTGCCCATGGCACTACT 0: 1
1: 0
2: 0
3: 11
4: 170
Right 966863549 3:184243805-184243827 GAGGGCAAACAGCAGGAGCAGGG 0: 1
1: 0
2: 4
3: 44
4: 518
966863544_966863549 -8 Left 966863544 3:184243790-184243812 CCTGTGCCACCTGCAGAGGGCAA 0: 1
1: 0
2: 2
3: 29
4: 240
Right 966863549 3:184243805-184243827 GAGGGCAAACAGCAGGAGCAGGG 0: 1
1: 0
2: 4
3: 44
4: 518
966863537_966863549 27 Left 966863537 3:184243755-184243777 CCCAACTCTGCCCATGGCACTAC 0: 1
1: 0
2: 0
3: 17
4: 181
Right 966863549 3:184243805-184243827 GAGGGCAAACAGCAGGAGCAGGG 0: 1
1: 0
2: 4
3: 44
4: 518

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966863549 Original CRISPR GAGGGCAAACAGCAGGAGCA GGG Exonic
900018678 1:171833-171855 GAGGGGGAACAGCATGAGCCAGG + Intergenic
900861821 1:5239145-5239167 GAGGTCCAAAATCAGGAGCAAGG + Intergenic
900951483 1:5860431-5860453 GACGGGGAACAGCAGGAGCAGGG + Intergenic
901945811 1:12702640-12702662 CAGGGCAAACAGCAGGTGGAGGG - Intergenic
902776715 1:18679489-18679511 GAGGGGAAAGAGCAGCAGCTGGG - Intronic
903347781 1:22698349-22698371 GAGGACCTACAGCAGGAGCTGGG - Intergenic
903672614 1:25045626-25045648 CAAGGCAAACAGCAGAACCAGGG - Intergenic
903808410 1:26021383-26021405 GATGGCCCACAGCAGGTGCAGGG + Intronic
903982215 1:27197368-27197390 GAGAGGAAACGGCAGGAGGAAGG - Intergenic
905037127 1:34925536-34925558 GAGGGGAAGAAGCAGGAGCGAGG + Intronic
905417671 1:37815444-37815466 GCGGGCATCCAGCAGGAGAAAGG - Exonic
905420969 1:37843839-37843861 GAGGGGAGACAGGAGGAGTAGGG - Intronic
905892001 1:41523594-41523616 GGGGCCAAGCAGCAAGAGCACGG + Intronic
906321859 1:44822297-44822319 GAGGGGATGCAGCAGCAGCAGGG + Exonic
907629848 1:56069526-56069548 CAGTGGAAAGAGCAGGAGCAAGG + Intergenic
907805418 1:57814349-57814371 GCAGGAAAACAGCAGCAGCAGGG + Intronic
907999117 1:59663222-59663244 GAGGTCAAACAGCTAGAGTATGG + Intronic
908852042 1:68386489-68386511 TAGAGCAAAGAGCAGGAGGATGG - Intergenic
909127701 1:71695519-71695541 GAGGGAAAACAGTAGGAAAAAGG - Intronic
909240110 1:73202235-73202257 GAGGGCGAAAAGTAGGTGCAAGG + Intergenic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910051504 1:82979267-82979289 TAGGGAACACAGTAGGAGCAAGG - Intergenic
910707192 1:90142297-90142319 CAGAGCAAAGAGCAGGAGCTGGG + Intergenic
911041836 1:93597489-93597511 GAGGCCACACAGCAGGTGCGTGG - Intronic
911047233 1:93638673-93638695 CATGGTAAACAGCAGGAGGAAGG + Intronic
911474302 1:98357442-98357464 GAGGGTAAGCAGCAGCAGCATGG - Intergenic
912273154 1:108230194-108230216 CAGGGCATACAGCAGGTGCAAGG + Intronic
912295066 1:108464128-108464150 CAGGGCATACAGCAGGTGCAAGG - Intronic
912701503 1:111881654-111881676 CAGGGCAAAGGGCAGGGGCATGG + Intronic
915943981 1:160136538-160136560 GAGGGCCAAAGGCAGGGGCAGGG - Intronic
915984337 1:160448749-160448771 GAGGGCAAGGAGGAGGAGGAGGG - Intergenic
916180125 1:162076213-162076235 GAGGGTAGACAGCAGGACAAGGG - Intronic
916883591 1:169046081-169046103 GAAGACAAATAGCTGGAGCAGGG + Intergenic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
919837238 1:201583270-201583292 GAGAGGAGACAGCAGGGGCAAGG + Intergenic
920087644 1:203429434-203429456 GAGGGCAAGGAGCAGGTACAAGG - Intergenic
920350127 1:205332383-205332405 GAGGGCACACAGAAGGACCCAGG - Intergenic
920764568 1:208819574-208819596 GCTGGCAAACACCAGGAGCCAGG - Intergenic
921137113 1:212271494-212271516 TAAGGGAAACAGCATGAGCAAGG - Intergenic
921260008 1:213377988-213378010 TAATGCAAATAGCAGGAGCAAGG + Intergenic
921626101 1:217379514-217379536 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
921975592 1:221199536-221199558 GAGGACAAAGAGTAGGAGGAGGG + Intergenic
922080064 1:222287308-222287330 GTGGGGAAATAGCAGGAGCTCGG - Intergenic
922087785 1:222367749-222367771 GTGGTCAGAGAGCAGGAGCAGGG - Intergenic
922356721 1:224783306-224783328 GAAGGAAAACAGAAGGGGCAAGG + Intergenic
922588529 1:226754158-226754180 GAGGCCAGACTGGAGGAGCAGGG + Intergenic
923343230 1:233025176-233025198 GAGGTCAAACACCTGCAGCATGG + Exonic
924207123 1:241725019-241725041 AAAGGCAGACAGCAGGGGCAGGG + Intronic
924580903 1:245323771-245323793 GAGGACACACAGTAGGAGCTTGG - Intronic
924680008 1:246221452-246221474 GTGGGCAAAGAGAAGGAGAAAGG + Intronic
1063472240 10:6297416-6297438 GTGGCCCAAGAGCAGGAGCAGGG + Intergenic
1063608133 10:7540952-7540974 GCGTGCAAACAGTAGGTGCATGG + Intergenic
1063956855 10:11275183-11275205 GAGGGCAAAGACAAGAAGCAGGG + Intronic
1064292101 10:14044596-14044618 GCTGGCAAGCAGCAGGAGCTGGG + Intronic
1065010735 10:21418571-21418593 GAGGACGGACAGAAGGAGCAAGG - Intergenic
1067201145 10:44172936-44172958 GAGACCACACAGCAAGAGCATGG - Intergenic
1067874472 10:49992306-49992328 GAGGGAAATAAGCAGGAGTAGGG - Intronic
1069811005 10:71159698-71159720 GAAGGCAAACTGCAGGATCTGGG + Intergenic
1069944186 10:71974693-71974715 GAGGGCAGACAGCAGGTGGGCGG - Intronic
1070476810 10:76836841-76836863 GAGGGCAAAGAGGATGAGGAAGG - Intergenic
1071105552 10:82089951-82089973 GAGGGCAAAGAGCTGGGGCAGGG - Intronic
1071512241 10:86269378-86269400 GAGGCCACACAGCAGGAGCTGGG - Intronic
1072411955 10:95210991-95211013 GAGGGAAAAGAGGAAGAGCAGGG + Intronic
1072423664 10:95310859-95310881 GAGGGGCAATAGCAGAAGCAGGG + Intergenic
1073118689 10:101108200-101108222 GAGGGGTCACAGCAGGGGCAGGG + Intronic
1073140329 10:101242946-101242968 AAGAGAAAACAGCAGGAGCCAGG + Intergenic
1073260823 10:102188882-102188904 AAGGCCAAGCAGCAAGAGCAGGG + Intergenic
1073602671 10:104862012-104862034 GAGGGCATACTGCAGTAGGATGG - Intronic
1074614545 10:115054103-115054125 GAGGGCAAAGAGGAAGAGGAGGG - Intergenic
1074672200 10:115804455-115804477 AAGAGCAAAGAGCAGGAGCCAGG - Intronic
1074851855 10:117445438-117445460 GGAGGGAAACAGCAGGATCAAGG - Intergenic
1075162038 10:120032847-120032869 GAAGGAAAACAGCAGGGGCAAGG + Intergenic
1076193807 10:128500731-128500753 GAGGGCGAACAGCCTGAGGAAGG + Intergenic
1077010468 11:377047-377069 GAGGGCGAAGAGGAGGAGGAAGG + Exonic
1078068454 11:8093262-8093284 CAGTGCAGGCAGCAGGAGCAAGG + Intronic
1079152789 11:17915931-17915953 GAGGGACAGCAGCAGGTGCAGGG + Intronic
1079562274 11:21836923-21836945 GAGGGCCAAGAGCAGAAACAGGG + Intergenic
1080590201 11:33716770-33716792 GAGGGGCAACAGCAGGTGCCAGG - Intronic
1081905403 11:46666221-46666243 AACGGGAAACAGCAGGAGCTCGG + Intronic
1081912366 11:46707973-46707995 AAGTGTAGACAGCAGGAGCAGGG + Intergenic
1082798045 11:57392666-57392688 GAGGTCAAACAAAAGGAGAAGGG + Intronic
1082821690 11:57548288-57548310 CAGAGGAAACAGCAGGTGCAAGG - Intronic
1083163086 11:60867602-60867624 GGTGGCAACCAGCAGTAGCAGGG - Exonic
1083424412 11:62575683-62575705 GAGGGGAAAGAGGAGCAGCAGGG - Exonic
1083811549 11:65109401-65109423 GCGGGAGAGCAGCAGGAGCAGGG - Exonic
1084014200 11:66369139-66369161 CAGGGCAAAGAGCAGCAGTATGG + Exonic
1084612432 11:70212181-70212203 GAGAGGAAACAGCAGGGGCAAGG - Intergenic
1084616640 11:70240794-70240816 CAGGGCTAAAAGCAGCAGCAAGG - Intergenic
1084651441 11:70491770-70491792 GAGGGCACACAGCTGGAAAAGGG - Intronic
1084972693 11:72780476-72780498 GAAGGGAAAGAGCAAGAGCAGGG + Intronic
1085865658 11:80288620-80288642 GAGTCCAAACTGAAGGAGCAAGG + Intergenic
1087515437 11:99154176-99154198 GTGGGGAAGCAGCAGGAGCAGGG + Intronic
1087596046 11:100256646-100256668 GAGGGCAAGCTGAAGCAGCATGG + Intronic
1088925003 11:114293137-114293159 TAGGGCAGTCAGCAGAAGCAGGG + Intronic
1089763985 11:120749654-120749676 GAGGACAGACAGCAGGAAGATGG + Intronic
1089780697 11:120871412-120871434 GAGGGCAAAGGGGAAGAGCAGGG + Intronic
1089879888 11:121763231-121763253 GAGAGCACACAGCATCAGCATGG + Intergenic
1090077471 11:123588269-123588291 TACGGCAAACACCAGGAGCTGGG - Intronic
1090536414 11:127646416-127646438 GAGGGCAAAAAGGAGGGTCAGGG + Intergenic
1091116176 11:133015821-133015843 AGGAGGAAACAGCAGGAGCAAGG - Intronic
1091282910 11:134391989-134392011 GAGGGCAATCAGCATGACCCAGG - Exonic
1091675499 12:2486161-2486183 GATGACAAACAGCACAAGCAGGG - Exonic
1091948153 12:4567823-4567845 CAGGCCTAAAAGCAGGAGCAGGG - Intronic
1092071668 12:5636554-5636576 GAGAGAAAACAGCAGGTGGAAGG + Intronic
1092629031 12:10358826-10358848 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1092709752 12:11323280-11323302 AAGAGAAACCAGCAGGAGCAAGG + Intergenic
1092755043 12:11755472-11755494 GAGGGCAAACAGCAAGAGCCTGG - Intronic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1094672703 12:32586599-32586621 AAGGGAAAACAGATGGAGCAGGG + Intronic
1095113055 12:38319145-38319167 GAGGACACAGAGAAGGAGCAGGG + Intronic
1095584938 12:43839196-43839218 GAGGGCAAGGAACAGAAGCAGGG - Intronic
1096231883 12:49901273-49901295 GAGGGGCAGCAGCAGGTGCATGG - Exonic
1096924646 12:55130139-55130161 GAGGGCAAAGAGAAAGAGCTGGG - Exonic
1097728290 12:63099348-63099370 GAAGGAAAACAGAAGGGGCAAGG + Intergenic
1097794268 12:63844903-63844925 GAAGGCACACAAAAGGAGCAAGG - Intronic
1098020667 12:66152349-66152371 GAGGGCAAACAGCAAAATTAAGG + Exonic
1098840470 12:75471530-75471552 AAGGGCAAAGAGAAGCAGCATGG + Intergenic
1099107809 12:78518769-78518791 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
1099111258 12:78564459-78564481 CAGGGCAAACACCAGGAGAGTGG + Intergenic
1099239015 12:80116345-80116367 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1100804521 12:98267579-98267601 GAGGGAAAAGAGCAAGAGAAAGG + Intergenic
1101498823 12:105281844-105281866 AAGGGAAAACAGAAGGAGCCTGG + Intronic
1102142056 12:110623077-110623099 GAGCTCATAAAGCAGGAGCAGGG - Intronic
1102644170 12:114393212-114393234 GAGGGGGAACTGCAGGAGCTGGG - Intronic
1102784448 12:115592826-115592848 GTGGGCAAACAGCTGGAGGATGG - Intergenic
1104367669 12:128192667-128192689 GAGGGCACCCTGCAGGAGCCTGG - Intergenic
1104423763 12:128658024-128658046 GAGGCCACAAGGCAGGAGCAGGG + Intronic
1104423781 12:128658098-128658120 GAGGCCACAAGGCAGGAGCAGGG + Intronic
1104423790 12:128658135-128658157 GAGGCCACAAGGCAGGAGCAGGG + Intronic
1104423799 12:128658172-128658194 GAGGCCACAAGGCAGGAGCAGGG + Intronic
1104423808 12:128658209-128658231 GAGGCCACAAGGCAGGAGCAGGG + Intronic
1106042063 13:26103094-26103116 GAGGGCAAGCAGAAGCAGGATGG + Intergenic
1107031876 13:35861706-35861728 AAGAGCAATCAGCAGAAGCAGGG - Intronic
1107230987 13:38110213-38110235 GAGGGTAAAGAGCGGGAGAAGGG + Intergenic
1107671390 13:42749941-42749963 GATGGTAAACAGCAGCAGGATGG - Intergenic
1107827500 13:44342030-44342052 GAGAACAAAAAGCAGGAGGAAGG + Intergenic
1108426207 13:50303975-50303997 GAGGGTAGAGAGCAGGAGGAAGG - Intronic
1108857249 13:54809797-54809819 GATGTATAACAGCAGGAGCATGG - Intergenic
1109478759 13:62919738-62919760 CAGAGCAGACACCAGGAGCAGGG + Intergenic
1110718707 13:78737532-78737554 CAGGGAAACCAGCAGGATCACGG + Intergenic
1112575358 13:100630705-100630727 AAAGGAAAACAGCAGGAGCTTGG - Intronic
1112910629 13:104479124-104479146 GAGGGCATTGAGCAAGAGCAAGG - Intergenic
1113376509 13:109769324-109769346 GTGGGCTAACATCAGTAGCACGG + Intronic
1113607377 13:111619993-111620015 TAGGGAAAGCAACAGGAGCAGGG - Intronic
1113660273 13:112103018-112103040 GGGGTGAAACAGCAGGAGGAAGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116932031 14:50700573-50700595 GAGTGCAAACAGCATGATCTCGG + Intergenic
1118291232 14:64526355-64526377 GAGGGCAAGAAGCAACAGCAAGG - Intronic
1118858556 14:69643600-69643622 GTGAGCAAACAGCAGGTGCTTGG + Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119616100 14:76100111-76100133 GAGGCAAAAAAGCAAGAGCATGG - Intergenic
1120827511 14:88969058-88969080 AAGGGGAAACAGCAGGAACAAGG - Intergenic
1121006970 14:90496593-90496615 GAGGGTGCGCAGCAGGAGCAGGG - Intergenic
1121263271 14:92581900-92581922 AAGGGGAAACATCAGGGGCAGGG + Intronic
1121933768 14:97997534-97997556 GAGGAAACACAGCAGGAGAAAGG - Intergenic
1122024882 14:98868436-98868458 GAGGGGAAATGGCAGGTGCAAGG + Intergenic
1122044376 14:99012744-99012766 GAGGGCACAGACCAGGAGCCTGG + Intergenic
1122691243 14:103533052-103533074 GAGGCCAGAGACCAGGAGCAGGG - Intronic
1122809610 14:104281495-104281517 GGGGGCACACAACAGCAGCAGGG - Intergenic
1122887196 14:104715365-104715387 GGGGGCTAACAGCAGCTGCAGGG + Intronic
1122895651 14:104755517-104755539 GAGGGCACACAGGAGGACGATGG + Intronic
1123067764 14:105626993-105627015 GAGGGCCAAGGGCAGGTGCAAGG - Intergenic
1123071783 14:105645718-105645740 GAGGGCCAAGGGCAGGTGCAAGG - Intergenic
1123091447 14:105743994-105744016 GAGGGCCAAGGGCAGGTGCAAGG - Intergenic
1123097217 14:105772335-105772357 GAGGGCCAAGGGCAGGTGCAAGG - Intergenic
1123108283 14:105853013-105853035 GAGGTCAGACAGCAGCAGCCCGG - Intergenic
1123578369 15:21695059-21695081 GAGGGAAATCAGCAGGAGGTAGG + Intergenic
1123614994 15:22137541-22137563 GAGGGAAATCAGCAGGAGGTAGG + Intergenic
1124596070 15:31092198-31092220 GAGTGGGAACAGCAGGGGCAAGG + Intronic
1125511840 15:40296408-40296430 GAGGGCAAAGAAGAGGAGGATGG + Intronic
1125517710 15:40332001-40332023 GAGGGCACACAGGAGGAGGGAGG - Intronic
1127294353 15:57596705-57596727 GAGGGGAAACAGCACAGGCACGG - Intronic
1127343118 15:58066605-58066627 GAGGGGAAACAGCCGGAAGAGGG - Intronic
1128396198 15:67228979-67229001 GAGGGGAGACAGTAGGAGGAGGG + Intronic
1128779764 15:70351672-70351694 GAGGGCAGTGAGCAGGAGCTCGG - Intergenic
1129032593 15:72629604-72629626 GCGGGCAAACATCAGGAGGTGGG + Intergenic
1129217300 15:74107640-74107662 GCGGGCAAACATCAGGAGGTGGG - Intronic
1129239245 15:74241923-74241945 TGGGGCAGACAGCAGGAGGAGGG + Intronic
1129386936 15:75201590-75201612 GAGGTCAAGCGGCAGGCGCAAGG + Intronic
1129407366 15:75328424-75328446 GCGGGCAAACATCAGGAGGTAGG + Intergenic
1129470545 15:75751216-75751238 GTGGGCAAACATCAGGAGGTGGG + Intergenic
1129734452 15:77951922-77951944 GTGGGCAAACATCAGGAGGTGGG - Intergenic
1130334657 15:82948701-82948723 CAGGGGAAACAGCAAGTGCAAGG + Intronic
1130460385 15:84155385-84155407 GAGGGAAAGCAGCAGGACCTGGG + Intergenic
1130886100 15:88093955-88093977 GAGGGCAAACAGCCTCAGCAAGG + Intronic
1132142166 15:99405210-99405232 GAGAGGAAACATCAGGAGAAAGG + Intergenic
1202987239 15_KI270727v1_random:429304-429326 GAGGGAAATCAGCAGGAGGTAGG + Intergenic
1132889764 16:2197689-2197711 GAGGTCAGACAGCAGGGACAGGG + Intergenic
1132989754 16:2786679-2786701 GAGGACAGACAGAAGGACCACGG - Exonic
1133387640 16:5383195-5383217 GTGGGGAAACAGGAGGAGTAGGG + Intergenic
1133389860 16:5401479-5401501 GAGGACTAACGGCAGGAGGAGGG - Intergenic
1134279068 16:12802130-12802152 GAGGGCAAACCCCTGGGGCATGG + Intronic
1134486370 16:14661911-14661933 GAGGGCGTATAGCAGGAACAGGG - Exonic
1135148677 16:19986246-19986268 AAGGGCCAACAGCTGGAGCCTGG - Intergenic
1135667864 16:24351150-24351172 GAAGGAAAACAGGAGGGGCAAGG + Intronic
1135950488 16:26909759-26909781 GAGTGGAAACCGCAGGAGCTTGG - Intergenic
1136235056 16:28908640-28908662 CAGGGCTCGCAGCAGGAGCAGGG - Exonic
1137421092 16:48334697-48334719 GAGGGCAAACAGCTGAAGGATGG - Intronic
1137540874 16:49360752-49360774 GAGGGCACACAGCTGGCACATGG + Intergenic
1137871043 16:51950613-51950635 GAGGGAAAAGAGCATGAGAAGGG + Intergenic
1138020056 16:53470574-53470596 GGTGGCCAACAGCAGAAGCAAGG + Exonic
1138445602 16:57061320-57061342 GAGGGCAAAGGCCTGGAGCAGGG - Intronic
1139459742 16:67112067-67112089 GAAGCCAAACAGCATTAGCATGG - Intronic
1140043316 16:71423985-71424007 GAGGGGAGGCAGCAGGACCAGGG - Intergenic
1140521411 16:75585090-75585112 GAGAACAGACTGCAGGAGCAGGG - Intergenic
1141675927 16:85517312-85517334 GAGGTTAAGCAGCAGGACCAAGG - Intergenic
1142890035 17:2937292-2937314 GAAGGCATTCAGAAGGAGCAAGG - Intronic
1142930836 17:3282853-3282875 TGGGGAAAACAGCATGAGCAAGG - Intergenic
1143040558 17:4032834-4032856 GAAGCCAACCAGCACGAGCAGGG + Exonic
1143130721 17:4675282-4675304 GAGTGCAGACAGCAGGTCCAAGG + Exonic
1143138055 17:4723131-4723153 GAGGTCAAGGAGCAGGTGCACGG - Intergenic
1143376868 17:6472172-6472194 CAGGGAGAACAGCAGGAGCGAGG - Intronic
1143393885 17:6576704-6576726 CAGGGCCAACAGCAAGAGGAAGG - Intergenic
1143411322 17:6711184-6711206 GAGGGTACACAGCACGGGCAGGG - Intronic
1143451274 17:7038320-7038342 GAGGGCAGACACCAGCAGCAGGG - Exonic
1144136560 17:12300951-12300973 GAGGGCAGGAAGCATGAGCACGG - Intergenic
1144810794 17:17997662-17997684 GAGGGCCTACAGCAGGAGACAGG - Intronic
1145253557 17:21310411-21310433 GAAGGAAAACAGCAGGAACAAGG - Intronic
1145323020 17:21777550-21777572 GAAGGAAAACATCAGGAACAAGG + Intergenic
1147431587 17:40374687-40374709 GAGGACAAAAAGGAGGAGGAGGG - Intergenic
1147549185 17:41426675-41426697 GAGGGAAACCAGAAGGACCATGG + Intergenic
1148774415 17:50087644-50087666 CAGGACAAACAGCAGGTGCCTGG + Intronic
1149190625 17:54057201-54057223 TAGGGCACAGAGCAAGAGCACGG + Intergenic
1150005009 17:61463895-61463917 GTGGGCCAACAGCTGAAGCAGGG - Intronic
1150096616 17:62381682-62381704 GAGGGCAGCCAGCAGGAGGGAGG - Intronic
1150272107 17:63873305-63873327 CAGGGCAAAAGCCAGGAGCAGGG + Exonic
1150275655 17:63896201-63896223 CAGGGCAAAAGCCAGGAGCAGGG + Exonic
1150277787 17:63910890-63910912 CAGGGCAAAAGCCAGGAGCAGGG + Exonic
1151536758 17:74743288-74743310 GATGTCATACAGCAGAAGCAAGG - Exonic
1151757588 17:76083471-76083493 GTGGGGAAAAAGCAGGAGCCAGG + Exonic
1151783978 17:76266139-76266161 GAGGCCAAGCAGCAGCAGCCCGG - Intronic
1151830451 17:76546216-76546238 GAGGGCAGCAACCAGGAGCAGGG + Intronic
1152190877 17:78886526-78886548 GTGCAGAAACAGCAGGAGCACGG + Intronic
1152277444 17:79366554-79366576 GCCGGCAGACAGCAGGAGCTGGG - Intronic
1152591792 17:81217183-81217205 GTGGGCACACAGCTGGGGCAAGG + Intronic
1152975956 18:218492-218514 AAGGGCAAACAGAAGAACCATGG + Intronic
1153469443 18:5427648-5427670 CAGGACAAACAGAAAGAGCATGG + Intronic
1153711866 18:7808294-7808316 GAGGGCACAGAGGAGAAGCAGGG + Intronic
1154092404 18:11378098-11378120 GAGGGCAAAGAGGAGAAGGAGGG + Intergenic
1154325914 18:13390304-13390326 AAGGACACATAGCAGGAGCACGG - Intronic
1154490102 18:14915200-14915222 GAGAGCAAACAGCAGCAGACAGG + Intergenic
1155857432 18:30850569-30850591 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1156454124 18:37283274-37283296 GAGAGCAGACAGCAGGGGCTTGG - Intronic
1158465301 18:57684943-57684965 GTGGGCAACCACCAGGAGCAGGG + Intronic
1158958117 18:62561632-62561654 GATCCCAAAAAGCAGGAGCAAGG - Intronic
1160523068 18:79520030-79520052 GAGGGCACACACCAGGAGAGGGG + Intronic
1160920783 19:1519382-1519404 ATGGGAAAACATCAGGAGCAGGG + Intergenic
1161058310 19:2201413-2201435 CAGGGAAGACAGCAGGAGCGAGG - Intronic
1161203174 19:3027524-3027546 GAGGGCACATAGCAGAGGCAGGG - Intronic
1161329910 19:3681777-3681799 GAGGGCAAACAGCAGCCCCAGGG + Intronic
1161771864 19:6235308-6235330 GAGGGACACCAGCAGGAGCCTGG + Intronic
1163660409 19:18573694-18573716 GCCGGCAAACAGCTGGAGGATGG + Exonic
1164700266 19:30279956-30279978 GAGGTCTGGCAGCAGGAGCAGGG - Intronic
1164709269 19:30343864-30343886 GAGGGAAAACAGCAAGAGGTTGG + Intronic
1164791591 19:30989991-30990013 GAGGTCACACAGCAAGATCATGG + Intergenic
1166898246 19:46037510-46037532 CAGGGCCATCAGCAGGACCAGGG + Intergenic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1168578462 19:57533744-57533766 GAGGGCATACAGGAGAATCAAGG - Intronic
1168578632 19:57534969-57534991 GAGGTGAACTAGCAGGAGCATGG + Intronic
925643401 2:6009571-6009593 GAAGGCAAAGAGAAGGAACAGGG + Intergenic
926008992 2:9393676-9393698 GAGGTCAGAGGGCAGGAGCACGG - Intronic
926194684 2:10755629-10755651 AGGGGCAAACAGTAGGAGCCGGG - Intronic
926716787 2:15930798-15930820 GAGGGAAAAGACCAAGAGCATGG - Intergenic
926756997 2:16244377-16244399 GAGGGCAAGGAGGAGGAGAAGGG + Intergenic
928092663 2:28385117-28385139 CAGGGCAGACAGCATGAGGAAGG - Intergenic
928601653 2:32909410-32909432 CAAGGCAAACAGCAAGACCAAGG - Intergenic
929318776 2:40514360-40514382 GTGGGCAAACAGAAGGACAAAGG + Intronic
930021517 2:47004659-47004681 GAGGGGAATGAGCAGGAGAAGGG + Intronic
930525248 2:52520854-52520876 GAGGAGAAACTGCAGGGGCAAGG + Intergenic
930710835 2:54549806-54549828 GAGGGCCAAGAGCAGAGGCATGG + Intronic
931074717 2:58696843-58696865 GAAGTCAAACAGCAGCAGCAGGG + Intergenic
931667247 2:64618208-64618230 GGGGGCATACTGCAGGAGGATGG + Intergenic
932751078 2:74372138-74372160 GAGGGCATAGACCTGGAGCAAGG - Intronic
932805156 2:74777211-74777233 GAGGGATAACAGCAGTAGAAAGG + Intergenic
933329825 2:80879722-80879744 GGGAGCAAAGAGCAGGAGGACGG + Intergenic
934126573 2:88898743-88898765 GTGGGAAAACAGCACCAGCAAGG + Intergenic
934738677 2:96703471-96703493 GAGTGCAGACAGCAGGAGCCGGG - Intergenic
934774412 2:96928000-96928022 GAGGGAAAGGGGCAGGAGCACGG + Intronic
935798707 2:106671068-106671090 GACTGCAAAGAGCAGCAGCAGGG - Intergenic
935977768 2:108595994-108596016 GAGAGCAAAGATCAGGAGTAAGG + Intronic
936050369 2:109217962-109217984 GAAGGCAACCGGCAGGAGCAAGG - Intronic
936135382 2:109888523-109888545 GAGAGCAAAGATCAGGAGTAAGG + Intergenic
936209315 2:110482962-110482984 GAGAGCAAAGATCAGGAGTAAGG - Intergenic
937032899 2:118755477-118755499 GAGAACAATCAGCAGAAGCAAGG + Intergenic
937056356 2:118940630-118940652 GAGGACAAGCAGCAGAAGCCAGG - Intergenic
937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG + Intergenic
937995230 2:127689508-127689530 GAAGGAAAAGAGAAGGAGCAGGG + Intergenic
938374948 2:130798943-130798965 GGGGGCCAACAGCAGGGGGATGG - Intergenic
939332507 2:140782921-140782943 AAGGTCACACAGCAGGAGTATGG + Intronic
939628184 2:144504250-144504272 GAGAGCAAACCCCCGGAGCAAGG + Intronic
940656974 2:156498964-156498986 GAAGGCAAACATAAGGAACAAGG + Intronic
940704374 2:157085414-157085436 GTAGGCAAACAGCAGTGGCATGG - Intergenic
941230481 2:162905690-162905712 GATGGCCAACATCAGGAGCTAGG + Intergenic
943593755 2:189830697-189830719 GAGGGCTGACAACAGGATCAAGG + Intronic
943619821 2:190136567-190136589 GAGGGCAAAGAGTAGGTACAAGG - Intronic
945482287 2:210357986-210358008 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
946385846 2:219384075-219384097 CAGGAAAAGCAGCAGGAGCAAGG + Intronic
946451118 2:219780309-219780331 CAGGGCAAATATCAGGAGAAAGG + Intergenic
946876842 2:224138004-224138026 GAGGGCAAAGAGAAGGAAGAGGG - Intergenic
947223879 2:227821671-227821693 GTGGTCAAAGAGCAGGAGAATGG + Intergenic
947722321 2:232377761-232377783 GGGGGCAATAAGCAGGAGGAAGG + Intergenic
947931727 2:233970311-233970333 GTAGGCAAACAGCAGGAGGAAGG - Exonic
948136159 2:235637919-235637941 GAGGGCAAAAAGGTGGAGGAAGG - Intronic
948238175 2:236406245-236406267 GAGGGCAAGAAGAAGGCGCACGG - Intronic
948272276 2:236683756-236683778 CTGGGCAAGCATCAGGAGCAGGG - Intergenic
948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG + Intergenic
1169235137 20:3924662-3924684 GCCTGCAAACAGCAGCAGCAGGG - Intronic
1169357968 20:4924019-4924041 GAGGGCAGCCACCAGGATCAGGG - Intronic
1170930175 20:20762549-20762571 GAGGGCACAGAGCAAGAGAAGGG - Intergenic
1171225690 20:23440293-23440315 CAGGGCAATCAGCAGCAGCAGGG - Exonic
1171971450 20:31567440-31567462 GAGGGCAAACAGTGGGGGCAGGG - Intronic
1172452749 20:35039606-35039628 GAGGGGAAACTACAGGAGTATGG - Intronic
1172502036 20:35434374-35434396 GCGGCCAAACACCAGGAACAGGG + Exonic
1172846475 20:37932447-37932469 CAAGGCAAGCAGGAGGAGCAGGG + Intronic
1173117838 20:40263076-40263098 GACGCCAAACAGCAGGAGCCAGG + Intergenic
1173736449 20:45364809-45364831 GAGAACAAGCAGCAGGAGCAAGG - Intronic
1174216519 20:48920743-48920765 GAGGGGAAAGAGTAGGAGAAAGG - Intergenic
1174338445 20:49881230-49881252 GAGGGCAAACAACATGCCCAGGG + Intronic
1174596448 20:51688041-51688063 GAGGTCACACAGCAGGTGAAAGG - Intronic
1174851990 20:54004688-54004710 GAGGCCACACAGCATTAGCATGG + Intronic
1175159006 20:56994231-56994253 CTGGGCAAACATCAGCAGCAAGG + Intergenic
1175825157 20:61932985-61933007 CATGACAAACAGCAGGACCATGG - Exonic
1177724979 21:24955614-24955636 GAGGGGAAACAGTAGGATAAGGG - Intergenic
1178587899 21:33885281-33885303 GAGGGCAAATTCCAGGAGCAAGG + Intronic
1179564766 21:42240321-42240343 AAGAGCAAACAGGAGGAGCCAGG - Intronic
1181982505 22:26775466-26775488 GTGGGACATCAGCAGGAGCAAGG + Intergenic
1182015790 22:27038648-27038670 CAGAGGAAACAGCAGGTGCAAGG + Intergenic
1182573211 22:31254606-31254628 GAGGGCTGGCAGTAGGAGCAGGG - Intronic
1183018095 22:35006438-35006460 CAGGGCTAAAAGCAGGAGCCAGG + Intergenic
1183019884 22:35018547-35018569 GAGGGCAGACAGCAGGGATATGG - Intergenic
1184272870 22:43394797-43394819 GAGGTTAAACAGCATGACCAAGG + Intergenic
1184997343 22:48217993-48218015 GAGTGCAAACAGCAGGAAGGAGG - Intergenic
1185100696 22:48839391-48839413 GAGGGCACAGAGCAGGCGCTGGG + Intronic
1185155764 22:49192534-49192556 GAGGGAAAGCCGCAGGAGCCCGG + Intergenic
1185330593 22:50250552-50250574 CAGGGTCACCAGCAGGAGCAGGG + Intronic
949276859 3:2294107-2294129 AAGAGCAAAGAGCAGAAGCAAGG + Intronic
949842777 3:8338142-8338164 GAGGTTTAACAGCAGGAGCCTGG + Intergenic
950544351 3:13629791-13629813 GAGGGCAGGCAGCAGGTACAGGG - Intronic
950863830 3:16173566-16173588 GGGGGCAAAAAGCAGGAGCAGGG - Intergenic
950994388 3:17480033-17480055 GAGAGCGGACACCAGGAGCAGGG - Intronic
951640358 3:24829308-24829330 GAGAGCAGACAGCGGGAGCCCGG - Intergenic
951881758 3:27486381-27486403 GCTGGCAAACAGCTGGAGGATGG + Intergenic
953214170 3:40902218-40902240 GAGGGCAGACAGCAAGAGGCAGG + Intergenic
953417697 3:42732357-42732379 GAGTGTTGACAGCAGGAGCATGG + Intronic
953576958 3:44120624-44120646 GAGAGCAAACAGAATGGGCAAGG + Intergenic
954367376 3:50153892-50153914 GAGGGTAAAGAGCAGGAAGAAGG + Intergenic
954442393 3:50528834-50528856 GAGGTCACACAGCTGGAGCTTGG - Intergenic
954524862 3:51261260-51261282 GAGGGCAAGCAGAAGGAGGGTGG + Intronic
955758250 3:62249297-62249319 GAGGGCAGACAGGAGGGGCAGGG + Intronic
956095481 3:65711731-65711753 GAGGGATAACAGCAGGAGTCTGG + Intronic
956262682 3:67362257-67362279 GAGGGAGAACAGCATGTGCAAGG - Intronic
956554130 3:70498922-70498944 GAAGGAAAACAGGAGGGGCAAGG - Intergenic
957733602 3:84177521-84177543 GAGGGCAGAGAGTAGGAGGAAGG + Intergenic
959679899 3:109082826-109082848 GAGGGAATAAAGCAAGAGCAAGG + Intronic
959774877 3:110146418-110146440 GAGAGCAAACAACAATAGCATGG - Intergenic
959844060 3:111012767-111012789 GCAGGGAAGCAGCAGGAGCAGGG - Intergenic
960169968 3:114448452-114448474 GAGGGCAAACAGATGGATCAAGG + Intronic
961418949 3:126784471-126784493 GGGGGCAGAAAGCAGCAGCAAGG - Intronic
961546761 3:127639637-127639659 GCAGGTAAACAGCAGCAGCATGG - Intronic
961786609 3:129351102-129351124 CAGAGGAAACAGCATGAGCAAGG - Intergenic
962257676 3:133883602-133883624 GAGGGCAAACAGGGGAAGCAAGG - Intronic
962317596 3:134368493-134368515 AAGGTTAAACAGCTGGAGCAGGG - Intronic
962765633 3:138560207-138560229 GAGGGCAAACCGAAGGAGGGTGG + Intronic
963317111 3:143771710-143771732 GAGGGACAACAGCAGGAGCACGG - Intronic
964602989 3:158523769-158523791 GAGAGGAATGAGCAGGAGCATGG + Intronic
966862749 3:184239661-184239683 GAGGCAAGACAGCAGGGGCATGG - Intronic
966863549 3:184243805-184243827 GAGGGCAAACAGCAGGAGCAGGG + Exonic
966954355 3:184858607-184858629 GAGAGCAATGAGCAGGAACATGG + Intronic
967866946 3:194198125-194198147 GAGGCCACACAGCAGGAGCTTGG - Intergenic
968547433 4:1206183-1206205 GGGGGCACACATGAGGAGCAGGG - Intronic
968964361 4:3762039-3762061 GAGGGCTGACCGCAGGAGCCAGG + Intergenic
969029279 4:4198130-4198152 GAGGGCGATTAGCAGGTGCAAGG + Intronic
969093224 4:4712518-4712540 CAGGACATACAGCAGGAGCAAGG + Intergenic
969677327 4:8621314-8621336 GTGTGGAAACAGCAGGCGCAAGG + Intergenic
969678282 4:8626952-8626974 GTGTGGAAACAGCAGGCGCAAGG + Intergenic
969679238 4:8632590-8632612 GTGTGGAAACAGCAGGCGCAAGG + Intergenic
969690495 4:8701552-8701574 GAGGGAAAACAGGAGGAGCTGGG + Intergenic
970422087 4:15914843-15914865 GTGGGCAAGCACCAGGAGAAGGG + Intergenic
970475001 4:16413036-16413058 GTGGCCACACAGCAGGAGGATGG - Intergenic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971664707 4:29467454-29467476 CAGGGCAGACAGGAGGAGCTGGG + Intergenic
972772051 4:42206555-42206577 GTCTGCAGACAGCAGGAGCATGG + Intergenic
973715303 4:53670108-53670130 GAGGGCAAACTGAAGCAGCGTGG - Intronic
973922654 4:55704557-55704579 CAGGGCAAACAGCAAGGACAAGG + Intergenic
974076124 4:57170153-57170175 GAGGTCAAACTGATGGAGCATGG + Intergenic
974333869 4:60514625-60514647 GAGTGCAAACAGGAGTACCAAGG + Intergenic
974531293 4:63111041-63111063 GAGCAAAAACAGCAGGAGCCGGG + Intergenic
975740542 4:77425178-77425200 GAGGGCAAGAAGTAGGTGCAAGG + Intronic
978016236 4:103749833-103749855 GAAGGAAAACAGGAGGAGCAGGG - Intergenic
978482542 4:109210741-109210763 CAGGGGAAACAGCTGGAACATGG - Intronic
979507011 4:121510113-121510135 GAGGGAGAAAAGCAGGATCAGGG - Intergenic
980034748 4:127871030-127871052 TAGGGAAAACAGCAGGAGTGAGG + Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
980612083 4:135172615-135172637 GGGAGCAAAGAGCAGGAGGATGG + Intergenic
981488944 4:145319177-145319199 GAGGGCAAAGAAGAGGAACAGGG - Intergenic
981528839 4:145733306-145733328 GGGGGGAATCAGCAGGAGGAGGG - Intronic
983077354 4:163343278-163343300 GTGGGCAAGTGGCAGGAGCAGGG - Intronic
983628467 4:169826492-169826514 GGAGACAAACAGCAGGAACAAGG - Intergenic
983651415 4:170040368-170040390 GAAGTCAGGCAGCAGGAGCAGGG - Intergenic
983948195 4:173609603-173609625 AAGGTCAAACAGCAGAAACACGG - Intergenic
984595706 4:181664801-181664823 GAGGGCAGAGAGCAAGAGCGGGG - Intergenic
985126697 4:186701704-186701726 GAGGACGTGCAGCAGGAGCAGGG + Intronic
985314674 4:188643940-188643962 GAGGGGAGACAGGAGGAACATGG - Intergenic
985669720 5:1201156-1201178 GAGGGAACTCAGCGGGAGCAGGG - Intergenic
985699341 5:1361121-1361143 GAGGGCAGAGGGCAGGAGGAGGG + Intergenic
986178992 5:5376121-5376143 GAGGGTAAACAGCAAGAGCAAGG + Intergenic
986306179 5:6518708-6518730 GAGGGCAGCCAGCAGCACCAGGG - Intergenic
986307937 5:6529261-6529283 GAAGGGAACCAGGAGGAGCAGGG - Intergenic
986308856 5:6536334-6536356 CAGGGAAAACAGCAGGTCCAGGG - Intergenic
987885087 5:23802201-23802223 GAGCCCAAACAGCAGGAGATAGG - Intergenic
988099760 5:26660997-26661019 GAGGGAAGAGAGCAAGAGCAGGG + Intergenic
988857910 5:35247120-35247142 GAGGCCAACCAAAAGGAGCAAGG - Intergenic
990332919 5:54745214-54745236 GAGGGCAAACAGAACCAGTAGGG + Intergenic
991021079 5:61980755-61980777 GAGGGCAGGTAGCAGGTGCATGG + Intergenic
992029151 5:72703156-72703178 GAAGGCAAATGGCAGGATCAAGG + Intergenic
992193570 5:74317521-74317543 GAGGGCAAACAGCTTGCCCAAGG + Intergenic
992732545 5:79688041-79688063 GAGGGAAAACAGCAGAGTCAAGG - Intergenic
993307403 5:86289767-86289789 CAGGGCCTACAGCAGGTGCAAGG - Intergenic
993431983 5:87842964-87842986 GAGAGCTAACAGCAGTAGGAAGG - Intergenic
994412820 5:99431039-99431061 AAGGGAAATCAGCAGGAGAACGG - Intergenic
994481021 5:100334681-100334703 AAGGGAAATCAGCAGGAGAACGG + Intergenic
995482412 5:112606321-112606343 GAGGTGAAAAAGCAGGAACAAGG + Intergenic
995511856 5:112918510-112918532 GAGAGGAAACAGCAAGAGAAAGG + Intronic
997472568 5:134124962-134124984 GAGGTCACACAGCAGGGGGAGGG - Intronic
997786110 5:136715500-136715522 GAGGGGAAGGGGCAGGAGCAGGG - Intergenic
998377685 5:141702130-141702152 GAGGTCATACAGCAAGAGCCAGG - Intergenic
998785994 5:145709405-145709427 GGTGGGAGACAGCAGGAGCAGGG + Intronic
999115004 5:149155178-149155200 GATGGTAAAAAGGAGGAGCAGGG - Intronic
999247080 5:150160764-150160786 GAGGGCACACAGCAGGCCTAGGG + Intergenic
999322580 5:150624653-150624675 GGGAGCAGGCAGCAGGAGCACGG + Intronic
999365056 5:151017995-151018017 GAGGGCAATCAGAAGCAGCCTGG + Intergenic
999623105 5:153491725-153491747 GAGAGCCAACAGGAGGAGAAAGG - Intronic
1001052465 5:168424047-168424069 GAGGGCAAGCAGCTGGGCCAAGG + Exonic
1001138611 5:169123980-169124002 GAGAGGAATGAGCAGGAGCATGG - Intronic
1001433805 5:171683904-171683926 TAGGGCAAACAGGAGGAGGTGGG - Intergenic
1001847802 5:174937286-174937308 CATGGCAAACAGCAGGTGCTGGG + Intergenic
1002181415 5:177432924-177432946 CAGGTCACACAGCAGGGGCAAGG - Intronic
1002571558 5:180142559-180142581 GATGGCAAACAAAGGGAGCATGG + Intronic
1002691438 5:181053248-181053270 GAGGACCAACAGCAGCGGCAGGG - Exonic
1003465497 6:6376524-6376546 GGGGCCATGCAGCAGGAGCAGGG + Intergenic
1003722299 6:8717684-8717706 GAAGGCAGACTGCAGAAGCAAGG - Intergenic
1004039975 6:11965912-11965934 GAAGGCAAAGGGCAGGAGCTTGG - Intergenic
1004991022 6:21138898-21138920 AAGGGCACACAGAAGGAGAAAGG - Intronic
1005615260 6:27566585-27566607 GAGGGACAAGAGCAGGAGCCTGG + Intergenic
1006053185 6:31359285-31359307 GAGGACAAGGAGCAGGAGAAAGG - Intergenic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1006457095 6:34138182-34138204 GAGGGCCAAGAGCAGGAACCAGG - Intronic
1006640372 6:35486405-35486427 GAGGGCAGAGAGCAGGGGGAAGG + Intronic
1006824328 6:36923321-36923343 GAGGGGAAATAGCAAGAGGAAGG - Intronic
1006846756 6:37067550-37067572 GAGAGGAATGAGCAGGAGCATGG - Intergenic
1006877954 6:37314967-37314989 GAGGGCTAACAGCTGGGCCAGGG - Intronic
1007111177 6:39314234-39314256 GTAGGCGAGCAGCAGGAGCACGG + Exonic
1007216960 6:40247871-40247893 CAGGTGAGACAGCAGGAGCAAGG - Intergenic
1008640644 6:53458845-53458867 TAGAGCATTCAGCAGGAGCATGG + Intergenic
1009718335 6:67428676-67428698 GAGGGCGAACAGAAGCAGGATGG - Intergenic
1010033535 6:71294381-71294403 GAGAGCAAATAGCAGAAGCCAGG - Intronic
1010290708 6:74133312-74133334 GAGGGCACACAGTAGGAGGTGGG + Intergenic
1011020784 6:82809787-82809809 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1012445456 6:99302729-99302751 GAGGCCATACAGCAGGAGGTAGG + Intronic
1013171095 6:107636722-107636744 GAGTGCAAACTCCAGGAGGAAGG + Intronic
1013460508 6:110370861-110370883 GAGAGGAATGAGCAGGAGCATGG - Intergenic
1013726814 6:113108110-113108132 GAGGGCAAAAGGCAAGAGGAGGG - Intergenic
1014472623 6:121835100-121835122 CAGAGAAAACAGCAGGAACAAGG - Intergenic
1015199809 6:130566537-130566559 GAGGAGAAAGAGCAAGAGCAAGG + Intergenic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1016920518 6:149288796-149288818 GAGGGGCAAGAGCAGAAGCAGGG - Intronic
1017070691 6:150573337-150573359 GATGTCAGCCAGCAGGAGCAGGG + Intergenic
1018787450 6:167119138-167119160 GGGGACAAACAGCATGAGCCTGG - Intergenic
1019050201 6:169176863-169176885 GAGGGCAAATCCCAGGAGAAAGG + Intergenic
1019154969 6:170032578-170032600 GAGGCAACAGAGCAGGAGCAGGG + Intergenic
1019575557 7:1735944-1735966 AAGGTCACACAGCAGGCGCACGG + Intronic
1021942314 7:25689802-25689824 GTGGGCAAACAGCTGGAGGATGG - Intergenic
1022095337 7:27137246-27137268 CAGGGGAAAGAGCAGGAGAAAGG + Intronic
1022764328 7:33393775-33393797 GAGGGCTAACTGCAGGATGATGG - Intronic
1023737625 7:43248766-43248788 GAGGGGAAACAGGAGGAGAACGG - Intronic
1024329788 7:48144370-48144392 GAGGGCAAAGAGTAGGTACAAGG + Intergenic
1024610465 7:51059750-51059772 TAGTGCAAACAGCAGGATGAGGG - Intronic
1024634365 7:51275320-51275342 GAGGGAAAAAACCAGGAGGATGG - Intronic
1025288171 7:57685618-57685640 GAGACCAAGGAGCAGGAGCATGG + Intergenic
1026234711 7:68516883-68516905 GAGGGCACAAAGGAGAAGCAAGG + Intergenic
1026946749 7:74321058-74321080 AGGGTCACACAGCAGGAGCAGGG - Intronic
1027159400 7:75791408-75791430 GAGGGAAGAGAGCAGGAGCCAGG - Intergenic
1027470606 7:78568961-78568983 TAGGGCAAACAGCAAGTGAAAGG - Intronic
1028998447 7:97127095-97127117 GAGGGCGAGCAGAAGCAGCATGG - Intronic
1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG + Intergenic
1030153529 7:106429050-106429072 CAGGGCAAGAAGCAGGAGTATGG - Intergenic
1032083989 7:128874210-128874232 GAGGGCAAGCGGAAGGGGCAGGG - Intronic
1032527981 7:132594174-132594196 GAGGTCATACTGGAGGAGCATGG + Intronic
1032859288 7:135862268-135862290 GGGGGCATACAACAGGAACAAGG - Intergenic
1033648230 7:143321254-143321276 AGGGGCACACAGAAGGAGCACGG + Intronic
1034439358 7:151078785-151078807 GAGGGCTGACAGGAGGAGGAAGG - Intronic
1035141462 7:156766698-156766720 GTGGGCAAGCAGGAGGAGCAGGG + Intronic
1035212037 7:157336167-157336189 GATGGTGACCAGCAGGAGCAGGG - Intronic
1035282357 7:157786018-157786040 GAGGCCAAACAGCAGGGGCCTGG - Intronic
1035297298 7:157874375-157874397 GGGGGCAGAAAGCAGGAGCTGGG - Intronic
1036505958 8:9356293-9356315 GAAGGCAAAAAGAAAGAGCAGGG - Intergenic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1038090891 8:24251883-24251905 GAGGGCAAGAAGTAGGTGCAAGG - Intergenic
1038220131 8:25599566-25599588 GAGGGACAACGGCAGGGGCAGGG - Intergenic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1038746803 8:30261850-30261872 GAGGTCCAAGGGCAGGAGCAAGG - Intergenic
1039383794 8:37112123-37112145 GAGGGTAAATGGCAGGAGGAGGG + Intergenic
1041126778 8:54649376-54649398 GTGGACAGACATCAGGAGCAAGG + Intergenic
1041485159 8:58368434-58368456 CATGGCAAACACCACGAGCAAGG - Intergenic
1042835340 8:73074785-73074807 GAGGGCACACAGTGGGTGCAGGG + Intronic
1044717345 8:95112719-95112741 GAGAGGAATCGGCAGGAGCATGG - Intronic
1044892534 8:96852555-96852577 GAGAGAAATAAGCAGGAGCAAGG - Intronic
1046237918 8:111451047-111451069 GAGGAGAAACAGCAGGACCCTGG + Intergenic
1046776010 8:118164114-118164136 GAGGGAGAGCAGCAGGAGGAAGG + Intergenic
1047258722 8:123236969-123236991 GCGGGCAAACAGCTGGAGGATGG + Intronic
1047538163 8:125738194-125738216 GAGATCACACAGCAGGAGTATGG - Intergenic
1047829823 8:128617106-128617128 GGGAGCAAAGAGCAGGAGGAAGG + Intergenic
1048194533 8:132321506-132321528 GAGAGCAAACAGAAGCAGGAGGG - Intronic
1049287479 8:141783660-141783682 AATGGGAAACAGCAGGAGAAGGG + Intergenic
1049403901 8:142443174-142443196 GAGGGCCAAGGGCAGGCGCAGGG + Intergenic
1049478319 8:142807118-142807140 GAGGGCAGACAGGATGAGGAGGG - Intergenic
1049514298 8:143045297-143045319 CAGGGCCACCAGCAGGACCAGGG + Intronic
1049997850 9:1048229-1048251 GAGGAGAAACAGGAGGAGAAAGG - Intergenic
1050077071 9:1876341-1876363 GAGGGCAAAGAGCAGCAACGTGG + Intergenic
1050286512 9:4108358-4108380 GAGAGCAAAAATAAGGAGCAAGG + Intronic
1050533378 9:6609676-6609698 GAGGGCAGAGGGCGGGAGCAGGG - Intronic
1051059971 9:13034464-13034486 GAGGGGAAACAGCAGAAGAATGG - Intergenic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052849952 9:33372021-33372043 GAAGGTAAACAGCAGGAGACAGG + Intergenic
1053307217 9:36993563-36993585 GAAGGGACACAGCAGGGGCAGGG + Intronic
1053377979 9:37624336-37624358 CAGGGCACACAGCAGGAGACAGG + Intronic
1053435481 9:38070860-38070882 GAGGGCAGACAGCAAGGCCAGGG + Intergenic
1053586545 9:39464487-39464509 GAGGGCAGACGGCAGGAGGTGGG + Intergenic
1054579762 9:66900746-66900768 GAGGGCAGACGGCAGGAGGTGGG - Exonic
1056872585 9:90297233-90297255 GATGGCAAACAGCAGGAGTTTGG - Intergenic
1057167624 9:92941139-92941161 GAGGGAAAACAGCAGGGGGAAGG + Intergenic
1057438679 9:95065485-95065507 AAGGGCAGCCAGCAGGAGAAGGG - Intronic
1059452333 9:114378158-114378180 GTGTGCACATAGCAGGAGCAGGG - Intronic
1059466523 9:114472169-114472191 GAGGGTAGATGGCAGGAGCAAGG - Intronic
1059499254 9:114737221-114737243 CAGGTCACACAGCAGGAGCTGGG - Intergenic
1060554545 9:124501536-124501558 GAGGGGAAAGAGCAGGAGAGAGG + Intronic
1060836971 9:126763388-126763410 GAGGCCACAGTGCAGGAGCACGG - Intergenic
1061377980 9:130237239-130237261 GACGACATACAGCAGGAGCTTGG - Exonic
1061423263 9:130483737-130483759 GAAGGCAAGGAGGAGGAGCAAGG - Intronic
1061970058 9:134040041-134040063 GAAGGCCAACAGCACGACCACGG - Exonic
1062562479 9:137147814-137147836 GGGGCCACACAGCAGGTGCACGG + Intronic
1062571420 9:137187431-137187453 GCGGGGAACCAGAAGGAGCAAGG + Intronic
1062675353 9:137740037-137740059 GAGGGAAAAAAGCAAGTGCACGG - Intronic
1062716932 9:138015378-138015400 GCACGCAAACAGCAGCAGCAGGG - Intronic
1185688279 X:1948314-1948336 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185688580 X:2133890-2133912 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185961015 X:4545799-4545821 GGGAGCAAAGAGCAGGAGGACGG + Intergenic
1186191749 X:7073546-7073568 GCGGGCAAGAAGCAGCAGCAGGG + Intronic
1186830483 X:13385040-13385062 GAGCACACACAGCAGGAACAAGG + Intergenic
1187802009 X:23074425-23074447 GAGGGTAAACAGTGGGAGGAGGG + Intergenic
1188627155 X:32298809-32298831 GAAGGCACCCAGCAGGAGGAGGG + Intronic
1190061462 X:47214505-47214527 GAGGGGGAACAGCAGGGTCATGG - Intronic
1190216127 X:48480596-48480618 GAGGGCCAAGGGCAGAAGCAGGG + Intronic
1190320124 X:49175156-49175178 GAGTGGAAACAGCTGGGGCAAGG + Exonic
1193228498 X:79013712-79013734 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1194703286 X:97142382-97142404 GAGAGAAAACAACATGAGCAAGG + Intronic
1194848815 X:98846826-98846848 GAGGGCATTGAGCAAGAGCAAGG - Intergenic
1195581508 X:106509190-106509212 GAGGGAAAACAGGAAGAGTATGG - Intergenic
1197841541 X:130752927-130752949 GAGAACACACAGAAGGAGCAAGG - Intronic
1199574623 X:149301505-149301527 GAGGGCAAACAGCAGAAGGCAGG + Intergenic
1199683019 X:150240426-150240448 TGGGGGACACAGCAGGAGCAAGG + Intergenic
1200048861 X:153417838-153417860 GAGGTCATACTGTAGGAGCAGGG + Intergenic
1200789934 Y:7290772-7290794 GAGCTCAAACAGCACCAGCAGGG - Intergenic
1200795749 Y:7339751-7339773 GAGTGCAATTAGCAAGAGCAAGG + Intergenic
1201376662 Y:13330374-13330396 GAGGGCAAACAGAAGCAGGGTGG + Intronic
1202378867 Y:24259795-24259817 GAGGGGAAGCAGCAGGACCTGGG - Intergenic
1202491915 Y:25410326-25410348 GAGGGGAAGCAGCAGGACCTGGG + Intergenic