ID: 966864528

View in Genome Browser
Species Human (GRCh38)
Location 3:184249897-184249919
Sequence AATCCCGGCGCGGCCCCGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 111}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966864515_966864528 30 Left 966864515 3:184249844-184249866 CCTCCTAGAGCCGGAGCTGCGGC 0: 1
1: 0
2: 1
3: 14
4: 126
Right 966864528 3:184249897-184249919 AATCCCGGCGCGGCCCCGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 111
966864519_966864528 8 Left 966864519 3:184249866-184249888 CCCGAGGACCGTATCCTTGTGCT 0: 1
1: 0
2: 0
3: 4
4: 48
Right 966864528 3:184249897-184249919 AATCCCGGCGCGGCCCCGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 111
966864518_966864528 20 Left 966864518 3:184249854-184249876 CCGGAGCTGCGGCCCGAGGACCG 0: 1
1: 0
2: 0
3: 5
4: 123
Right 966864528 3:184249897-184249919 AATCCCGGCGCGGCCCCGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 111
966864525_966864528 -6 Left 966864525 3:184249880-184249902 CCTTGTGCTAGGTGGGTAATCCC 0: 1
1: 0
2: 0
3: 8
4: 60
Right 966864528 3:184249897-184249919 AATCCCGGCGCGGCCCCGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 111
966864516_966864528 27 Left 966864516 3:184249847-184249869 CCTAGAGCCGGAGCTGCGGCCCG 0: 1
1: 0
2: 1
3: 9
4: 173
Right 966864528 3:184249897-184249919 AATCCCGGCGCGGCCCCGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 111
966864520_966864528 7 Left 966864520 3:184249867-184249889 CCGAGGACCGTATCCTTGTGCTA 0: 1
1: 0
2: 0
3: 2
4: 46
Right 966864528 3:184249897-184249919 AATCCCGGCGCGGCCCCGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 111
966864524_966864528 0 Left 966864524 3:184249874-184249896 CCGTATCCTTGTGCTAGGTGGGT 0: 1
1: 0
2: 1
3: 1
4: 68
Right 966864528 3:184249897-184249919 AATCCCGGCGCGGCCCCGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966864528 Original CRISPR AATCCCGGCGCGGCCCCGCC AGG Intronic
900342227 1:2194652-2194674 AAACCGGCCGCGCCCCCGCCCGG + Intronic
901792589 1:11662098-11662120 AATCCAGGCCCGGCCCCCTCTGG + Exonic
902823297 1:18956398-18956420 GCTCCCGGCGCGGCCGGGCCAGG + Exonic
905179251 1:36156310-36156332 ACGCCCGGCCCGGCCCGGCCCGG - Exonic
913615892 1:120558960-120558982 TTTCCCGGCCCCGCCCCGCCTGG + Intergenic
914574387 1:148951942-148951964 TTTCCCGGCCCCGCCCCGCCTGG - Intronic
916065454 1:161132472-161132494 AAGCCCTTTGCGGCCCCGCCCGG + Intronic
922783323 1:228269982-228270004 AGGCCCGGCGCGGCCGCGGCCGG - Intronic
1067091168 10:43266541-43266563 ACGCCCGGCCCGGCCCGGCCCGG + Intronic
1076792515 10:132784858-132784880 AATCCGGGGGCGGCCCCGGGTGG - Exonic
1076900483 10:133335333-133335355 ACTCCTGGCGCGGGCCCTCCGGG - Intronic
1078527364 11:12110908-12110930 AAGCCCGGGGCGGCCCTGGCCGG + Intronic
1078631800 11:13010053-13010075 GGCCCCGGCGCGGCCCAGCCTGG + Intergenic
1085430792 11:76445700-76445722 CATCCCGGCGCGTCCTAGCCAGG - Intronic
1095703848 12:45216878-45216900 CTTCCCGGGGCCGCCCCGCCAGG - Intronic
1097046200 12:56189319-56189341 GGTCCCCGCGCGGCCCGGCCCGG + Intronic
1116905193 14:50396970-50396992 ACCCCCGGCCCGGCCCAGCCCGG + Intronic
1117131974 14:52695748-52695770 CTTCCCGGCTCGGCCCCGCCCGG + Intronic
1119325880 14:73759420-73759442 CACCCGGGCGCGGCCCCGCCAGG - Intronic
1122960993 14:105093554-105093576 AATCCCCTCGTGGCCTCGCCAGG - Intergenic
1129424552 15:75454468-75454490 TCTCCCGGCGTCGCCCCGCCCGG + Intronic
1130347960 15:83066696-83066718 CAGCCCGGCCCGGCCCGGCCCGG + Intronic
1131825952 15:96322677-96322699 GAGCTCGGCGCGGCCCCGCCCGG - Intergenic
1131837981 15:96409413-96409435 AATCCCGGCGGGGCAGGGCCGGG + Intergenic
1140097028 16:71884006-71884028 AGTCCCGGAGCGCCCCGGCCCGG - Exonic
1143479462 17:7220148-7220170 AGCCCCGGCCCGGCCCTGCCCGG + Exonic
1143543525 17:7583146-7583168 AATCCCGGGACTGCCTCGCCAGG + Intergenic
1143625983 17:8110357-8110379 CATCCCGGGGCGGCGGCGCCGGG + Intronic
1146022512 17:29292594-29292616 AATCCCCCCGCCGCCCCCCCAGG + Intronic
1146438999 17:32877184-32877206 CGTCCCGGCTCCGCCCCGCCCGG + Intergenic
1148225649 17:45896381-45896403 AAAGCCGGAGAGGCCCCGCCAGG - Intronic
1148356365 17:46978501-46978523 AGTCTCGCCGCGTCCCCGCCCGG + Exonic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1148854584 17:50571785-50571807 ACTCCCGGAGGGGCCCCACCAGG - Intronic
1151218353 17:72592836-72592858 CGTCCCGGCGCGGGTCCGCCTGG - Intergenic
1152924092 17:83079724-83079746 AAGCCCGCCCCGCCCCCGCCCGG + Exonic
1157545152 18:48541207-48541229 AAGCCCAGCGCGCCCCAGCCCGG + Intronic
1160668325 19:344215-344237 ACTCCCGACGCGGACCCGCCTGG - Intronic
1160754678 19:751189-751211 GATCCCCGCCCGGCCCGGCCCGG - Intronic
1161017515 19:1990667-1990689 AATCCCAGCGGGGCCTCGGCGGG - Intronic
1161080624 19:2308237-2308259 AGCCCCCGCGCGCCCCCGCCAGG - Intronic
1161794848 19:6380752-6380774 AATCCTGGCACTGCCCAGCCTGG - Intronic
1162744652 19:12791720-12791742 AGGCCCGGAGCGGCCCCGCAGGG + Exonic
1163597050 19:18226341-18226363 GATCCCCGCGCGGCTCCCCCGGG - Intronic
1163807258 19:19406498-19406520 AGTCCCCGCGCGCCCACGCCTGG + Intronic
1167001064 19:46746097-46746119 CAACCCGGCCCGGCCCGGCCCGG - Intronic
926268077 2:11344335-11344357 CAGCCCGGCCCGGCCCTGCCGGG + Exonic
934079188 2:88452727-88452749 GAGCCCGGCGCGGCTCCTCCTGG + Intergenic
937335811 2:121061811-121061833 AACCCCTGGGAGGCCCCGCCGGG + Intergenic
941096690 2:161245167-161245189 AGGCCCGGCGCGGCCGCGGCCGG - Intergenic
942170242 2:173282761-173282783 AATTCCAGCGCAGCCCCGGCGGG + Intergenic
946351783 2:219160272-219160294 CATCCCGGCTGGGCCCCGCCCGG + Intronic
947860590 2:233354764-233354786 AGGCCCGGCTCGGCCCGGCCCGG + Intronic
1170524762 20:17226845-17226867 ACCCCCGGCCCGGCCCGGCCCGG - Intronic
1171810404 20:29741968-29741990 AAGTGCGGCGCGGCCCCGGCCGG + Intergenic
1174386395 20:50190587-50190609 AATCCCGGGGCGGCCGGGCGGGG + Intergenic
1174494577 20:50930801-50930823 AAGCCCGGCGCCGCCGCGCGCGG - Intronic
1175260766 20:57672807-57672829 AATCCTGGCGCTGTCCTGCCTGG + Intronic
1176207238 20:63895543-63895565 ACCCCCGGCCCGGCCCGGCCCGG - Intronic
1179812283 21:43879750-43879772 CATCCCCGGGCGGCCCAGCCAGG - Intronic
1183665516 22:39243968-39243990 ACTCCGGGCCCGGCCCCGCGGGG + Exonic
1185259364 22:49853318-49853340 GCTCCCCGCGCGGCCCCCCCGGG - Intergenic
950683682 3:14602274-14602296 AACCCCTGCGCGGGGCCGCCCGG - Intergenic
954812377 3:53256054-53256076 CATCCCCGCCCCGCCCCGCCCGG - Intergenic
961754863 3:129121686-129121708 CGGCCCGGCTCGGCCCCGCCCGG + Exonic
966821882 3:183931406-183931428 AACCCCTGCCCTGCCCCGCCAGG + Intronic
966860846 3:184230229-184230251 AGTCCCGCCGCGGCTCCCCCGGG - Intronic
966864528 3:184249897-184249919 AATCCCGGCGCGGCCCCGCCAGG + Intronic
968808743 4:2790719-2790741 AACGTCGGTGCGGCCCCGCCAGG - Intergenic
975410043 4:74038737-74038759 AAGCCCGGAGCGGCCGGGCCAGG + Intronic
977809691 4:101346016-101346038 AATCCCGGGGCGGCAACGGCTGG + Intronic
979624158 4:122827149-122827171 GATCCCGGCCGGGCCCCGCAGGG + Exonic
985782305 5:1877790-1877812 AAGCCCGGCGCTGCCACGCCGGG - Exonic
1004217596 6:13716940-13716962 AATCCCAGCGCAGCGCCGGCAGG - Intergenic
1006581395 6:35079675-35079697 AGTCCCTGCGTGGCCCGGCCTGG + Intronic
1013117668 6:107115114-107115136 AAACTCGGCGCGGGCCCGCCCGG - Intronic
1015749997 6:136550122-136550144 CAGCCCGGCTCGGCCCCGGCCGG - Intronic
1017446328 6:154510266-154510288 CGTCCCAGCGCGGCTCCGCCAGG + Exonic
1018940767 6:168307893-168307915 GATCTCGGCCCGGGCCCGCCTGG - Exonic
1021828101 7:24573925-24573947 CTCCCCGGCGCGGCCCCGACTGG + Intronic
1022715071 7:32891626-32891648 CCTCCCGCCGCGGCCTCGCCTGG + Exonic
1024520926 7:50303965-50303987 CATCGCGCCGCGGCCCCGCACGG - Intergenic
1029496031 7:100895821-100895843 GCTCCCGGCGCGGCCCGGCCCGG - Exonic
1032125322 7:129189010-129189032 AATCCGGGCCCGGGCCCCCCCGG - Exonic
1032194476 7:129781157-129781179 AGTCCCAGCTCCGCCCCGCCCGG + Intergenic
1034243172 7:149624853-149624875 ACTGCAGGCGCGACCCCGCCTGG + Intergenic
1042020629 8:64369602-64369624 ATTCCCGCCGCGACCTCGCCCGG - Intergenic
1042235878 8:66613054-66613076 AGCCCCGGCCCGGCCCGGCCAGG + Exonic
1042591518 8:70402844-70402866 GAGCCCGGCTCGGCGCCGCCGGG + Intronic
1042965832 8:74350716-74350738 CACCCGGGCGCGTCCCCGCCTGG - Intronic
1043527489 8:81112185-81112207 ACCCCCAGCCCGGCCCCGCCCGG - Intergenic
1044340426 8:91040769-91040791 AACCCCGGCTCGGCCTCCCCAGG - Exonic
1049651343 8:143771338-143771360 AACCCCGGCTCGGCCGCGCTGGG + Intergenic
1053239960 9:36487450-36487472 AAGCTCGGCGGGGCCCGGCCTGG + Intronic
1056078167 9:83062621-83062643 AGTCCCGGCGCCGCCCCCCGCGG + Exonic
1058908129 9:109498003-109498025 CCTCCCGCCCCGGCCCCGCCAGG + Intronic
1061281010 9:129597618-129597640 AGGCCCGGCGCGTCCCCGCTGGG + Intergenic
1061807472 9:133144425-133144447 CACCCCGCCTCGGCCCCGCCTGG + Intronic
1062696404 9:137878236-137878258 GGTCCCCGCCCGGCCCCGCCCGG - Intronic
1203360683 Un_KI270442v1:217708-217730 AAGTGCGGCGCGGCCCCGGCTGG + Intergenic
1186660626 X:11664922-11664944 AACCCCGGGCCAGCCCCGCCTGG - Exonic
1189320370 X:40083764-40083786 CCTCGCGGCGCGCCCCCGCCAGG + Intronic
1193600936 X:83508185-83508207 AATCGCAGCGCGTCTCCGCCTGG - Intergenic
1196443334 X:115732933-115732955 AGGCCCGGCCCGGCCCGGCCCGG + Intergenic
1196444188 X:115737004-115737026 AGGCCCGGCCCGGCCCGGCCCGG - Intergenic
1196445655 X:115844848-115844870 AGGCCCGGCCCGGCCCGGCCCGG + Intergenic
1196446326 X:115847829-115847851 AGGCCCGGCCCGGCCCGGCCCGG + Intergenic
1196446997 X:115850810-115850832 AGGCCCGGCCCGGCCCGGCCCGG + Intergenic
1196447666 X:115853793-115853815 AGGCCCGGCCCGGCCCGGCCCGG + Intergenic
1196448336 X:115856772-115856794 AGGCCCGGCCCGGCCCGGCCCGG + Intergenic
1196449005 X:115859763-115859785 AGGCCCGGCCCGGCCCGGCCCGG + Intergenic
1196449676 X:115862754-115862776 AGGCCCGGCCCGGCCCGGCCCGG + Intergenic
1196450345 X:115865737-115865759 AGGCCCGGCCCGGCCCGGCCCGG + Intergenic
1196451015 X:115868722-115868744 AGGCCCGGCCCGGCCCGGCCCGG + Intergenic
1196451686 X:115871701-115871723 AGGCCCGGCCCGGCCCGGCCCGG + Intergenic
1196452357 X:115874688-115874710 AGGCCCGGCCCGGCCCGGCCCGG + Intergenic
1196453027 X:115877657-115877679 AGGCCCGGCCCGGCCCGGCCCGG + Intergenic
1196453697 X:115880650-115880672 AGGCCCGGCCCGGCCCGGCCCGG + Intergenic
1196454366 X:115883659-115883681 AGGCCCGGCCCGGCCCGGCCCGG + Intergenic
1196455446 X:115888731-115888753 AGGCCCGGCCCGGCCCGGCCCGG + Intergenic