ID: 966867762

View in Genome Browser
Species Human (GRCh38)
Location 3:184269694-184269716
Sequence ACTTTAGCCTGGAAAATTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 8, 3: 45, 4: 385}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966867762_966867770 10 Left 966867762 3:184269694-184269716 CCCTCAATTTTCCAGGCTAAAGT 0: 1
1: 0
2: 8
3: 45
4: 385
Right 966867770 3:184269727-184269749 CCTCAGCCCCCTGAGTAGCTGGG 0: 1388
1: 100786
2: 206642
3: 240744
4: 152662
966867762_966867768 9 Left 966867762 3:184269694-184269716 CCCTCAATTTTCCAGGCTAAAGT 0: 1
1: 0
2: 8
3: 45
4: 385
Right 966867768 3:184269726-184269748 TCCTCAGCCCCCTGAGTAGCTGG 0: 32
1: 2936
2: 105862
3: 212183
4: 243422
966867762_966867774 18 Left 966867762 3:184269694-184269716 CCCTCAATTTTCCAGGCTAAAGT 0: 1
1: 0
2: 8
3: 45
4: 385
Right 966867774 3:184269735-184269757 CCCTGAGTAGCTGGGACTACAGG 0: 826
1: 44844
2: 164903
3: 224557
4: 209880

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966867762 Original CRISPR ACTTTAGCCTGGAAAATTGA GGG (reversed) Intronic