ID: 966867768

View in Genome Browser
Species Human (GRCh38)
Location 3:184269726-184269748
Sequence TCCTCAGCCCCCTGAGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 564435
Summary {0: 32, 1: 2936, 2: 105862, 3: 212183, 4: 243422}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966867762_966867768 9 Left 966867762 3:184269694-184269716 CCCTCAATTTTCCAGGCTAAAGT 0: 1
1: 0
2: 8
3: 45
4: 385
Right 966867768 3:184269726-184269748 TCCTCAGCCCCCTGAGTAGCTGG 0: 32
1: 2936
2: 105862
3: 212183
4: 243422
966867763_966867768 8 Left 966867763 3:184269695-184269717 CCTCAATTTTCCAGGCTAAAGTG 0: 1
1: 0
2: 50
3: 631
4: 3516
Right 966867768 3:184269726-184269748 TCCTCAGCCCCCTGAGTAGCTGG 0: 32
1: 2936
2: 105862
3: 212183
4: 243422
966867764_966867768 -2 Left 966867764 3:184269705-184269727 CCAGGCTAAAGTGATCCTCCCTC 0: 2
1: 136
2: 3899
3: 11272
4: 22973
Right 966867768 3:184269726-184269748 TCCTCAGCCCCCTGAGTAGCTGG 0: 32
1: 2936
2: 105862
3: 212183
4: 243422

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966867768 Original CRISPR TCCTCAGCCCCCTGAGTAGC TGG Intronic