ID: 966867770

View in Genome Browser
Species Human (GRCh38)
Location 3:184269727-184269749
Sequence CCTCAGCCCCCTGAGTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 702222
Summary {0: 1388, 1: 100786, 2: 206642, 3: 240744, 4: 152662}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966867764_966867770 -1 Left 966867764 3:184269705-184269727 CCAGGCTAAAGTGATCCTCCCTC 0: 2
1: 136
2: 3899
3: 11272
4: 22973
Right 966867770 3:184269727-184269749 CCTCAGCCCCCTGAGTAGCTGGG 0: 1388
1: 100786
2: 206642
3: 240744
4: 152662
966867763_966867770 9 Left 966867763 3:184269695-184269717 CCTCAATTTTCCAGGCTAAAGTG 0: 1
1: 0
2: 50
3: 631
4: 3516
Right 966867770 3:184269727-184269749 CCTCAGCCCCCTGAGTAGCTGGG 0: 1388
1: 100786
2: 206642
3: 240744
4: 152662
966867762_966867770 10 Left 966867762 3:184269694-184269716 CCCTCAATTTTCCAGGCTAAAGT 0: 1
1: 0
2: 8
3: 45
4: 385
Right 966867770 3:184269727-184269749 CCTCAGCCCCCTGAGTAGCTGGG 0: 1388
1: 100786
2: 206642
3: 240744
4: 152662

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966867770 Original CRISPR CCTCAGCCCCCTGAGTAGCT GGG Intronic