ID: 966867774

View in Genome Browser
Species Human (GRCh38)
Location 3:184269735-184269757
Sequence CCCTGAGTAGCTGGGACTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 645010
Summary {0: 826, 1: 44844, 2: 164903, 3: 224557, 4: 209880}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966867764_966867774 7 Left 966867764 3:184269705-184269727 CCAGGCTAAAGTGATCCTCCCTC 0: 2
1: 136
2: 3899
3: 11272
4: 22973
Right 966867774 3:184269735-184269757 CCCTGAGTAGCTGGGACTACAGG 0: 826
1: 44844
2: 164903
3: 224557
4: 209880
966867763_966867774 17 Left 966867763 3:184269695-184269717 CCTCAATTTTCCAGGCTAAAGTG 0: 1
1: 0
2: 50
3: 631
4: 3516
Right 966867774 3:184269735-184269757 CCCTGAGTAGCTGGGACTACAGG 0: 826
1: 44844
2: 164903
3: 224557
4: 209880
966867762_966867774 18 Left 966867762 3:184269694-184269716 CCCTCAATTTTCCAGGCTAAAGT 0: 1
1: 0
2: 8
3: 45
4: 385
Right 966867774 3:184269735-184269757 CCCTGAGTAGCTGGGACTACAGG 0: 826
1: 44844
2: 164903
3: 224557
4: 209880
966867765_966867774 -8 Left 966867765 3:184269720-184269742 CCTCCCTCCTCAGCCCCCTGAGT 0: 5
1: 475
2: 10644
3: 27400
4: 45543
Right 966867774 3:184269735-184269757 CCCTGAGTAGCTGGGACTACAGG 0: 826
1: 44844
2: 164903
3: 224557
4: 209880

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966867774 Original CRISPR CCCTGAGTAGCTGGGACTAC AGG Intronic