ID: 966867821

View in Genome Browser
Species Human (GRCh38)
Location 3:184270230-184270252
Sequence CTATTTCTCCAGCCCTGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 164}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966867819_966867821 -5 Left 966867819 3:184270212-184270234 CCAATCAAGAAGTAGCATCTATT 0: 2
1: 0
2: 14
3: 66
4: 350
Right 966867821 3:184270230-184270252 CTATTTCTCCAGCCCTGAATGGG 0: 1
1: 0
2: 1
3: 18
4: 164
966867817_966867821 1 Left 966867817 3:184270206-184270228 CCTCCTCCAATCAAGAAGTAGCA 0: 1
1: 0
2: 0
3: 13
4: 150
Right 966867821 3:184270230-184270252 CTATTTCTCCAGCCCTGAATGGG 0: 1
1: 0
2: 1
3: 18
4: 164
966867818_966867821 -2 Left 966867818 3:184270209-184270231 CCTCCAATCAAGAAGTAGCATCT 0: 1
1: 0
2: 0
3: 19
4: 157
Right 966867821 3:184270230-184270252 CTATTTCTCCAGCCCTGAATGGG 0: 1
1: 0
2: 1
3: 18
4: 164
966867816_966867821 16 Left 966867816 3:184270191-184270213 CCACATTATTTTGTACCTCCTCC 0: 1
1: 0
2: 2
3: 30
4: 257
Right 966867821 3:184270230-184270252 CTATTTCTCCAGCCCTGAATGGG 0: 1
1: 0
2: 1
3: 18
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966867821 Original CRISPR CTATTTCTCCAGCCCTGAAT GGG Intronic
900705197 1:4076151-4076173 CTGTTTCTCCATCTCTGAAATGG + Intergenic
902277928 1:15352763-15352785 CTTTCTCTCCAACCCTGACTTGG + Intronic
904988568 1:34572967-34572989 CTGTTTCTCCAGCCCAGAGCTGG - Intergenic
909490093 1:76216499-76216521 ATGTTTGTCCAGGCCTGAATAGG - Intronic
909784385 1:79592809-79592831 TTATTTCTCCAGCTCTATATTGG + Intergenic
912934802 1:113993725-113993747 CTATTTCTCAGGCCCTTACTGGG - Intergenic
913219580 1:116648705-116648727 CCAGATCTCCAGACCTGAATAGG - Intronic
915577139 1:156786916-156786938 CTTTTTCTCCCTCCCTGAAAAGG + Exonic
916031488 1:160881227-160881249 CTGTTTCTCCAGTGCTGCATGGG + Exonic
917648600 1:177053061-177053083 CTGTGTCTCCAGCACTGTATGGG - Intronic
919285917 1:195559627-195559649 CTTTGTGTCCAGCCCTGAATAGG - Intergenic
920031476 1:203039977-203039999 CTATTTCTCCCTCACTGCATTGG + Intronic
921563546 1:216687781-216687803 ATATTTCTGCAGCCCTTATTAGG + Intronic
923163041 1:231334420-231334442 CTATATCTCCTACCCTGAATGGG + Exonic
1070766275 10:79058210-79058232 CAATTTCTCCAGTTCAGAATGGG - Intergenic
1071196679 10:83168954-83168976 AGATTCCTCCATCCCTGAATAGG - Intergenic
1073541892 10:104321632-104321654 CCATTTCTCGAGCCCTCACTAGG + Intronic
1075623785 10:123947241-123947263 CTGCTTCTCCAGAACTGAATTGG + Intergenic
1078182065 11:9020178-9020200 CGATTTCACCAACCCTGAGTCGG - Intergenic
1079277970 11:19059321-19059343 CTATTTCCCCATCCCTAAAGCGG - Intronic
1079491015 11:20989330-20989352 CTGATTTTCCAGCCCAGAATTGG - Intronic
1080278503 11:30529920-30529942 CAGTTTCTCCAGCCCTAAAAGGG - Intronic
1081069855 11:38597243-38597265 CTTTTGCTCCATCCCTGACTTGG + Intergenic
1084393066 11:68891124-68891146 CTATTTATCCAGCCCTGGGAGGG + Intergenic
1085021969 11:73215711-73215733 CTGTCTCTCCAGCCCTGAGGAGG - Intergenic
1085130473 11:74033754-74033776 CTTTCTCTCCAGCCCAGAAAGGG - Exonic
1085404117 11:76251647-76251669 CTGTTTCTGCATCCATGAATTGG + Intergenic
1085775462 11:79362086-79362108 CTATTTCTTCATCTCTCAATTGG - Intronic
1089336020 11:117724570-117724592 TTATTTCACCAGCCTTGAAGCGG + Intronic
1089972642 11:122706444-122706466 CTATTTCTCCAGACCTTTATGGG - Intronic
1090105478 11:123850628-123850650 CTAGTTCTCCAGCAATAAATTGG - Intergenic
1091099329 11:132855635-132855657 CTATTCCTCCAGCCCTGGTCAGG + Intronic
1091452749 12:583694-583716 CTATTTCCACAGCCATGAAATGG + Intronic
1091771427 12:3154412-3154434 CTATTTCTCTTGCTTTGAATGGG - Intronic
1092125308 12:6071253-6071275 CTCTTCCTCCTTCCCTGAATCGG - Intronic
1093226369 12:16488789-16488811 CTATTTCTCCACCGCTTAAATGG + Intronic
1093522342 12:20065966-20065988 CTCTTTCTCCAGCTCTGCACTGG - Intergenic
1099541376 12:83912694-83912716 CTATTTCTCCAGCCAGTTATTGG + Intergenic
1101344799 12:103877057-103877079 CATTTTCTCCAGCAATGAATGGG - Intergenic
1101554295 12:105793628-105793650 CCTTGTCTCCAGCCCTGAAATGG - Intergenic
1102765807 12:115431946-115431968 CTAGTTTTCCAGCCAAGAATAGG - Intergenic
1103083210 12:118041687-118041709 CAATTCCTCCAGCCCTGGATGGG - Intronic
1107884972 13:44867637-44867659 TTTCTTCTCCAGCCCTGAAGAGG - Intergenic
1114563985 14:23614652-23614674 CTATTTGTCCTGCTCTGCATGGG + Intergenic
1115916594 14:38321661-38321683 CTACTTCTCCAGGCCTGTGTTGG + Intergenic
1118326329 14:64783893-64783915 CTATTCCTCCAGCCCTGTGCAGG + Intronic
1119592491 14:75903120-75903142 TTATTTCTTCAGCCATAAATGGG - Intronic
1119947172 14:78707029-78707051 CTATTTCCACAGCCCTGAAAAGG - Intronic
1124062223 15:26304916-26304938 CCATTTCTCCATACCTGAAGTGG - Intergenic
1125605110 15:40935705-40935727 CCATTTCTTCATCACTGAATGGG + Intronic
1125740619 15:41961166-41961188 CTATTTTTCCAGCTATGGATGGG + Intronic
1127766459 15:62190020-62190042 CTACTTCTCCACCCCTGGCTGGG + Intergenic
1128250449 15:66160165-66160187 CTACTTCTCCCTCCCAGAATAGG - Intronic
1128320461 15:66690252-66690274 CTGTTTCTCTTGCCCTGCATTGG + Intergenic
1128937248 15:71757336-71757358 CTATTTTTCCAACCCAGACTTGG + Intronic
1130548645 15:84874878-84874900 CTACTTTCCCATCCCTGAATAGG + Intergenic
1131106145 15:89736286-89736308 CTTTCTCTCCAGGCCTGAAGTGG - Intronic
1131132798 15:89910887-89910909 CTATTTACCCAGCCCTGAGAAGG + Intronic
1138663824 16:58545628-58545650 CTATTTTTCCCACCCTGAAAGGG + Intronic
1138912715 16:61421392-61421414 ATATTTCTCCTGCCCTCAAGTGG - Intergenic
1139281535 16:65774712-65774734 CAGTTTCTCCAGCTCTGAAATGG - Intergenic
1139317175 16:66082943-66082965 CAAGTTCTCCAACCCTCAATGGG - Intergenic
1140973411 16:80035746-80035768 CCATTTATTCAGCCCTGACTAGG + Intergenic
1141182876 16:81766307-81766329 CTGTGTCTCCAGCCCTGCAGAGG - Intronic
1142005938 16:87689637-87689659 CTGGTACTCCAGCCCTGTATGGG - Exonic
1142329206 16:89440141-89440163 CTACTTCTCCAGTCCTCAAGGGG + Intronic
1142351887 16:89584350-89584372 CTATTTCCCCATCCCTGAGCAGG - Intronic
1145000221 17:19299759-19299781 CTCTTTCACCAGCCCTGCATTGG + Intronic
1147253463 17:39167165-39167187 CTGCTTCCCCAGCCCTGACTTGG + Intronic
1151702674 17:75751819-75751841 TTATTTCTCCAGTCCTGGAAGGG + Intronic
1154084931 18:11294529-11294551 CTATTTTTCTAGCCATTAATAGG - Intergenic
1157128126 18:44977086-44977108 CTCCATCTCCAGCCCTGAAATGG + Intronic
1157135228 18:45047658-45047680 CCATTTCTGCAGCAATGAATGGG - Intronic
1157148916 18:45195112-45195134 CTCTTTCTCCAGATCTAAATAGG - Intergenic
1158635486 18:59152599-59152621 CTATTTCACCAGCTCTGATTGGG - Exonic
1158746152 18:60202084-60202106 CTAGTTCTACAGCCTTGAAAAGG - Intergenic
1159793657 18:72816122-72816144 CTATCTCTCCAGCCTGGAATTGG + Intronic
1160296759 18:77645514-77645536 CTATTTATCCAGCACTGGTTTGG - Intergenic
1161750645 19:6093748-6093770 CTATTAGTCCAGCCATGAAAAGG + Intronic
1162154229 19:8665836-8665858 CAATTTCTCCAGACATGCATTGG + Intergenic
1162531588 19:11239341-11239363 CTGTTTCTCCATCTATGAATAGG - Intronic
1163345208 19:16736910-16736932 CTCTTTCTGCAGAGCTGAATGGG + Intronic
1164182520 19:22832167-22832189 CTGTCACTCCAGGCCTGAATGGG + Intergenic
1166710981 19:44937119-44937141 CTGTTTCTTCATCCATGAATGGG - Intergenic
1168595078 19:57668876-57668898 CTGTTTCACCAGCCTGGAATTGG + Intergenic
925305587 2:2846221-2846243 TTCTTCCTCCAGCCCTGAACAGG + Intergenic
926405387 2:12547084-12547106 CCATTTTTATAGCCCTGAATCGG - Intergenic
926968291 2:18440393-18440415 TTATCTCTACAGCCCTGAAGAGG - Intergenic
929889074 2:45904800-45904822 CCTTTTCTCCAGCCCTGCATGGG + Intronic
930260612 2:49141635-49141657 CTATGTCGCCAACCCTGACTGGG + Intronic
931407577 2:61994841-61994863 TCATTTCTCCTGCCCTAAATTGG + Intronic
939112010 2:138019598-138019620 TTATTTCTCCAGGACTGATTGGG + Intergenic
941113686 2:161447037-161447059 CTATTTCTCCACCAATGATTTGG + Intronic
946028355 2:216686152-216686174 CTATTTCTCCCGGCCTAAAATGG - Intronic
946265431 2:218537204-218537226 CTATTTCTTCATCCCTTAATGGG + Intronic
1169335401 20:4751830-4751852 CTTTTTCTTCTGCCCTGGATTGG - Intergenic
1169807474 20:9574339-9574361 CTCTTCCTCCACCTCTGAATTGG + Intronic
1170032599 20:11958578-11958600 CTCTTTTTCCAGCTCTCAATTGG + Intergenic
1170130779 20:13017384-13017406 CTATCTCTCAAGCTCTGACTGGG - Intronic
1173410057 20:42802238-42802260 CTAATTCCCCAGCCCTGATAGGG + Intronic
1175176626 20:57116187-57116209 GAGTTTCTCCAGCCCTGAGTGGG - Intergenic
1178813217 21:35903724-35903746 CTATTCCTCCACCCCTCAACAGG - Intronic
1181047942 22:20224377-20224399 CTGTTGCTCCAGCCCTGGAAGGG - Intergenic
1181768699 22:25110754-25110776 CTAGTACTCCAGCCCTGTAAGGG + Intronic
1184866824 22:47205982-47206004 CTATTTTTCCATCCGTGAAATGG + Intergenic
949328159 3:2890560-2890582 CCATTTTGCCAACCCTGAATAGG - Intronic
949878217 3:8641048-8641070 CCATTTCCCCAGCCCTGGCTGGG + Intronic
953012446 3:39039903-39039925 CTATATCTCCATCACTGGATGGG - Intergenic
954582624 3:51711290-51711312 CTATTTCTGCAGCCCCGGGTTGG + Intronic
955759273 3:62260615-62260637 CTATTTATCAAGTTCTGAATAGG + Intronic
955853035 3:63241452-63241474 CTATTTCTCTTGCCATTAATTGG + Intronic
961954963 3:130792033-130792055 CAATTTCTCCATCTCTAAATTGG + Intergenic
962805205 3:138922204-138922226 CATTTTCTCAAGCCCTGGATAGG - Intergenic
963587443 3:147210481-147210503 CTATTTTTCAACCCCTAAATAGG + Intergenic
964269487 3:154939936-154939958 CTATTTCTCAGGCCCTTATTAGG - Intergenic
964473189 3:157075671-157075693 CTTTTTGTTCAGCCCTGTATAGG - Intergenic
966776248 3:183545066-183545088 CTCTTTCTCCACCCCTCACTTGG - Intronic
966867821 3:184270230-184270252 CTATTTCTCCAGCCCTGAATGGG + Intronic
968598730 4:1499101-1499123 CCATTTCTCCATCACTCAATTGG - Intergenic
970308910 4:14761210-14761232 CTATATCCCCAGCCCTGTCTAGG - Intergenic
970672858 4:18416219-18416241 CTATTTCCCCAACTTTGAATAGG + Intergenic
971070171 4:23081819-23081841 CTTTTTCTCCACCCCAGAAGTGG + Intergenic
971845748 4:31916154-31916176 CTATGTCTCCAGGCCTGTGTTGG - Intergenic
974476560 4:62389016-62389038 CTTTTTCTGAAGCACTGAATGGG + Intergenic
975829666 4:78356231-78356253 CTTTTTCTCCTGGCCTGAAGTGG + Intronic
976438097 4:85042391-85042413 CTATTTCTTCACCCCTGATAAGG - Intergenic
977398658 4:96503323-96503345 CTATTTATCCAGCCTTCATTAGG + Intergenic
978824263 4:113001878-113001900 TTATTTCTCCAGTCCTGACTAGG + Intronic
979746233 4:124216823-124216845 CTATTTTTCCAGCCCTTACCTGG - Intergenic
980171926 4:129299851-129299873 CCACTTCGCCAGCCCTGAACTGG + Intergenic
981215279 4:142158345-142158367 GTCTTTCTACAGCCCTGAATAGG + Intronic
981347972 4:143698389-143698411 CAATTTCTCCAGCCCGGACTTGG + Exonic
982579999 4:157164304-157164326 TTATTTCTCCAGGCCAGAAATGG + Intronic
983123206 4:163914967-163914989 CTATTTCTCCAGCCTTATTTTGG - Intronic
983989132 4:174097007-174097029 TTGTTTCTCAGGCCCTGAATGGG + Intergenic
986801762 5:11267595-11267617 CTATTTGCCCAGCCCTGAAATGG + Intronic
987863341 5:23511152-23511174 CTATTTTTCCCGCCCTGAGACGG - Intronic
988917412 5:35908762-35908784 GTATGTCTCCATCCCTGAAAGGG + Intronic
990867549 5:60396698-60396720 CAAAATCTCCAGCCTTGAATAGG - Intronic
993076059 5:83233253-83233275 TTATTTCTCCAGCTTTGACTTGG + Intronic
993802587 5:92361421-92361443 CTGTCTCTCCAGCCTTGACTAGG - Intergenic
998041336 5:138952716-138952738 CTATTTCTCTAGCCCAGAATGGG - Intronic
999999181 5:157120887-157120909 CTATTTCTCAGGCCCAGGATGGG - Intronic
1001746841 5:174098864-174098886 CTAGTTCTCCAGCGCTACATTGG - Intronic
1003732802 6:8844815-8844837 CCTTTTCTCCAGCACTGAGTGGG - Intergenic
1004143663 6:13045214-13045236 CAATTTCTCCAGCTCTAAAATGG + Intronic
1004967588 6:20872516-20872538 TTATTTCTCCAGACTAGAATGGG - Intronic
1005600144 6:27418317-27418339 ACATCTCTCCAGCCCTGGATAGG + Intergenic
1006099482 6:31677289-31677311 CTTTTCCTCCAGCCTTGCATGGG - Intronic
1006680758 6:35795494-35795516 CTATTTACCCAGCCATGAAATGG + Intronic
1007006869 6:38372376-38372398 CTATTTCTGCAGCTGTGAGTTGG + Intronic
1008255650 6:49296585-49296607 CTATTTCCCCAACTCTTAATAGG - Intergenic
1015451893 6:133379731-133379753 TTATATCCCCAGCCCTGAGTAGG - Intronic
1016441734 6:144091474-144091496 CTACTGCTACAGCCTTGAATTGG + Intergenic
1017937422 6:159018521-159018543 CTTTTTCTCCATCCCAGCATAGG - Intergenic
1018478574 6:164167758-164167780 ATACTTCTCCAGCACTGCATGGG + Intergenic
1029315160 7:99705275-99705297 CTACTTCCCCAGCACTGATTTGG + Exonic
1032741934 7:134748174-134748196 CTATTTCTCCATCTTGGAATGGG + Intronic
1033673992 7:143519761-143519783 CTAGGTCTCCAGCCTTGAAGAGG - Intergenic
1041352854 8:56966246-56966268 CTGTTTGACCATCCCTGAATGGG + Exonic
1041596070 8:59654519-59654541 CTAATCCTCCAGCCCAGAACTGG - Intergenic
1042571413 8:70169383-70169405 CTATAGCCCAAGCCCTGAATGGG - Intronic
1043743414 8:83843146-83843168 CACATTCTCTAGCCCTGAATGGG + Intergenic
1045870865 8:106925430-106925452 CTTTTTCTCCAGCCATTAATGGG - Intergenic
1047378221 8:124325657-124325679 CTATTTTTCCAGGCCTGAGATGG - Intronic
1049833601 8:144718457-144718479 CTTTTTCTCCAGCTCTAAAATGG - Intergenic
1052574989 9:30280627-30280649 TTTTCTCTCTAGCCCTGAATTGG - Intergenic
1053438140 9:38091146-38091168 CCATTTCTCCATCCCTAAAATGG - Intergenic
1057567447 9:96178235-96178257 CTTCTTCCCCAGCCCTGAATGGG + Intergenic
1058133854 9:101285408-101285430 ATATTTCTCCTACCCTGAACTGG - Intronic
1060385129 9:123218952-123218974 CTATTTCCTCATCCGTGAATTGG - Intronic
1061601497 9:131673332-131673354 CTTTTCATCCAGCCCTGATTTGG - Intronic
1186232241 X:7467860-7467882 CTGTTTCTTCATCTCTGAATTGG - Intergenic
1187123275 X:16429784-16429806 CTATTTCTCCACTCTTGAATCGG - Intergenic
1188637287 X:32450002-32450024 CAATTTCTTCACCCCTGAATGGG - Intronic
1188643440 X:32535154-32535176 CTATTTCGTCACCCCTGAAATGG - Intronic
1189158946 X:38790820-38790842 TTGTTTCTCCAGCCCTGCGTAGG - Intergenic
1191117669 X:56868199-56868221 CTATTTTTATTGCCCTGAATTGG - Intergenic
1193862929 X:86693508-86693530 CTTTTACTCCAGTCCTGAAGAGG - Intronic
1197893851 X:131290018-131290040 CTATTTCACAAGGCCTCAATGGG + Intronic
1198162299 X:134019679-134019701 CAATTTATGCAGCCTTGAATGGG + Intergenic
1199505611 X:148558193-148558215 GAATTTCTCCAGCCCTCACTTGG + Intronic
1200275279 X:154726443-154726465 CTAATTCACCAGGCCTGACTTGG + Intronic
1201666661 Y:16465086-16465108 CTATTTCTTTAGCTTTGAATAGG + Intergenic