ID: 966868509

View in Genome Browser
Species Human (GRCh38)
Location 3:184275894-184275916
Sequence CGGTGTTGCTGGAGGGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 242}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966868503_966868509 -1 Left 966868503 3:184275872-184275894 CCATGAAGCGTGGAGGGGTCTCC 0: 1
1: 0
2: 0
3: 5
4: 87
Right 966868509 3:184275894-184275916 CGGTGTTGCTGGAGGGCAGCTGG 0: 1
1: 0
2: 0
3: 17
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966868509 Original CRISPR CGGTGTTGCTGGAGGGCAGC TGG Intronic
900550619 1:3252609-3252631 GGGTGGGGCTGGTGGGCAGCAGG + Intronic
900555775 1:3279666-3279688 CTGTGCTGCAGGAGGGCAGAGGG + Intronic
900618069 1:3574217-3574239 AGGCGTTGCTGGGGGCCAGCTGG - Intronic
901057489 1:6455420-6455442 CGCTGTTGCTCGCCGGCAGCCGG - Intronic
902363754 1:15957439-15957461 CGGTGTATCTGGAGAGGAGCAGG + Intronic
902370748 1:16005419-16005441 CTGTGTTCCTGGAAGGCAGATGG + Intronic
902410534 1:16209017-16209039 AGGTGGGGCTGGAGGGTAGCAGG + Exonic
902646789 1:17805117-17805139 CCGTGTGGCTGGAAGGGAGCTGG - Intronic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903781223 1:25821031-25821053 CAGTGTGGCTGGAGGGCAAGGGG + Intronic
904441676 1:30535821-30535843 CTGTGTGGTTGGAGGGCAGGGGG + Intergenic
905853620 1:41292565-41292587 CATTGTTTCTGGAGGCCAGCAGG - Intergenic
907372636 1:54013324-54013346 CTGTGTTCCTGCAGGGCAGGGGG + Intronic
912796512 1:112696652-112696674 AGGTGATCCAGGAGGGCAGCTGG + Exonic
914676922 1:149912993-149913015 GGGGCTTGCGGGAGGGCAGCTGG - Intronic
919729079 1:200901494-200901516 CTGTGGGCCTGGAGGGCAGCGGG - Intronic
920433008 1:205930684-205930706 TGGTGTGGCTGGAGGGTAGAGGG - Intronic
921389656 1:214605758-214605780 CGCTGTGGGTGGAGGGCACCAGG - Intronic
1062791211 10:307781-307803 CGGTCCATCTGGAGGGCAGCAGG + Intronic
1062791252 10:307897-307919 CGGTCCCTCTGGAGGGCAGCAGG + Intronic
1062791274 10:307955-307977 CGGTCCATCTGGAGGGCAGCAGG + Intronic
1062791314 10:308071-308093 CGGTCCATCTGGAGGGCAGCAGG + Intronic
1062860792 10:807650-807672 TGGTGGAGCTGGAGGGCCGCAGG - Exonic
1063643895 10:7859381-7859403 CTGAGTTTCAGGAGGGCAGCGGG + Intronic
1067297086 10:44980745-44980767 GGGTGGGGCTGGAGGGCAGTGGG + Intronic
1067786621 10:49254982-49255004 CGGTGCAGGTGGAGGGCAGTGGG - Intergenic
1068408407 10:56624077-56624099 AGGTGCTCCTGGATGGCAGCAGG + Intergenic
1069798683 10:71069201-71069223 CAGCCTTTCTGGAGGGCAGCAGG - Intergenic
1074851132 10:117440494-117440516 GGGTGTGGCTGGAGGGCTGGAGG + Intergenic
1075278054 10:121113034-121113056 AGCTGAGGCTGGAGGGCAGCAGG + Intergenic
1076701884 10:132277506-132277528 CCGCCTTGCTGGATGGCAGCTGG + Intronic
1076910417 10:133385342-133385364 CTGGGTTGCTGGTGGGCAGCCGG + Intronic
1077037696 11:503250-503272 CCGTCTTTCTGAAGGGCAGCTGG - Exonic
1077219046 11:1407327-1407349 CGGTGTTGCCAGAGGGCATAGGG - Intronic
1077247138 11:1545126-1545148 AGGCATTGCTGGAGGGCAGGAGG + Intergenic
1077438689 11:2558173-2558195 AGTTGGTGCTGGGGGGCAGCTGG - Intronic
1078102968 11:8340662-8340684 GGCTGGTGCTGGAAGGCAGCAGG - Intergenic
1078498272 11:11842062-11842084 CGCTATTGCTGGAGCGCAGGCGG + Exonic
1080015896 11:27506643-27506665 CTGTGTCGCTGGAGGGGAGGAGG - Intronic
1080411872 11:32032732-32032754 CGCTGCTGCTGGAGAGCAGAAGG - Intronic
1083225336 11:61281190-61281212 CGGGGTTGCAGGATGGCAGATGG + Exonic
1083325444 11:61870764-61870786 GGGAGTAGCTGGAGGGGAGCAGG - Intergenic
1083681343 11:64353239-64353261 AGGTGTGGCTGGAGGGCCGGTGG + Exonic
1083736776 11:64686009-64686031 CTGCGTTGCTGGAGGGGAGAGGG - Intronic
1084289850 11:68155615-68155637 TGGAGGTGCTGGAGGGCAGCGGG - Exonic
1084677604 11:70645307-70645329 CGGTGTTGCTGGTCGGAGGCAGG + Intronic
1085048657 11:73368118-73368140 AGGGTTTTCTGGAGGGCAGCAGG + Exonic
1085052985 11:73389229-73389251 CCCTCTTGCTGGAGGGCTGCAGG - Intronic
1086009522 11:82083307-82083329 CTTTGTTGGTGTAGGGCAGCTGG + Intergenic
1086700537 11:89896638-89896660 CGGAGTTCCTGTGGGGCAGCCGG + Intergenic
1086705632 11:89947888-89947910 CGGAGTTCCTGTGGGGCAGCCGG - Intergenic
1095953598 12:47794764-47794786 GGGTGCTGCTGGAGAGGAGCGGG + Exonic
1100349377 12:93764315-93764337 CAGAGTTGCTGGAGGGAAGGGGG + Intronic
1101376001 12:104172209-104172231 CAGTGCTCCTGGAGGGGAGCAGG + Intergenic
1103446999 12:121001123-121001145 CGCTGTGGTTGGATGGCAGCAGG - Exonic
1104818368 12:131661430-131661452 CTGTTTCCCTGGAGGGCAGCTGG + Intergenic
1104910474 12:132237925-132237947 CCCTGAAGCTGGAGGGCAGCAGG - Intronic
1105617238 13:22029961-22029983 CTGTGTTGCTGCGGGCCAGCTGG + Intergenic
1105895327 13:24712339-24712361 CGTTATTGCTGGAGAGCACCTGG - Intronic
1106088333 13:26562741-26562763 GGGTGTTGAGGGAGGGAAGCTGG + Intronic
1108275721 13:48807596-48807618 TGGTGTGGCTGGAGAGAAGCGGG - Intergenic
1113378573 13:109784598-109784620 CGCTGCCGCTGGAGGGCCGCTGG + Exonic
1113657245 13:112074687-112074709 CGTTGTTTGTGGAGAGCAGCAGG + Intergenic
1113709117 13:112452530-112452552 TGGTGTTTCTGGGGGGCTGCTGG - Intergenic
1115271863 14:31561550-31561572 CCGTGGTGCTGCAGGGCAGGGGG + Intronic
1117347330 14:54846076-54846098 CAGTGATGCTGGAGGGCTTCAGG - Intronic
1117838266 14:59830120-59830142 GGGTGCTGCTGGTGGGCAGAGGG - Intronic
1118688169 14:68312482-68312504 TGTTGTTGCCTGAGGGCAGCTGG + Intronic
1119399005 14:74349273-74349295 CGGTGGCCCTGGAGGCCAGCTGG - Intronic
1119740006 14:77008103-77008125 AGGTGTGGGTGAAGGGCAGCAGG + Intergenic
1121081911 14:91115124-91115146 CAGTGCTGGAGGAGGGCAGCAGG + Intronic
1121489469 14:94347649-94347671 CATTGCAGCTGGAGGGCAGCTGG + Intergenic
1122082223 14:99273941-99273963 GGGTGTTGGGGGTGGGCAGCCGG - Intergenic
1122609208 14:102969707-102969729 TGGTGGGGCTGGAGGGTAGCAGG - Intronic
1122692440 14:103537685-103537707 CTGGGTGGGTGGAGGGCAGCAGG + Intergenic
1122834542 14:104424373-104424395 CAGAGATGCTGGCGGGCAGCGGG + Intergenic
1123105866 14:105840801-105840823 CGGTGCTGCTGGGGCCCAGCTGG + Intergenic
1202839652 14_GL000009v2_random:110133-110155 CGGTGTTGCTGGAGGGTCAGTGG - Intergenic
1202909026 14_GL000194v1_random:100273-100295 CGGTGTTGCTGGAGGGTCAGTGG - Intergenic
1124662771 15:31563625-31563647 AGGTGGTGCTGGAGCACAGCTGG + Intronic
1124696803 15:31870466-31870488 CGGTGCTGCCGGCGGGCGGCGGG - Intronic
1128510756 15:68312752-68312774 GGGTGAGGCTGGAGGGGAGCCGG - Exonic
1129009576 15:72403037-72403059 TGGTGTTGCTGGAGACAAGCTGG - Intronic
1129726522 15:77904319-77904341 TCCTCTTGCTGGAGGGCAGCTGG + Intergenic
1131167689 15:90154351-90154373 CAGTGTAGCTTGAGGGCAGATGG - Intergenic
1132311648 15:100861955-100861977 ATGGGTTGCTGGGGGGCAGCTGG + Intergenic
1132550531 16:552191-552213 CGCTCTTCCAGGAGGGCAGCAGG + Exonic
1132845769 16:2000163-2000185 CGGGGTTGCTGCAGTGGAGCAGG + Exonic
1132943095 16:2518181-2518203 TGGTGGCCCTGGAGGGCAGCTGG + Intronic
1134560460 16:15204776-15204798 TGGTGTCCCTGGAGAGCAGCTGG - Intergenic
1134920999 16:18116390-18116412 TGGTGTCCCTGGAGAGCAGCTGG - Intergenic
1137584674 16:49657330-49657352 TGGAGCTGCTGGAGGGCACCTGG - Intronic
1138304564 16:55962622-55962644 GGGTGTGGCTGGAGAGGAGCAGG - Intergenic
1138340267 16:56284624-56284646 GTGTGCTGCTGGGGGGCAGCTGG - Intronic
1139800529 16:69519050-69519072 CGTTGTTCCTTGAGTGCAGCAGG + Intergenic
1140537814 16:75727024-75727046 AGGTTTTTCTGGAGGGAAGCGGG + Intronic
1141615615 16:85207903-85207925 CGATGTTGCTGGGGGGTAGCTGG + Intergenic
1142178850 16:88657517-88657539 AGCTGAGGCTGGAGGGCAGCGGG + Exonic
1142361506 16:89629777-89629799 CTGTGACGCTGGAGGGCTGCAGG + Intronic
1142368440 16:89663685-89663707 GGGTGTGTCTGAAGGGCAGCAGG + Intronic
1143861894 17:9897268-9897290 CGGGGTGGCTGGAGGGTAGAAGG - Exonic
1144685440 17:17223059-17223081 CTGTGCTTCTGGAGGGCAGAAGG + Intronic
1144761711 17:17710936-17710958 GGGTGTTGATGGGGGGCAGGTGG + Intronic
1145813807 17:27781324-27781346 GGGTCTTGAGGGAGGGCAGCAGG - Intronic
1146367796 17:32242813-32242835 CTGTGTTACTGGAGAGCAACAGG + Intronic
1146931145 17:36778805-36778827 CTGTGCTGGAGGAGGGCAGCTGG - Intergenic
1147448126 17:40487429-40487451 TGGAGTTGCTGGAGTGCAGGAGG + Exonic
1150130468 17:62666299-62666321 CAGTGTTCCTGGAGGGAGGCTGG + Intronic
1150976343 17:70091401-70091423 CTGTGTTGGAGGAGGGTAGCTGG - Intronic
1151516546 17:74599844-74599866 ACAAGTTGCTGGAGGGCAGCTGG + Intergenic
1152177976 17:78800360-78800382 CGGTGTTGCTGATGGGGACCAGG - Intronic
1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG + Intergenic
1152210457 17:79000489-79000511 GGATGTTGGTGGGGGGCAGCTGG - Intronic
1152669476 17:81593821-81593843 CAGGGTAGCTGGAGAGCAGCTGG - Intronic
1152713234 17:81885445-81885467 CGGGGCTTCTGGTGGGCAGCAGG - Intergenic
1152739099 17:82011301-82011323 GGGTGGGGCTGGGGGGCAGCGGG + Intronic
1152811329 17:82384143-82384165 GGGTGTGGGTGGAGGGTAGCAGG - Intergenic
1155381845 18:25231320-25231342 CTGTGTTGGAGGAGGACAGCTGG + Intronic
1157709935 18:49843261-49843283 CGTTGATGGTGGAGGTCAGCAGG + Exonic
1159340221 18:67124958-67124980 CAGTGTTCCTGGAGCTCAGCCGG - Intergenic
1161037843 19:2095542-2095564 GGGTCCTGCGGGAGGGCAGCGGG + Intronic
1161169121 19:2804276-2804298 GGGTGTGGCTGCCGGGCAGCGGG + Intronic
1162971159 19:14182354-14182376 GCGGGGTGCTGGAGGGCAGCAGG + Intronic
1163003090 19:14381343-14381365 CGGTGCAGCTGGAAGCCAGCAGG - Intronic
1163063605 19:14776920-14776942 CGGTGCAGCTGGAAGCCAGCAGG + Exonic
1163155911 19:15439882-15439904 CGGTGCTGCTCCAGGGCAGTGGG + Intronic
1165702459 19:37948954-37948976 CACTGTGGCAGGAGGGCAGCGGG + Intronic
1165890103 19:39106845-39106867 CTGTCTTCCTTGAGGGCAGCAGG + Intronic
1166303472 19:41924828-41924850 CGGTGTTTCTGGAGAGAAGCAGG + Intronic
1166571085 19:43797773-43797795 CGGTGGTGCAGGAGGGCCGGTGG + Exonic
1166862359 19:45817762-45817784 AGGTGATGAGGGAGGGCAGCTGG - Intronic
925533250 2:4887438-4887460 GGGTGTGGCTGGAGGGGAGGAGG + Intergenic
925907421 2:8547726-8547748 GGGTGTTGGAGGAGGGCACCAGG - Intergenic
926136881 2:10342770-10342792 CGTAGCTACTGGAGGGCAGCTGG - Intronic
926287181 2:11498651-11498673 CAGTTTTGCTGCTGGGCAGCTGG + Intergenic
926324377 2:11771658-11771680 TGGAGCTGCTGGAGAGCAGCAGG + Exonic
926588643 2:14716632-14716654 CCATGGTCCTGGAGGGCAGCAGG + Intergenic
931791002 2:65664188-65664210 AGCTGTTCCTGGAGGTCAGCTGG + Intergenic
932492688 2:72132009-72132031 GGGAGTGGCTGGAGGGAAGCTGG + Exonic
933707456 2:85302638-85302660 CAGTGCTGCTGCAGGGCAGGCGG + Intronic
933810192 2:86028251-86028273 CTGTGCTGCTGGAAGGAAGCGGG - Intronic
934852118 2:97707966-97707988 TGGGGTGGCTGTAGGGCAGCAGG + Intergenic
935989226 2:108704551-108704573 TGGTGTTCCTGCAGGGCAGAGGG - Intergenic
938293413 2:130162243-130162265 CCGTGGTGCTGCAGGGCAGCAGG - Intronic
940906284 2:159172877-159172899 CGGTGGAGCTGGAGAGCTGCTGG + Intronic
942190581 2:173465132-173465154 CTGTGCTGCTTGCGGGCAGCTGG + Intergenic
943715225 2:191144250-191144272 AGTTGTTGCTGGAGGGCTGGAGG + Intronic
944923067 2:204435632-204435654 TCCTGATGCTGGAGGGCAGCAGG - Intergenic
947532908 2:230924088-230924110 TGGGGTTGCTGGAGGACAGCAGG - Intronic
947819133 2:233058687-233058709 GGATGTTGGTGGAGGCCAGCAGG + Intergenic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
948554261 2:238796409-238796431 CTGTGTGGCAGGAGGACAGCTGG + Intergenic
948862695 2:240760644-240760666 AGGTGGGGCTGGAGGGCCGCTGG - Exonic
948899800 2:240950515-240950537 TGGTGAGGCTGGGGGGCAGCGGG + Intronic
1169080671 20:2796273-2796295 CAGGGTTCATGGAGGGCAGCAGG + Exonic
1169303795 20:4470752-4470774 CAGTATTGCTGGAGGCCGGCAGG - Intergenic
1171458024 20:25282832-25282854 AGGTGCTGGTGGAGGGCAGCGGG + Intronic
1172792735 20:37517344-37517366 CGGAGTTGGTGGGGGGCAGGGGG - Intronic
1174183382 20:48688918-48688940 TGGTGGTGGTGGAGGGCAGGTGG - Intronic
1175278680 20:57788368-57788390 CAGCGTGGCTGGAGGGCAGCAGG - Intergenic
1175444512 20:59010752-59010774 CAGTGGTGCTTGAGGGCAGAGGG + Intergenic
1175918430 20:62438441-62438463 CAGTGGTGCAGGAGGGCTGCCGG + Intergenic
1176362570 21:6010212-6010234 GTGTGATGCTGGAGGGCTGCTGG + Intergenic
1179760948 21:43528333-43528355 GTGTGATGCTGGAGGGCTGCTGG - Intergenic
1179890312 21:44331822-44331844 ACGTGAGGCTGGAGGGCAGCGGG - Exonic
1180385177 22:12172715-12172737 TGGCGTGGCTGGAGGGTAGCTGG + Intergenic
1183731147 22:39619262-39619284 GGATGGTGCTGGAGGCCAGCTGG - Intronic
1184115145 22:42417804-42417826 GGGTGGAGCAGGAGGGCAGCAGG + Intronic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1184422832 22:44391754-44391776 AGGAGTTGCTGGAGTGCAGCAGG - Intergenic
1184731652 22:46373994-46374016 CGTTGTTTCTGGAGGGTGGCTGG - Intronic
1185015345 22:48339538-48339560 CTGGGTTGCTGGAGTGCAGGCGG - Intergenic
1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG + Intronic
950212819 3:11136456-11136478 AGGTGTTGCTGCAGGGAACCAGG - Intergenic
953405681 3:42658741-42658763 CGGCGCAGCTGGAGTGCAGCTGG - Exonic
954293291 3:49660987-49661009 CGGGGCTGCTGGAAGGCAGTGGG - Exonic
954422471 3:50425952-50425974 GGGGGTTGCTGGGGAGCAGCTGG - Intronic
954684820 3:52364773-52364795 CTGGGCAGCTGGAGGGCAGCTGG + Intronic
955961579 3:64346317-64346339 CGGTGTGGCTGGAGCACAGTGGG + Intronic
959733782 3:109634013-109634035 CGATGTTGCAGGAGGGTAACTGG - Intergenic
961201859 3:125051874-125051896 CGGGGCTGCTGGAAGGCAGGAGG + Intronic
961517282 3:127445817-127445839 CGGTGTTCCAGGAGGACTGCAGG + Intergenic
962923007 3:139967432-139967454 GGGTGTTGCTGAGGTGCAGCTGG - Intronic
963051134 3:141144965-141144987 GGGTGTTGCTGGAGGAGAGATGG + Intronic
966813076 3:183865648-183865670 CGGGGTTGCAGGGGGGCAGATGG - Intronic
966855766 3:184193032-184193054 AGGTGTGGCTGGAGGGCACAGGG + Intronic
966868509 3:184275894-184275916 CGGTGTTGCTGGAGGGCAGCTGG + Intronic
966879142 3:184339930-184339952 CAGTTTTCCTGGAGTGCAGCTGG - Intronic
968917502 4:3503003-3503025 TGGTGTGGCTCGAGGGCAGTGGG - Intergenic
969421186 4:7097102-7097124 CGGGGCTGGGGGAGGGCAGCTGG + Intergenic
969674186 4:8606137-8606159 CAGGGTTCATGGAGGGCAGCAGG - Exonic
973892530 4:55381741-55381763 TGGTGATGGTGGCGGGCAGCAGG + Intergenic
974761773 4:66285545-66285567 CAGTGCTGATGGAGGGCAGGAGG + Intergenic
976035877 4:80820514-80820536 CAGTGTTGCTGGAGCGTAGTGGG + Intronic
983391370 4:167134400-167134422 CGTTGTTACTGGAGGGCAAATGG + Intronic
986297127 5:6448846-6448868 CAGTGTTGCTGGCGCGCCGCGGG - Exonic
986545376 5:8891413-8891435 CAGTGTTCCTGGATGGCAGAAGG - Intergenic
988509721 5:31854979-31855001 CCGCGTTCCAGGAGGGCAGCTGG + Intronic
988548192 5:32176689-32176711 GGGTGGGGGTGGAGGGCAGCTGG + Intergenic
995246899 5:109945095-109945117 CGGTGTTGCTGGAAGGCTGAGGG + Intergenic
998165198 5:139838739-139838761 GGGTGGTGCAGGAGGGCAGCAGG - Exonic
998402615 5:141855844-141855866 CGGTGTAGTTGCTGGGCAGCGGG + Intronic
999208772 5:149869679-149869701 CTGTGCTGCAGGAAGGCAGCTGG + Intronic
1000103444 5:158037241-158037263 CGGGGTGGCTGCCGGGCAGCGGG + Intergenic
1002323118 5:178387455-178387477 CTGAGCTGCAGGAGGGCAGCAGG - Intronic
1002355452 5:178625681-178625703 CTGTTTTGCTGGAGGTTAGCTGG - Intronic
1002817365 6:693218-693240 CGCGGGTGCTGGAGGTCAGCAGG + Intergenic
1002967135 6:1978037-1978059 CTCTGTTGCTGGTGGCCAGCTGG - Intronic
1007412656 6:41673917-41673939 CTGTGTTGCTGGGGGGCAGATGG - Intergenic
1008876381 6:56334201-56334223 CCATGTTTCTGGAGGGCAGATGG - Intronic
1012263114 6:97111083-97111105 CAGTGTTGCTGGAAGGCCCCTGG - Intronic
1013047041 6:106497023-106497045 CAGTGTTCCTGGCAGGCAGCGGG - Intergenic
1013473349 6:110485730-110485752 CAGTGTGGCTGGAGTGGAGCAGG - Intergenic
1013658497 6:112270384-112270406 CAGTGTGTCTGGTGGGCAGCTGG + Intergenic
1019079990 6:169423988-169424010 CATTGTTGCTGCAGAGCAGCTGG + Intergenic
1019643358 7:2116244-2116266 GGGTGCAGCTGGAGGGCAGGCGG + Intronic
1019763799 7:2834360-2834382 AGGTGTTGCAGGAGGCCAGTGGG - Intronic
1020141166 7:5612743-5612765 CGGAGCTGGTGGGGGGCAGCAGG - Intergenic
1022272010 7:28817720-28817742 CGAGGTTGCTGGAGCTCAGCTGG + Intronic
1023170342 7:37385340-37385362 CAGTGTGGCTGGAGGGGAGGGGG - Intronic
1025801322 7:64789218-64789240 AGGTGTGGGAGGAGGGCAGCAGG - Intergenic
1026944227 7:74306041-74306063 TGGTGGGGCTGGAAGGCAGCAGG - Intronic
1027350874 7:77309535-77309557 TGGTGTTTCTGGAGGGAAGGGGG + Intronic
1030148312 7:106378460-106378482 CGGTGCTGCAGGAGGGCAATGGG - Intergenic
1032446334 7:131986938-131986960 TGGTGTGGCTGGAGTACAGCGGG + Intergenic
1033352577 7:140573678-140573700 CTGTGTTGCTGCAGGCCAGGGGG - Intronic
1033629135 7:143140008-143140030 AGCTGTTGCTGGAGGGCAGTGGG - Intergenic
1033773702 7:144582664-144582686 AGGTGCAGCTGGAGGGAAGCAGG - Intronic
1034069691 7:148172240-148172262 AGGTGGTGCTGGGGGCCAGCAGG + Exonic
1034981510 7:155481214-155481236 CGGTTTTGCTGCAGGGGTGCAGG - Intronic
1037113673 8:15196887-15196909 GGTTGTTGCTGGTTGGCAGCTGG + Intronic
1039845316 8:41321612-41321634 CGGTGGGGCTGGAGAGCAGAGGG + Intergenic
1040046286 8:42967258-42967280 AGGTGTGTGTGGAGGGCAGCCGG - Intronic
1040300863 8:46187346-46187368 GGGTGGTGTTGGAGGGCTGCAGG - Intergenic
1040551206 8:48438991-48439013 CGCTGGTGCTGGAGGGGAGATGG + Intergenic
1043171499 8:76972344-76972366 CGGTGTGGGTGGGGGGCAGCAGG + Intergenic
1043212475 8:77540358-77540380 CGGTGTGGCAGGAGGGCTGGAGG + Intergenic
1044937816 8:97309886-97309908 AGGAGATGCTGGAGGACAGCTGG - Intergenic
1048510179 8:135055004-135055026 CGGTGGGGCTGGGGGGAAGCTGG - Intergenic
1049651525 8:143771952-143771974 CGGTGCTGAAGGAGGTCAGCGGG + Intergenic
1051612678 9:18976854-18976876 TGGTGTAGCTGGAGGACGGCAGG - Intronic
1056133231 9:83605832-83605854 CGGGGTTTCTGGAAAGCAGCTGG - Intergenic
1057304571 9:93904749-93904771 CGGGGATGCAGGAGGACAGCAGG + Intergenic
1058010097 9:99967604-99967626 CGGTCCTGCTGGGGAGCAGCAGG - Intronic
1060283439 9:122228690-122228712 CGGCGTTGCCCGAGGGCTGCCGG - Exonic
1061054638 9:128215841-128215863 TGGTGTTGCTGGTGAGGAGCTGG + Intronic
1061886345 9:133592832-133592854 CGATGCTGCTGGAGAGCAACAGG + Intergenic
1062031791 9:134365146-134365168 GGCTGTTGCTGGAGGGCTGATGG + Intronic
1062304352 9:135894535-135894557 TGATGTTGCTCGAGGGCAGCAGG - Intronic
1062623512 9:137433136-137433158 CCCTGTGGGTGGAGGGCAGCCGG - Intronic
1203482755 Un_GL000224v1:21681-21703 CGGTGTTGCTGGAGGGTCAGTGG + Intergenic
1185473704 X:400480-400502 CGCTATTTTTGGAGGGCAGCTGG + Intergenic
1186977381 X:14922810-14922832 GGGTGTTGCAGAGGGGCAGCAGG + Intergenic
1190342480 X:49308582-49308604 CAGAGTGGCTGGGGGGCAGCAGG + Intronic
1199814868 X:151388334-151388356 CCTTGTTCCTGGAGGGCAGGGGG + Intergenic
1200051263 X:153433096-153433118 CTGTGTGGCTGGAGGCCAGTGGG + Intergenic
1200067632 X:153511656-153511678 CGGAGCTGCTGGAAGGCAGCAGG + Intergenic
1201164884 Y:11200276-11200298 CGGTGTTGCTGGAGGGTCAGTGG - Intergenic
1201383535 Y:13413330-13413352 CGGTGTGGATAGAGGGCAGGAGG - Intronic
1201898146 Y:19016027-19016049 CTGTGTTGCTGAGGGCCAGCTGG - Intergenic