ID: 966871210

View in Genome Browser
Species Human (GRCh38)
Location 3:184291522-184291544
Sequence GTGTCAAACGGGCTGGTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 77}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966871198_966871210 27 Left 966871198 3:184291472-184291494 CCTTTGTCCTGCTCCCTCCTGAG 0: 1
1: 0
2: 3
3: 55
4: 469
Right 966871210 3:184291522-184291544 GTGTCAAACGGGCTGGTGAATGG 0: 1
1: 0
2: 0
3: 6
4: 77
966871199_966871210 20 Left 966871199 3:184291479-184291501 CCTGCTCCCTCCTGAGTATGTCA 0: 1
1: 0
2: 0
3: 19
4: 173
Right 966871210 3:184291522-184291544 GTGTCAAACGGGCTGGTGAATGG 0: 1
1: 0
2: 0
3: 6
4: 77
966871197_966871210 28 Left 966871197 3:184291471-184291493 CCCTTTGTCCTGCTCCCTCCTGA 0: 1
1: 1
2: 3
3: 44
4: 556
Right 966871210 3:184291522-184291544 GTGTCAAACGGGCTGGTGAATGG 0: 1
1: 0
2: 0
3: 6
4: 77
966871196_966871210 29 Left 966871196 3:184291470-184291492 CCCCTTTGTCCTGCTCCCTCCTG 0: 1
1: 1
2: 6
3: 81
4: 761
Right 966871210 3:184291522-184291544 GTGTCAAACGGGCTGGTGAATGG 0: 1
1: 0
2: 0
3: 6
4: 77
966871203_966871210 10 Left 966871203 3:184291489-184291511 CCTGAGTATGTCATTAGGAGAAC 0: 1
1: 0
2: 0
3: 4
4: 80
Right 966871210 3:184291522-184291544 GTGTCAAACGGGCTGGTGAATGG 0: 1
1: 0
2: 0
3: 6
4: 77
966871201_966871210 14 Left 966871201 3:184291485-184291507 CCCTCCTGAGTATGTCATTAGGA 0: 1
1: 0
2: 0
3: 9
4: 117
Right 966871210 3:184291522-184291544 GTGTCAAACGGGCTGGTGAATGG 0: 1
1: 0
2: 0
3: 6
4: 77
966871202_966871210 13 Left 966871202 3:184291486-184291508 CCTCCTGAGTATGTCATTAGGAG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 966871210 3:184291522-184291544 GTGTCAAACGGGCTGGTGAATGG 0: 1
1: 0
2: 0
3: 6
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966871210 Original CRISPR GTGTCAAACGGGCTGGTGAA TGG Intronic
901183746 1:7358983-7359005 GTGCCACATGGGCTGCTGAAGGG - Intronic
901444069 1:9296366-9296388 GTGACAAACTTACTGGTGAAGGG - Intronic
902080935 1:13820350-13820372 GTGCCACAGAGGCTGGTGAAAGG - Intronic
903868779 1:26417313-26417335 GTGTCAAGGAGGTTGGTGAAAGG - Intronic
912658971 1:111512044-111512066 GTGACAAACGAGCCAGTGAAGGG - Intronic
913666194 1:121051219-121051241 GTGCCCAACGGGGTGGAGAAGGG + Intergenic
914017884 1:143838333-143838355 GTGCCCAACGGGGTGGAGAAGGG + Intergenic
914656493 1:149746864-149746886 GTGCCCAACGGGGTGGAGAAGGG + Intergenic
914838537 1:151228561-151228583 GTGGAAATTGGGCTGGTGAAGGG + Intronic
922717656 1:227885672-227885694 GGGTCACAAGGGGTGGTGAAGGG - Intergenic
1070799222 10:79235276-79235298 CTCTCACACGGGGTGGTGAAAGG + Intronic
1072904690 10:99442081-99442103 GTGTCAAAAGAGCAGGTGATGGG + Intergenic
1075547253 10:123364267-123364289 GTGTGACAAGGGCTGGTGTAGGG + Intergenic
1081776330 11:45678276-45678298 GTGTCAAAACGGCAGGTGGAGGG - Intergenic
1084771830 11:71348304-71348326 GTGTCAAAAGCTATGGTGAAAGG + Intergenic
1086094661 11:83038308-83038330 GTGTCAAACAAGATGCTGAAAGG + Intronic
1089220999 11:116871570-116871592 GTGTGAAAAGGGCTGGTGGCAGG + Intronic
1097726733 12:63083742-63083764 CTGTCAAATGGGCTAGGGAAAGG + Intergenic
1097829973 12:64214045-64214067 GTGTGCAATGGGATGGTGAAGGG - Intronic
1101495951 12:105254251-105254273 GGGTCAGAGGGGCTGGAGAATGG - Intronic
1103994558 12:124820655-124820677 GTGTCCCCCAGGCTGGTGAAGGG - Intronic
1109299605 13:60577274-60577296 TGGTCAAAGAGGCTGGTGAAAGG + Intergenic
1114715252 14:24817670-24817692 GTGTCACAGAGGCTGGAGAAAGG + Intronic
1115513781 14:34164719-34164741 GTGTGAAACTGGGTGGGGAAAGG + Intronic
1115745203 14:36429452-36429474 GTGTCAAACAGGAAAGTGAATGG + Intergenic
1120952175 14:90051406-90051428 GTGAAAAATGGGCTGGTGACTGG + Intergenic
1121991438 14:98561754-98561776 TTGTCCAACAGGGTGGTGAATGG - Intergenic
1127567291 15:60203974-60203996 GTGGCAAACGGAGGGGTGAAGGG + Intergenic
1127907711 15:63388857-63388879 GAGTCACACAGGGTGGTGAATGG - Intergenic
1131048095 15:89328875-89328897 GGGCCAGACGGGCTGGTGAGAGG + Intronic
1137693823 16:50448073-50448095 ATATCAAACGGGCAGGTGACTGG + Intergenic
1138950326 16:61905103-61905125 GTGCCAAAAAGGCTGGGGAAGGG + Intronic
1144946711 17:18973106-18973128 GTGGGCAAGGGGCTGGTGAAAGG + Intronic
1146902994 17:36600380-36600402 GTGAAAAATGGGCTGGGGAAAGG + Exonic
1154236771 18:12613334-12613356 ATGTCAAAGGGTCTGGTAAAAGG - Intronic
1163778520 19:19232469-19232491 ATGGCAAACGGGCTTGTGGATGG - Intronic
1164685503 19:30164004-30164026 ATGTGAATGGGGCTGGTGAAGGG - Intergenic
1168093095 19:54098645-54098667 GTGTCACCCGGGCTGGAGTACGG - Intronic
925497611 2:4469660-4469682 GTGACAAACCAGCTGTTGAATGG - Intergenic
930991825 2:57665350-57665372 GTGTCATACAGGCAGGTGCATGG + Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
938573924 2:132586347-132586369 TTGTAAAACGGTCTGGTGACAGG + Intronic
948325957 2:237121129-237121151 GTGTCAAACGTTCAGATGAAAGG + Intergenic
1171385057 20:24764327-24764349 GTGTCAAACAGGCAAGGGAAGGG - Intergenic
1173188623 20:40859812-40859834 GTGTCAAACAGGATGGTGATGGG + Intergenic
1174218177 20:48933048-48933070 GTGTCAGAGGTGCTGGTGAATGG + Intronic
1184598518 22:45528712-45528734 GTGTCAATTGGGCTGGGGTATGG - Intronic
950029704 3:9844071-9844093 GTGTCAATCGGAATGGTGACCGG + Intronic
952774464 3:37031451-37031473 TTTTCAAACGTGCTGGTGTAGGG + Intronic
953394929 3:42561143-42561165 GTGGCAAATGGGGTGATGAATGG - Exonic
954305606 3:49723828-49723850 CTGTCAGGCGGGTTGGTGAAGGG - Exonic
960447561 3:117766370-117766392 ATTTCAAATGGGCTGGTGAATGG - Intergenic
962317361 3:134367217-134367239 GTGTGCAAGGAGCTGGTGAATGG + Intronic
964814687 3:160704183-160704205 GTGTACAACAGGCTGGAGAAAGG + Intergenic
965830884 3:172787941-172787963 GTGTCAAGCTGGCTGCTGTAGGG + Intronic
966871210 3:184291522-184291544 GTGTCAAACGGGCTGGTGAATGG + Intronic
967796626 3:193605362-193605384 GTGTTACAGGGGCTGGTGCATGG + Intronic
968187625 3:196644002-196644024 GTGTCAGGCTGGCTGGTGACAGG - Intronic
968549827 4:1216515-1216537 GTGTCAAACGGACTGGTCAGTGG + Intronic
976096718 4:81516217-81516239 GTATCAAAAGGGCTGGGGACAGG - Intronic
978872099 4:113591862-113591884 GTGTCTAATGAGCTGGGGAATGG - Intronic
990624207 5:57593415-57593437 GGGTCACACGGGTTGGAGAATGG - Intergenic
991392022 5:66154861-66154883 GTGGGAAAGGAGCTGGTGAATGG + Intronic
996994401 5:129677759-129677781 GTGGAAAATGGGCTGGTGTAGGG - Intronic
1001271673 5:170317228-170317250 GTGTCTAACGGGCAAGTGATGGG + Intergenic
1001584084 5:172820966-172820988 GAGTCACACAGGCTGGTAAACGG + Intergenic
1004355420 6:14926221-14926243 GTGTTAAATTGCCTGGTGAACGG - Intergenic
1004644052 6:17542474-17542496 TGGGCAAACAGGCTGGTGAAGGG - Intronic
1011326557 6:86154603-86154625 GTATTAAAGGGGATGGTGAATGG + Intergenic
1016076233 6:139799371-139799393 GTGTCAAGTGGGCTGGTGGAAGG + Intergenic
1016573946 6:145546526-145546548 GTGTCAACTTGACTGGTGAAGGG - Intronic
1018994470 6:168700783-168700805 GTTTCAAACAGGCTGAAGAAGGG + Intergenic
1030185643 7:106759078-106759100 GTGACAAAGGGGGTGGTGTAAGG - Intergenic
1032074386 7:128829697-128829719 AGGCCAAACGGGCTGGTGACAGG + Intergenic
1035701209 8:1640311-1640333 GTGTCAGACCTGCTGCTGAAGGG + Intronic
1049498124 8:142946243-142946265 GTGTGCAGGGGGCTGGTGAAGGG - Intergenic
1052525281 9:29609631-29609653 GTATAAAACTGGCTGGTAAAAGG + Intergenic
1061934907 9:133852068-133852090 GTGACAGACGGGCTGATGAGTGG + Intronic
1186076640 X:5886856-5886878 GGTTCAGACGGGCTGGTCAAGGG - Intronic
1190228522 X:48563595-48563617 GTGTCCAAAGGGCAGGTGAGCGG + Intergenic
1190363078 X:49667159-49667181 GTGTCTAACCAGCTGGTGACCGG + Intergenic
1191978854 X:66903517-66903539 GTGTAAAAGGGGCTGCTGAAGGG - Intergenic
1201337131 Y:12893211-12893233 GTGTCACAAGGGCTGCTGCAGGG - Intergenic
1201518623 Y:14847136-14847158 GTTTCAGACAGGCTGGTCAAGGG + Intergenic