ID: 966872446

View in Genome Browser
Species Human (GRCh38)
Location 3:184299601-184299623
Sequence CTCACCACCGCCGCGTGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 57}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966872434_966872446 23 Left 966872434 3:184299555-184299577 CCTCATTCTCCGTTCCGCGCTGT 0: 1
1: 0
2: 0
3: 2
4: 56
Right 966872446 3:184299601-184299623 CTCACCACCGCCGCGTGAAGTGG 0: 1
1: 0
2: 1
3: 3
4: 57
966872435_966872446 14 Left 966872435 3:184299564-184299586 CCGTTCCGCGCTGTCACCTCCGC 0: 1
1: 0
2: 0
3: 5
4: 92
Right 966872446 3:184299601-184299623 CTCACCACCGCCGCGTGAAGTGG 0: 1
1: 0
2: 1
3: 3
4: 57
966872436_966872446 9 Left 966872436 3:184299569-184299591 CCGCGCTGTCACCTCCGCCGTCC 0: 1
1: 0
2: 1
3: 12
4: 287
Right 966872446 3:184299601-184299623 CTCACCACCGCCGCGTGAAGTGG 0: 1
1: 0
2: 1
3: 3
4: 57
966872438_966872446 -5 Left 966872438 3:184299583-184299605 CCGCCGTCCCCACCAACCCTCAC 0: 1
1: 0
2: 8
3: 71
4: 771
Right 966872446 3:184299601-184299623 CTCACCACCGCCGCGTGAAGTGG 0: 1
1: 0
2: 1
3: 3
4: 57
966872437_966872446 -2 Left 966872437 3:184299580-184299602 CCTCCGCCGTCCCCACCAACCCT 0: 1
1: 0
2: 5
3: 39
4: 526
Right 966872446 3:184299601-184299623 CTCACCACCGCCGCGTGAAGTGG 0: 1
1: 0
2: 1
3: 3
4: 57
966872439_966872446 -8 Left 966872439 3:184299586-184299608 CCGTCCCCACCAACCCTCACCAC 0: 1
1: 1
2: 14
3: 176
4: 1364
Right 966872446 3:184299601-184299623 CTCACCACCGCCGCGTGAAGTGG 0: 1
1: 0
2: 1
3: 3
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966872446 Original CRISPR CTCACCACCGCCGCGTGAAG TGG Intronic
901761694 1:11476025-11476047 CTCCACACCGCCCCGTGAAGGGG - Intergenic
905235163 1:36541470-36541492 CTCACCACTGCCCAATGAAGTGG - Intergenic
907445096 1:54502437-54502459 CTTACCACAGCCCCGTGAGGTGG + Intergenic
907501950 1:54887374-54887396 CTCCCCGCCGCCGCGCGAGGCGG + Intergenic
909105893 1:71407798-71407820 CTCACCACAGCCCTGTGAGGTGG - Intronic
916025987 1:160834023-160834045 CCCACCACCACCACGGGAAGAGG + Intronic
916072236 1:161177073-161177095 CTCCCCACCCCCGCTAGAAGAGG - Intronic
922864275 1:228846021-228846043 CTCACCACAGCAGCCTGCAGAGG - Intergenic
1071562636 10:86655729-86655751 CTCACCACCCCAGCGTCTAGAGG + Intronic
1073080118 10:100854338-100854360 CTCAGCACCGCCTGGTGATGAGG - Intergenic
1076657757 10:132036172-132036194 CTCACCACGGCCGCGTGCTCCGG - Intergenic
1081489982 11:43559745-43559767 CTCTCCAACGTCGCGTGAAGGGG - Intronic
1083351259 11:62030710-62030732 CTCCCCAAGGCCGCGTGCAGTGG - Intergenic
1083726814 11:64632780-64632802 CTCCCCACCGCCGCCTAATGAGG - Intronic
1086380206 11:86244868-86244890 CCCACCACCGCCTCGAGAAGAGG - Exonic
1089135602 11:116246670-116246692 CTCCCAACCGCCCTGTGAAGAGG - Intergenic
1089613077 11:119680478-119680500 CTCACCTCCTCAGCGTGACGGGG + Intronic
1096159643 12:49366484-49366506 CCGACCACCGCCGCGTAGAGGGG + Intergenic
1097191932 12:57223616-57223638 GCCACCACCGCCGCGTGCTGTGG - Intronic
1102051066 12:109862278-109862300 CTGACCTCCGCTGCGTGTAGAGG + Intronic
1117571006 14:57049298-57049320 CTGACCACCCCCGCGGGGAGGGG + Intergenic
1121409258 14:93737937-93737959 CTCCCCACCCCCGCCTGCAGAGG - Intronic
1133267535 16:4594003-4594025 GTCACCACAGCCGTGGGAAGGGG + Intronic
1134598610 16:15515565-15515587 CTCACCACCACCCAGGGAAGTGG + Intronic
1135151076 16:20006537-20006559 CTCACCACCGCCTGGTGAGCAGG + Intergenic
1135232944 16:20726771-20726793 CTCACCACAGCCTTGTGAGGTGG - Intronic
1136293140 16:29287753-29287775 CTCCCCACAGCCACGGGAAGGGG - Intergenic
1142099024 16:88261760-88261782 CTCCCCACAGCCACGGGAAGGGG - Intergenic
1142596804 17:1033746-1033768 CTCACCAGCACCGCCTGAGGGGG + Intronic
1144909814 17:18672021-18672043 CTCATCACTGCTGCGTGACGTGG + Intronic
1149567818 17:57652266-57652288 CTCACCACAGCCCCGGGGAGGGG + Intronic
1156088726 18:33440465-33440487 CTCCCCACCGCCTCTGGAAGGGG + Intronic
1161532216 19:4796725-4796747 CTCCCCACTGCCACGTGAGGCGG - Exonic
1163091350 19:15022221-15022243 CTCACCACCACCATTTGAAGTGG - Intronic
1163570979 19:18082145-18082167 CTCACCAACACCGCAGGAAGTGG + Exonic
1166733655 19:45072060-45072082 CTCACCACCGCTGCATGGAAGGG + Exonic
934528605 2:95069780-95069802 CTCACAACAGCCCCGAGAAGTGG - Intergenic
1172473129 20:35215723-35215745 CTCACCACTGTCCTGTGAAGTGG - Intergenic
1178358648 21:31930255-31930277 CTCACAACAGCCATGTGAAGTGG - Intronic
1181130067 22:20726151-20726173 CTCACCACTTCCGGCTGAAGAGG + Intronic
1181645810 22:24231420-24231442 CTCACCACCGCCGCCTGCAGGGG - Exonic
1182330788 22:29550453-29550475 CTCACCACAGCCTCCTGAGGTGG + Intronic
952233233 3:31453577-31453599 CTCACCACCACAGCCTGGAGGGG - Intergenic
966872446 3:184299601-184299623 CTCACCACCGCCGCGTGAAGTGG + Intronic
967037736 3:185660541-185660563 CTCACTACAGCCGTGTTAAGTGG - Intronic
968634833 4:1672443-1672465 CTCCCCACCACCCCGTGAGGAGG - Intronic
972220732 4:36951186-36951208 CTCTCCACCACCATGTGAAGAGG - Intergenic
995106356 5:108381424-108381446 CTCGCCGCCGCCGCGGGACGGGG - Exonic
1003795133 6:9593280-9593302 CTCACAACCACCCCGTGAAATGG + Intergenic
1007726090 6:43916463-43916485 CCCACCACCGCTGTGGGAAGAGG + Intergenic
1013283851 6:108663717-108663739 CTCATCACTGCTGCGTGACGTGG - Exonic
1015310898 6:131766063-131766085 CTCACCATAGTCTCGTGAAGTGG - Intergenic
1019429080 7:990504-990526 CCCACCTGCGCCACGTGAAGCGG + Intergenic
1019515285 7:1437272-1437294 CTCACAACAGCTGCGTGAGGTGG + Intronic
1020283682 7:6664213-6664235 CGCACCACCGCCGCATCCAGCGG - Intergenic
1023955701 7:44885265-44885287 CTCGCCGCCGCCGCGGGACGCGG + Exonic
1035352008 7:158253596-158253618 CTGACCACCGCCGAGGGGAGGGG - Intronic
1037845953 8:22282473-22282495 ATCACCACGGCTGCGTGCAGGGG - Intronic
1052600090 9:30616091-30616113 CTCTCCACCACCCTGTGAAGAGG + Intergenic
1061326132 9:129865815-129865837 CTCCCCTCCGCCGGGTGCAGTGG - Intronic
1061412506 9:130429199-130429221 CTCACCACGACCCCATGAAGAGG + Intronic
1061959103 9:133979053-133979075 CCCACCCCAGCCGCGTCAAGTGG + Intronic