ID: 966872710

View in Genome Browser
Species Human (GRCh38)
Location 3:184301781-184301803
Sequence AAGCACTTCTCTGTGGGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 205}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966872710_966872717 9 Left 966872710 3:184301781-184301803 CCTTGACCCACAGAGAAGTGCTT 0: 1
1: 0
2: 2
3: 8
4: 205
Right 966872717 3:184301813-184301835 CTGTGCTCTCTTAATCGTCTGGG 0: 1
1: 0
2: 0
3: 11
4: 94
966872710_966872719 28 Left 966872710 3:184301781-184301803 CCTTGACCCACAGAGAAGTGCTT 0: 1
1: 0
2: 2
3: 8
4: 205
Right 966872719 3:184301832-184301854 TGGGACTATCTGTAGGCATCTGG 0: 1
1: 0
2: 0
3: 8
4: 87
966872710_966872718 21 Left 966872710 3:184301781-184301803 CCTTGACCCACAGAGAAGTGCTT 0: 1
1: 0
2: 2
3: 8
4: 205
Right 966872718 3:184301825-184301847 AATCGTCTGGGACTATCTGTAGG 0: 1
1: 0
2: 0
3: 4
4: 57
966872710_966872716 8 Left 966872710 3:184301781-184301803 CCTTGACCCACAGAGAAGTGCTT 0: 1
1: 0
2: 2
3: 8
4: 205
Right 966872716 3:184301812-184301834 GCTGTGCTCTCTTAATCGTCTGG 0: 1
1: 0
2: 1
3: 4
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966872710 Original CRISPR AAGCACTTCTCTGTGGGTCA AGG (reversed) Intronic
901291790 1:8129891-8129913 AAGCACATCTCACTGGGACATGG - Intergenic
902610119 1:17592299-17592321 CAGCACTTTTCTGTGGGTCAGGG + Intronic
903835758 1:26202373-26202395 AAGCACTTCTCTGGGAGGCCTGG + Intronic
905540632 1:38757653-38757675 AAGCACTGCCTTGTGGGCCATGG - Intergenic
905733778 1:40312829-40312851 CTGCCCTGCTCTGTGGGTCAGGG - Intronic
906424447 1:45698465-45698487 AAGCAGTTTTGTTTGGGTCAAGG + Intronic
910003517 1:82366224-82366246 AAGTACCTCTCAGTTGGTCATGG + Intergenic
910895008 1:92060002-92060024 AAATACTTCTCGGTGGGGCAGGG - Intronic
911705080 1:101001736-101001758 AGGAACTTCTCTTTGGTTCATGG + Intronic
916634262 1:166651399-166651421 ATGCACTTGTGTGTGGGGCATGG + Intergenic
919860986 1:201739535-201739557 AGCCACTTCTCTCTGGGGCACGG - Intronic
921737028 1:218640561-218640583 AAGCACTCCTCTGATGGGCAGGG + Intergenic
922603603 1:226875033-226875055 AGGCACTTCTGAGTGGGACAGGG + Intronic
922614562 1:226954166-226954188 GAGGTCTGCTCTGTGGGTCACGG + Intronic
922629701 1:227093730-227093752 GAGCACTTCTCTGTGTTTCCTGG + Intronic
924447950 1:244151172-244151194 AAGCCATTCTCTGGGGGGCAGGG - Intergenic
1062879780 10:968684-968706 AAGTTCTTCTTTGTGGCTCAAGG - Intergenic
1062898000 10:1119539-1119561 AAGCCCTTCTCTGTGGGCCATGG + Intronic
1064790176 10:18950226-18950248 AAGCATATCCCTGTGGCTCATGG + Intergenic
1066422942 10:35278751-35278773 AGGCAGTTCTCTGTGGTTGAGGG + Intronic
1067011271 10:42716107-42716129 ATGCACTTCTCTACGGATCAGGG - Intergenic
1067312315 10:45125735-45125757 GTGCACTTCTCTATGGATCAGGG + Intergenic
1072108573 10:92296579-92296601 AAGCATTTCTCAGTAGGTCCAGG - Intronic
1075438272 10:122460965-122460987 TATCACTTCACTGTGGGTCTGGG + Intergenic
1079806481 11:24937087-24937109 AAGCACTTATCTTGGGGTCTAGG + Intronic
1081219889 11:40447348-40447370 AGGCACTTCTCTGCTGGTCTGGG - Intronic
1083257548 11:61505940-61505962 AGGCCCTTCTCAGTGGGTAAAGG - Intergenic
1085992709 11:81869640-81869662 ATGAACTGCTCTGTGGGTTAAGG - Intergenic
1087621937 11:100552993-100553015 GTGAACTTCTCTGTGTGTCAGGG - Intergenic
1089677790 11:120101859-120101881 AAGGAATTCGCTGTGGATCATGG + Intergenic
1091788439 12:3257138-3257160 AAGTGCTGCTCTGTGGGTCTTGG + Intronic
1091883116 12:3995678-3995700 AAGCTGTGCTCTGTGGTTCAGGG + Intergenic
1092114327 12:5988237-5988259 TAGCTCTTCTCTGTGAGGCAGGG - Intronic
1093116097 12:15212955-15212977 AATCACTTCTCTTTGTGCCACGG + Intronic
1100870396 12:98904719-98904741 ATGCACTTCTCTTTGGTTCCTGG - Intronic
1102556689 12:113731420-113731442 AAGCACTTCCCAGTGAGTAAAGG + Intergenic
1103197658 12:119059121-119059143 AACCACTTCTGTTTGGGTCTTGG + Intronic
1104401663 12:128481463-128481485 AAGCACTTGTCTGGGGGCCTGGG - Intronic
1105429919 13:20326991-20327013 GAGCACTGCCCTGTGGATCAAGG + Intergenic
1105580730 13:21693351-21693373 TAGGACTTCTCTGTGGGTATTGG + Intronic
1105705532 13:22965622-22965644 CAGCACTTCTCAGAGGGCCAGGG + Intergenic
1105858434 13:24390607-24390629 CAGCACTTCTCAGAGGGCCAGGG + Intergenic
1106976396 13:35221973-35221995 AAACACTTCTCTGAGGGAAATGG - Intronic
1107811979 13:44209168-44209190 TAGCTCTTCTCTTTGGATCAGGG - Intergenic
1109159424 13:58953885-58953907 AAGCTGCTCTCTGTGGGTTAGGG - Intergenic
1109531679 13:63657358-63657380 AAGCACTTCTCTGGGGCTGTTGG + Intergenic
1110473047 13:75882143-75882165 AAACACTGCTCTGCTGGTCAAGG + Intronic
1110794831 13:79624188-79624210 AAGCACTTTTGTGTGGAGCACGG - Intergenic
1110999161 13:82156010-82156032 AAGCAATTGTCTATGGGTGAGGG + Intergenic
1111896565 13:94149724-94149746 TATTTCTTCTCTGTGGGTCAAGG - Intronic
1114082938 14:19217624-19217646 AAGCACATCTGTGTGTGTTAAGG + Intergenic
1116375315 14:44192002-44192024 AAGCACTTATCTGAGTGTCTGGG - Intergenic
1119035677 14:71228579-71228601 CAGCACTGCTCTGTGCTTCATGG + Intergenic
1119670532 14:76514880-76514902 AAGCCCTGCTCTGAGAGTCAGGG + Intergenic
1121506188 14:94479360-94479382 AAGAGCTTCTCTCTGGGGCAAGG - Intronic
1122797477 14:104213165-104213187 ATGCTCTGCTCTGTGGGACAAGG + Intergenic
1124054575 15:26230447-26230469 AAGCGCTACTCTATGGGTCCGGG - Intergenic
1125617573 15:41028954-41028976 AATCACTCCTCAGTGGGACATGG + Intronic
1126004676 15:44245021-44245043 AACCACTTCTCTGTTGATCTTGG + Intergenic
1127333146 15:57958018-57958040 AGGTGCTTCTCTGTGGGTCCTGG + Intronic
1128598732 15:68977043-68977065 AATCACTTCTCCCTGTGTCAAGG - Intronic
1128638723 15:69319802-69319824 AAGCTCTTGTCTGGGGGTCTTGG + Intronic
1129541834 15:76356275-76356297 AAGCACTACCCTTTGGGGCAGGG + Intronic
1130961047 15:88658871-88658893 AAGCACTTCTCAGAGGGTGGGGG + Intergenic
1131785568 15:95907823-95907845 TAGCACCTCACAGTGGGTCATGG + Intergenic
1132751328 16:1459200-1459222 AAGCACGGCTGAGTGGGTCACGG + Intronic
1133131522 16:3679020-3679042 CAGAACTGCTCTGTGGGTCTGGG + Intronic
1133512276 16:6471689-6471711 AACCTCTTCCCTGTGGCTCATGG - Intronic
1136684460 16:31986116-31986138 AAGGACTTCTGTGTGGCTCGTGG - Intergenic
1136785087 16:32929659-32929681 AAGGACTTCTGTGTGGCTCGTGG - Intergenic
1136884696 16:33924145-33924167 AAGGACTTCTGTGTGGCTCGTGG + Intergenic
1138358271 16:56403196-56403218 AAGCTCTTCACTGTTGGTGATGG + Intronic
1140893656 16:79306453-79306475 AAGCAATGCTCCGTGGGTCAGGG - Intergenic
1141447177 16:84068549-84068571 CAGGCCTTCTCTGTGGGCCATGG - Intronic
1203087747 16_KI270728v1_random:1193668-1193690 AAGGACTTCTGTGTGGCTCGTGG - Intergenic
1144945386 17:18967074-18967096 GAGCACTCCTCTGTGGGCCGGGG - Intronic
1146720847 17:35122420-35122442 ACGCTCTTCTCTGGGAGTCAAGG - Intronic
1148100358 17:45086556-45086578 GAGCTGTTCTCAGTGGGTCAGGG + Exonic
1148772671 17:50076236-50076258 CAGCTCTTCTCTGGGGTTCAGGG + Intronic
1148991272 17:51668995-51669017 AGCCACTTCCCTGTGGGGCAGGG + Intronic
1151254071 17:72861929-72861951 AAGCACCACTCTGTGGTCCATGG + Intronic
1151344865 17:73495263-73495285 CAGCACCTCACTGTAGGTCATGG + Intronic
1151436122 17:74098479-74098501 ATGCATTTCTGTGTGTGTCAGGG - Intergenic
1153560463 18:6367479-6367501 AAGACATTCTCTGTGGGCCAGGG - Intronic
1154499653 18:14989300-14989322 AAGCACATCTGTGTGTGTTAAGG + Intergenic
1156663716 18:39380284-39380306 TTGCACTTCTCTGTGGTCCAGGG + Intergenic
1159023972 18:63166164-63166186 AACCACCTCTCTCTGGGGCATGG - Intronic
1160012229 18:75114900-75114922 AAACACTGCTCTGTGGTTTATGG - Intergenic
1160257014 18:77255834-77255856 AAGCACACCTGAGTGGGTCATGG + Intronic
1161473751 19:4473539-4473561 AAGCACTCCCTTGTGGGTCCTGG + Intronic
1161630576 19:5353183-5353205 AAGCCATTCCCTGTGGGCCAGGG - Intergenic
1161644791 19:5446436-5446458 AAGCCCATCTCTGTAAGTCAGGG - Intergenic
1164785672 19:30928481-30928503 AAGCTCTTTGCTGTGAGTCATGG - Intergenic
1166201984 19:41243603-41243625 AAACACTTCTCTGGGGGGGAGGG - Exonic
1166512137 19:43416052-43416074 AAGCACTTCTCCATGGGCCAAGG - Intronic
925892264 2:8444861-8444883 AAGTACTTATCTTTGGGGCATGG + Intergenic
926497369 2:13607172-13607194 AAGCATTTTTCTGAGGGTCCCGG + Intergenic
927720462 2:25378828-25378850 AATCACATGTCTGTGGGTCAGGG + Intronic
928652842 2:33420574-33420596 GAGAACTGCTCTGTGGGGCATGG - Intergenic
928865804 2:35916432-35916454 AAGCTCTTCTCTGAGGGCAATGG - Intergenic
929509313 2:42554538-42554560 AAGCACATCCCTGGGGGCCAGGG + Intronic
930028820 2:47046003-47046025 AAGCACTGTTCTGTGAGTCCTGG - Intronic
930094214 2:47554468-47554490 GCGCACTGCTCTGTGAGTCACGG - Intronic
930740021 2:54822738-54822760 AAGCAGTTATCTCTGGGTAATGG + Intronic
930761992 2:55048760-55048782 AAACATTTCTCTGTGTCTCATGG + Intronic
931057077 2:58484305-58484327 AAGCACTTATTTGTGTGGCATGG + Intergenic
931208918 2:60173945-60173967 ATGCACCTCTATGTGGGTCCTGG + Intergenic
931487809 2:62710906-62710928 AAGCATTTCTCTGTTGACCATGG + Intronic
933835509 2:86242317-86242339 AAGTATTGCTCTGTTGGTCATGG + Intronic
934661619 2:96146242-96146264 AAGTACTTCTCTCTGGGGCCTGG - Intergenic
936342459 2:111646442-111646464 GAGCATTTCTCTGTGGGTGTCGG - Intergenic
936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG + Intronic
938498861 2:131819654-131819676 AAGCACATCTGTGTGTGTTAAGG + Intergenic
939269474 2:139918870-139918892 AACCAGTTCTGTGTGGCTCAGGG + Intergenic
945020050 2:205561502-205561524 AAGTACTTCTCTGTGCGACAAGG + Intronic
948353632 2:237360398-237360420 CAGCACTGCCCTGTGGGGCAAGG + Intronic
948911590 2:241007593-241007615 AAGCACTTATTTTTGGGTGATGG - Intronic
1169111600 20:3037539-3037561 CTGTACTTCTCTGTGGGTCTTGG + Intronic
1170279603 20:14631318-14631340 AACCACTTCTCTTTTGTTCACGG + Intronic
1170997410 20:21376579-21376601 AACCACAACTCTGTGGGTTAAGG + Intronic
1173348383 20:42222091-42222113 AAGTGCTTCTCTCTGGGGCAGGG + Intronic
1175700645 20:61134495-61134517 AATCACATCTGTGTGGGGCAGGG - Intergenic
1176979270 21:15360772-15360794 ATGTACTGCTCTGTGGGACATGG + Intergenic
1177475661 21:21618405-21618427 AACCACTTTTATGTGGATCAGGG + Intergenic
1177946219 21:27472586-27472608 AAGCACTTATGTGCTGGTCAAGG + Intergenic
1178080918 21:29064047-29064069 AAGCACTTCTCGGCCGGGCACGG - Intronic
1178217151 21:30612415-30612437 AAGCCCCTCTCTGTGAGTGAGGG + Intergenic
1178437814 21:32575290-32575312 CTGCACTTCTCTGTGGGGCAGGG - Intergenic
1180497841 22:15905057-15905079 AAGCACATCTGTGTGTGTTAAGG - Intergenic
1181303772 22:21902359-21902381 GACCACTCCTCTGTGGGTTATGG + Intergenic
1182010874 22:26999679-26999701 AAGTACTGGTCTTTGGGTCAGGG - Intergenic
1182847568 22:33444111-33444133 AAGCACTTCTGTGTAGGATAAGG + Intronic
950318469 3:12026858-12026880 AAACACTGCTGTGTGGATCAGGG - Intronic
951225404 3:20115279-20115301 AACTACTTCCCTGTGGGGCAGGG + Intronic
952735351 3:36685191-36685213 CAGTACTTCTCTATGGGTGATGG - Intergenic
954856516 3:53648565-53648587 AAGCACTCCTCTGGGGGATATGG + Intronic
958730628 3:97956973-97956995 AAACACCACTCTGTGGCTCAGGG - Intronic
958915843 3:100048923-100048945 AAGCACTTTTGTTTGTGTCATGG + Intronic
960156011 3:114297763-114297785 AATTTCTTCTCTGTGGCTCATGG + Intronic
960527855 3:118730828-118730850 AAGGAGTTGTCTTTGGGTCAGGG - Intergenic
961871607 3:129992662-129992684 AAGTGTTCCTCTGTGGGTCAGGG + Intergenic
962434846 3:135356904-135356926 CAGCCCTTCTCTGTGGACCAGGG - Intergenic
963173326 3:142273057-142273079 AAGGAATTTTCTGTGGGTGATGG + Intergenic
965530077 3:169763121-169763143 ATGCACTTGTCTGTAGTTCAAGG + Intergenic
966872710 3:184301781-184301803 AAGCACTTCTCTGTGGGTCAAGG - Intronic
966944310 3:184766971-184766993 AAGCAGTTCTCTGTGTGTTGTGG + Intergenic
969156140 4:5211527-5211549 AAGCACTTGTGTGTGAGTCTGGG + Intronic
970212080 4:13720330-13720352 TAGCTCTTCTCTGGGGGCCACGG - Intergenic
970687258 4:18582699-18582721 AGGAACTTCTCTGTAGGTTAAGG - Intergenic
972999977 4:44935144-44935166 AAGCACAAATTTGTGGGTCATGG - Intergenic
978122186 4:105092846-105092868 TAGCTCTTCTCTGTAGGACAGGG + Intergenic
981849268 4:149209473-149209495 AAGCACATTTCTGTGGTTGATGG - Intergenic
986217909 5:5738186-5738208 CTACACTTCTCTGTGGGTCACGG + Intergenic
986749899 5:10777558-10777580 AATCAGCTCTCTGGGGGTCAGGG + Intergenic
987427462 5:17789683-17789705 ATGCTTTTCTCTGTGTGTCATGG + Intergenic
987476086 5:18393866-18393888 AAGTACTTTTGTGTGTGTCATGG + Intergenic
988035556 5:25823452-25823474 AGCCACTTCTCCGTGGGGCAGGG - Intergenic
990443575 5:55870776-55870798 GAGCACTTTTCAGTAGGTCATGG + Intronic
990783517 5:59394131-59394153 TAGCAGATCTCTGTGGGTCTTGG - Intronic
996904140 5:128578250-128578272 AAGCATTACTCTGTGGCTTATGG + Intronic
997986047 5:138502300-138502322 AGTCACTTCCCTGTGAGTCAAGG - Intergenic
998104636 5:139460638-139460660 AAAGATTTCTCTGTGGGTAAGGG + Intronic
1001297522 5:170508794-170508816 AATCACTTCTCTCTGGGGCTTGG - Intronic
1003567928 6:7236249-7236271 AAGCCCATCACTGTGGGACAAGG - Intronic
1004527470 6:16422784-16422806 AAACATCTCTCTGTGGGTGAAGG - Intronic
1004909226 6:20267322-20267344 AATGATTTCTTTGTGGGTCAAGG - Intergenic
1004955887 6:20727164-20727186 AAACAGTTACCTGTGGGTCAAGG - Intronic
1006752833 6:36389474-36389496 ATGGAGTTCTCTGTGGATCATGG + Intergenic
1007309174 6:40931808-40931830 AGGCCTTTCTCTGTGGCTCATGG - Intergenic
1007326110 6:41061315-41061337 CAGCCGTTCTCTGTAGGTCAAGG - Exonic
1007932300 6:45702620-45702642 AAGGACTTGTCTGAGGGCCAGGG - Intergenic
1008300112 6:49826931-49826953 AAGTTCTTCACTGTGGTTCAGGG - Intergenic
1010852004 6:80788730-80788752 AAGGGATTCTATGTGGGTCAAGG - Intergenic
1011942742 6:92863114-92863136 AAGCACTCCGGTGTGGGCCAAGG - Intergenic
1012888973 6:104877552-104877574 TAGCACTTCTCTGAGTATCAGGG - Intergenic
1013229337 6:108147563-108147585 TAGCACTGCTCTTTGGGGCAGGG - Intronic
1016808921 6:148240651-148240673 ATGCATTTCTCTATGCGTCAGGG + Intergenic
1017038320 6:150286931-150286953 AAGCCTTTCTCTGTATGTCATGG - Intergenic
1019885390 7:3899835-3899857 AAGCACTTCTCAGTGTGCCTGGG - Intronic
1020756512 7:12210669-12210691 AAGCTCTTCGCTGTGGGTTGGGG - Intergenic
1022602491 7:31774936-31774958 AAGCACATCTGTTTGGGGCAAGG - Intronic
1026505699 7:70980722-70980744 ATGCACTTGTCTCTGGGTTACGG + Intergenic
1031112915 7:117632729-117632751 GAGCACTGCTCTGTGGGGGATGG + Intronic
1031433222 7:121699127-121699149 CAGCAGTCATCTGTGGGTCATGG - Intergenic
1032902019 7:136320818-136320840 AAGCACTTTGCTGTGGGCCTGGG - Intergenic
1033478515 7:141714822-141714844 TTGAACTTCTCTGTGGGTGATGG + Intronic
1034987030 7:155522612-155522634 AAGCCTTTCTCTGAGTGTCAGGG + Intronic
1036383405 8:8255234-8255256 TAGCAGTTCTCTGTAGGTAAAGG - Intergenic
1038496547 8:28007334-28007356 GAGCACTTCTCAGGGAGTCAGGG + Intergenic
1038704525 8:29881180-29881202 ATTCACTTCTCTGTAGTTCAGGG - Intergenic
1039248633 8:35636656-35636678 CAGCACTTTTCTGTGAGTGATGG - Intronic
1040887017 8:52275904-52275926 AAGCACTTCTTTATGGATCCAGG + Intronic
1042206922 8:66338775-66338797 AATGACTTCTCCCTGGGTCATGG - Intergenic
1045416851 8:101976100-101976122 CAGCTCTTCTCTGTGGGTTCTGG + Intronic
1046493765 8:114986798-114986820 AAGACTTTCTCTGTGAGTCAGGG + Intergenic
1047870640 8:129078042-129078064 AAGAACTTCTGCCTGGGTCATGG + Intergenic
1049164393 8:141117342-141117364 AACGACGTCTCAGTGGGTCAAGG + Intronic
1049359438 8:142205366-142205388 AAGCACTTCTCAGGGGGTTGTGG + Intergenic
1050262977 9:3860552-3860574 AAGCAGTTCTCAGTGTCTCAGGG - Intronic
1050775305 9:9252260-9252282 AAGGAAATCTCTGTTGGTCATGG + Intronic
1055921299 9:81463638-81463660 GAGCACTTCTCATTGGGTAAAGG - Intergenic
1057140109 9:92721571-92721593 GAGCACATCTCTGTGGGTCTTGG + Intronic
1060228913 9:121812934-121812956 CAGCACTTCTGTCGGGGTCATGG + Intergenic
1061084477 9:128391081-128391103 AAGCTCTTTTCTCTAGGTCATGG - Exonic
1186196717 X:7116504-7116526 AGGCACTTCTCTCTGGGCCCTGG + Intronic
1187199363 X:17120193-17120215 AAGCACTCCTGAGGGGGTCAGGG + Intronic
1187224390 X:17361847-17361869 AAGAACTTCACTGTGGGTGGAGG + Intergenic
1188351722 X:29139692-29139714 AATAACTTCTCTCTGGGGCAAGG + Intronic
1190418854 X:50207560-50207582 AAGCACTTCTATGTGGTCCTGGG - Intronic
1191695533 X:63985970-63985992 AAGCACAGCTCGGTGGGTCATGG - Intergenic
1195337016 X:103865417-103865439 AGGCACTGACCTGTGGGTCAGGG + Intergenic
1195338465 X:103879911-103879933 AGGCACTGACCTGTGGGTCAGGG + Intergenic
1196563109 X:117174052-117174074 AAGCACTGCTCTGTGGTTACAGG - Intergenic
1198028077 X:132728541-132728563 AATCCCATCTATGTGGGTCAGGG - Intronic
1199656566 X:150001607-150001629 CAGCACTGCTCTCAGGGTCAGGG + Intergenic
1201395643 Y:13544761-13544783 AGGCACTGATCAGTGGGTCAGGG + Intergenic