ID: 966874452

View in Genome Browser
Species Human (GRCh38)
Location 3:184314528-184314550
Sequence CGCCCCCACGTGACCGGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 3, 3: 4, 4: 57}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966874452_966874457 1 Left 966874452 3:184314528-184314550 CCTGCGCCGGTCACGTGGGGGCG 0: 1
1: 0
2: 3
3: 4
4: 57
Right 966874457 3:184314552-184314574 CGGCTGCGCCTGCGGAGAAGCGG 0: 1
1: 0
2: 1
3: 6
4: 130
966874452_966874460 15 Left 966874452 3:184314528-184314550 CCTGCGCCGGTCACGTGGGGGCG 0: 1
1: 0
2: 3
3: 4
4: 57
Right 966874460 3:184314566-184314588 GAGAAGCGGTGGCCGCCGAGCGG 0: 1
1: 0
2: 0
3: 8
4: 99
966874452_966874455 -7 Left 966874452 3:184314528-184314550 CCTGCGCCGGTCACGTGGGGGCG 0: 1
1: 0
2: 3
3: 4
4: 57
Right 966874455 3:184314544-184314566 GGGGGCGCCGGCTGCGCCTGCGG 0: 1
1: 0
2: 6
3: 45
4: 528
966874452_966874464 27 Left 966874452 3:184314528-184314550 CCTGCGCCGGTCACGTGGGGGCG 0: 1
1: 0
2: 3
3: 4
4: 57
Right 966874464 3:184314578-184314600 CCGCCGAGCGGGATCTGTGCGGG 0: 1
1: 0
2: 0
3: 1
4: 50
966874452_966874465 28 Left 966874452 3:184314528-184314550 CCTGCGCCGGTCACGTGGGGGCG 0: 1
1: 0
2: 3
3: 4
4: 57
Right 966874465 3:184314579-184314601 CGCCGAGCGGGATCTGTGCGGGG 0: 1
1: 0
2: 0
3: 0
4: 37
966874452_966874462 26 Left 966874452 3:184314528-184314550 CCTGCGCCGGTCACGTGGGGGCG 0: 1
1: 0
2: 3
3: 4
4: 57
Right 966874462 3:184314577-184314599 GCCGCCGAGCGGGATCTGTGCGG 0: 1
1: 0
2: 0
3: 1
4: 44
966874452_966874461 16 Left 966874452 3:184314528-184314550 CCTGCGCCGGTCACGTGGGGGCG 0: 1
1: 0
2: 3
3: 4
4: 57
Right 966874461 3:184314567-184314589 AGAAGCGGTGGCCGCCGAGCGGG 0: 1
1: 0
2: 1
3: 8
4: 149
966874452_966874458 4 Left 966874452 3:184314528-184314550 CCTGCGCCGGTCACGTGGGGGCG 0: 1
1: 0
2: 3
3: 4
4: 57
Right 966874458 3:184314555-184314577 CTGCGCCTGCGGAGAAGCGGTGG 0: 1
1: 0
2: 0
3: 5
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966874452 Original CRISPR CGCCCCCACGTGACCGGCGC AGG (reversed) Intronic
900224672 1:1527345-1527367 CGCCCACACGTGCCAGGAGCAGG - Intronic
900431893 1:2606551-2606573 GGCCCCCAGGTGACCGGAGGGGG + Intronic
900589745 1:3454389-3454411 CGCCCCCTCGAGGCCGGCCCGGG - Intergenic
900786990 1:4655468-4655490 CGCCCACACGCACCCGGCGCCGG - Intronic
901235323 1:7664517-7664539 CGTCTCCACGTGACCGCTGCAGG - Exonic
902916865 1:19644628-19644650 CGCGCCCACGTCCCCAGCGCCGG - Intronic
903069080 1:20717789-20717811 CCGCCCCCCGTGGCCGGCGCTGG - Exonic
908955894 1:69626727-69626749 CGCCCCCCCATGACAGGCCCCGG + Intronic
910251430 1:85201689-85201711 CGGCTCCCCATGACCGGCGCTGG + Intergenic
917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG + Exonic
920309764 1:205042156-205042178 CTCCCCCACGTGACCGGAGCAGG + Intergenic
923744281 1:236686366-236686388 CGCCCGCACGTGCTCGGGGCGGG + Intergenic
1063393625 10:5666413-5666435 CGCCACCACCTCCCCGGCGCAGG + Intronic
1065967582 10:30781932-30781954 CGCTCCCACGTGATAGGCACGGG - Intergenic
1074377420 10:112951367-112951389 CGCCCCGACCGGGCCGGCGCAGG - Intronic
1077285595 11:1763958-1763980 CGCGCCCACGTGACCGGTCCGGG - Exonic
1081521953 11:43890397-43890419 CGCCCCCAAGTGACCGCCTGTGG - Intronic
1081873047 11:46391864-46391886 CGCCGCCGGGTGACCGGCCCGGG - Intergenic
1083331233 11:61899286-61899308 CGCCCCCTGGTGGCCGGTGCAGG - Intronic
1083335107 11:61917553-61917575 CTCCGCCACGTGACCCGCCCAGG - Intronic
1084868590 11:72080444-72080466 CGCAGCCAGGTAACCGGCGCGGG - Exonic
1085284570 11:75351546-75351568 CGCCCCCACGCGCCCCCCGCCGG + Intronic
1090366606 11:126211740-126211762 CGTCCCCACGTGACTCGCCCAGG - Exonic
1108221084 13:48233553-48233575 CGCCCCGAGGTGGCGGGCGCGGG + Intronic
1116437573 14:44912214-44912236 CGCCCACCCGGAACCGGCGCCGG - Intergenic
1122773382 14:104106851-104106873 CGCCTCCACGTCACCGGCGTGGG - Exonic
1131466112 15:92655860-92655882 CGGCCCCACGTGGGCGGGGCAGG + Exonic
1142421445 16:89972836-89972858 CGCTCCCCCGCGGCCGGCGCAGG - Intergenic
1144799895 17:17918949-17918971 GGCCCCCAGGTGACAGGCACTGG + Intronic
1146439062 17:32877351-32877373 CGCCCCCTGGGGACAGGCGCTGG + Intergenic
1148323632 17:46771478-46771500 CGCCCCCGCGTTCCCGGGGCTGG - Intronic
1148560818 17:48605034-48605056 CCCGGCCACATGACCGGCGCCGG + Intergenic
1149608298 17:57940410-57940432 CGGCCCCATGTGACCAGCTCTGG + Intronic
1160613959 18:80109714-80109736 CGCTCCCACGTGACCGGCGGCGG - Intronic
1161349696 19:3784949-3784971 CGCCCCCACCTGACCTGGGCTGG - Intronic
1162778735 19:12995876-12995898 CGCCCCCGCGCGACCGGGGGAGG + Intronic
1163639007 19:18451077-18451099 CGCCCCCATGTGGCCAGCGTGGG - Intronic
1165734111 19:38164856-38164878 CACCCCCACGGGACTGGCGGGGG + Exonic
1165787956 19:38473610-38473632 AGCCCCCAGCTGAGCGGCGCAGG - Exonic
1167472086 19:49680871-49680893 CGCCCTCTAGTGACCGGCGGTGG + Intronic
945080904 2:206085606-206085628 CACCCCCACCTGGCCCGCGCAGG + Intronic
947596095 2:231412532-231412554 CGCCCCCAACTGACCGCCGGGGG + Intergenic
1173831242 20:46089911-46089933 CGCCACCAACCGACCGGCGCGGG + Exonic
1175394732 20:58650493-58650515 CGCCCCCCCGTGCCCCGGGCCGG - Intergenic
1176156990 20:63626942-63626964 CGGCCCCAGGTAAGCGGCGCCGG - Intronic
1178551292 21:33542112-33542134 CGGCCCACCGGGACCGGCGCGGG + Intronic
1181585295 22:23849705-23849727 CGCCCCCTCGCGGCCGGAGCCGG + Intergenic
1183956039 22:41381433-41381455 CGGCTCCACGTGACCCGCGGGGG + Intronic
955656604 3:61251181-61251203 CACCGCCCCGTGAGCGGCGCCGG + Intronic
966874452 3:184314528-184314550 CGCCCCCACGTGACCGGCGCAGG - Intronic
972533060 4:39977583-39977605 CGCCCGCCCGGGAGCGGCGCTGG + Exonic
973025675 4:45266905-45266927 CGCCTCCACATGACAGGCCCCGG - Intergenic
985895990 5:2750502-2750524 CGCCCCCAGGTCGCCGGAGCAGG + Intronic
994185104 5:96807770-96807792 GCCCCCCACTTGACGGGCGCAGG + Intronic
998424206 5:142013042-142013064 CGCAGCCACGTGACCCGCGCGGG - Intergenic
1013575723 6:111482654-111482676 CGCGCACACGCCACCGGCGCCGG - Intronic
1019576078 7:1738226-1738248 GGCCTCCACGTGCCCGGCCCTGG - Intronic
1036454276 8:8893649-8893671 GGCCCCCACGTGACCGGCGGAGG + Intergenic
1036767932 8:11560709-11560731 TGCCCCCACGGGGCAGGCGCTGG + Intronic
1037878674 8:22561998-22562020 CGCCCCCTCGTGACCACAGCCGG + Intronic
1044821980 8:96160993-96161015 CGCCCCCGCGGGACGCGCGCGGG + Intergenic
1057619181 9:96619659-96619681 CGCCCCCAGGTGCCCGCAGCCGG + Exonic
1062403392 9:136382201-136382223 CGCCACCACGTGCCCCGCCCTGG - Intronic
1191252349 X:58265598-58265620 GACCCCCGCGGGACCGGCGCGGG + Intergenic
1194890508 X:99372351-99372373 CGCCCCCCCGGAACTGGCGCTGG + Intergenic