ID: 966874699

View in Genome Browser
Species Human (GRCh38)
Location 3:184315247-184315269
Sequence AGCTAGGCCTGCCGCCGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 120}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966874699_966874713 29 Left 966874699 3:184315247-184315269 CCTGGGCGGCGGCAGGCCTAGCT 0: 1
1: 0
2: 1
3: 15
4: 120
Right 966874713 3:184315299-184315321 GGCGTATCCTGTGTGCCCCTGGG 0: 1
1: 0
2: 0
3: 2
4: 72
966874699_966874712 28 Left 966874699 3:184315247-184315269 CCTGGGCGGCGGCAGGCCTAGCT 0: 1
1: 0
2: 1
3: 15
4: 120
Right 966874712 3:184315298-184315320 AGGCGTATCCTGTGTGCCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 93
966874699_966874704 1 Left 966874699 3:184315247-184315269 CCTGGGCGGCGGCAGGCCTAGCT 0: 1
1: 0
2: 1
3: 15
4: 120
Right 966874704 3:184315271-184315293 CTGGCCCAGTGCGGGTTCCCCGG 0: 1
1: 0
2: 1
3: 11
4: 193
966874699_966874701 -8 Left 966874699 3:184315247-184315269 CCTGGGCGGCGGCAGGCCTAGCT 0: 1
1: 0
2: 1
3: 15
4: 120
Right 966874701 3:184315262-184315284 GCCTAGCTTCTGGCCCAGTGCGG 0: 1
1: 0
2: 2
3: 10
4: 197
966874699_966874708 8 Left 966874699 3:184315247-184315269 CCTGGGCGGCGGCAGGCCTAGCT 0: 1
1: 0
2: 1
3: 15
4: 120
Right 966874708 3:184315278-184315300 AGTGCGGGTTCCCCGGCGGCAGG 0: 1
1: 0
2: 0
3: 1
4: 80
966874699_966874703 -7 Left 966874699 3:184315247-184315269 CCTGGGCGGCGGCAGGCCTAGCT 0: 1
1: 0
2: 1
3: 15
4: 120
Right 966874703 3:184315263-184315285 CCTAGCTTCTGGCCCAGTGCGGG 0: 1
1: 0
2: 5
3: 25
4: 275
966874699_966874705 4 Left 966874699 3:184315247-184315269 CCTGGGCGGCGGCAGGCCTAGCT 0: 1
1: 0
2: 1
3: 15
4: 120
Right 966874705 3:184315274-184315296 GCCCAGTGCGGGTTCCCCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966874699 Original CRISPR AGCTAGGCCTGCCGCCGCCC AGG (reversed) Intronic
900226426 1:1535443-1535465 AGCTGGGCCGGCGGCCGCACAGG - Exonic
900365865 1:2311775-2311797 AGCTAGGCCAGCCGTCACCCAGG + Intergenic
901057455 1:6455310-6455332 CGCTGGGCCTGCCGCGGACCAGG + Intronic
901915008 1:12492146-12492168 TGTTAGGCCTGCGGCCTCCCTGG - Intronic
902180115 1:14681757-14681779 AGCTCCGCCTCCCGCCTCCCGGG + Intronic
902851863 1:19164907-19164929 AGCCAGGCCTGCAGGCGCACAGG + Exonic
905626092 1:39491497-39491519 CGCAACACCTGCCGCCGCCCGGG + Intergenic
905886989 1:41496791-41496813 AGCAAGACCTGACGCTGCCCTGG + Intergenic
907409269 1:54273403-54273425 AGCTGAGCCAGCCGCCGCCGAGG + Intronic
910876669 1:91885356-91885378 AGCTCGGCCCCCCCCCGCCCCGG - Intronic
913186310 1:116373379-116373401 AGCTAGGGCTGCCGCGGGGCGGG - Intronic
921181505 1:212635488-212635510 AGAGAGGCCTGCCCCAGCCCTGG + Intergenic
1065816151 10:29484635-29484657 AGGTACTCCTGCCGCCGCCCGGG - Exonic
1070911466 10:80122464-80122486 AGCTAGGCCTGCAGTGGTCCTGG - Intergenic
1071527576 10:86367013-86367035 AGCTCGGCGCGCCGCAGCCCAGG - Intergenic
1075713918 10:124545063-124545085 AGCTCTGCCTGCCACCTCCCTGG + Intronic
1076291378 10:129348499-129348521 AGCCAGGGCTGCCACGGCCCTGG + Intergenic
1077338816 11:2017071-2017093 AGCTGGGCCTGCCGCCCCCGTGG + Intergenic
1084430690 11:69109288-69109310 AGCCAGGCCTGCCCTGGCCCAGG - Intergenic
1084936078 11:72587447-72587469 AGATAGCCCTGCCCCTGCCCTGG + Intronic
1085471863 11:76763620-76763642 AGCTATGCCTGCCTCAGCCTGGG - Intergenic
1088172849 11:107017878-107017900 AGCTGCCGCTGCCGCCGCCCCGG - Exonic
1090712581 11:129400777-129400799 ACCCACGCCTGCCACCGCCCTGG - Intronic
1202821800 11_KI270721v1_random:72253-72275 AGCTGGGCCTGCCGCCCCCGTGG + Intergenic
1094103743 12:26787139-26787161 AGCTGGGCTTGCCTCTGCCCTGG - Intronic
1094395896 12:30005594-30005616 AGCTAAGCCTGCTGCCGCATAGG - Intergenic
1096570478 12:52520248-52520270 AGCTACGACTGCCCCCGCTCCGG + Exonic
1097159553 12:57036673-57036695 AGCTAGTCCTGCCTGCACCCAGG - Intronic
1101910035 12:108854556-108854578 AGCCAGGCCTGCTGCCGGCGTGG - Intronic
1104866856 12:131961040-131961062 TGCAAGGCCTGCCCCGGCCCCGG - Exonic
1104885406 12:132104408-132104430 TGCAAGGCCTGCCCCGGCCCCGG - Exonic
1105280934 13:18962229-18962251 ATCAAGGCCTGCAGCCACCCAGG - Intergenic
1105779016 13:23690248-23690270 AGCCTGGCCTCCCTCCGCCCGGG - Intergenic
1106208702 13:27621646-27621668 AGACAGGCCTGCGGGCGCCCCGG - Exonic
1106776663 13:33016286-33016308 AGCCGGGACTGCCTCCGCCCTGG - Intergenic
1108683349 13:52798205-52798227 AGCTTTGCCTGCCTCAGCCCAGG - Intergenic
1114042100 14:18688453-18688475 AGCTAGGCCTGCAGAGGCCCTGG - Intergenic
1125025028 15:35020955-35020977 AGCTCTGCCTCCCGCCTCCCAGG - Intergenic
1128374414 15:67065401-67065423 AGCCAGGACTGCCGCCGCCCGGG + Intronic
1128997468 15:72307318-72307340 ACCTAGGCCTCCCACCACCCAGG + Intronic
1131271413 15:90949705-90949727 AGCTTACCCTGCCGCCTCCCTGG - Exonic
1131707673 15:95015566-95015588 TGCAAGCCCTGCCGCCTCCCGGG - Intergenic
1133008006 16:2895288-2895310 AGCTAGTGCTGGCGCTGCCCTGG - Exonic
1133336710 16:5011161-5011183 AGCGTGGCCTGCAGCCTCCCGGG + Exonic
1135142755 16:19935825-19935847 AGCCAGGCCTGCTGCTGCCCAGG + Intergenic
1136419125 16:30121626-30121648 ACCCAGGCCTGCAGCGGCCCAGG - Intronic
1136776320 16:32873722-32873744 AGCGAGGCCTGGCCCAGCCCGGG - Intergenic
1136894295 16:33987790-33987812 AGCGAGGCCTGGCCCAGCCCGGG + Intergenic
1138309175 16:56008601-56008623 AGCTAGACCTGGCCCCTCCCGGG - Intergenic
1141174087 16:81707963-81707985 AGCCAGGCCTCCTGCCGCCAGGG + Intronic
1141407670 16:83808159-83808181 GGCTTGGCCCGGCGCCGCCCGGG - Intronic
1141497156 16:84418254-84418276 GGCTCGGCCTGCCGCCTCCTTGG + Intronic
1141830750 16:86508897-86508919 GGCTCGGCCTGCCGCCGCCGCGG - Intergenic
1142147023 16:88496984-88497006 TGCCAGGCCTGCCCCTGCCCAGG + Intronic
1142177654 16:88652356-88652378 AGGGAGTCCTGCGGCCGCCCAGG - Exonic
1142188458 16:88706090-88706112 CGCGAGGCCGGCGGCCGCCCCGG - Intronic
1203078735 16_KI270728v1_random:1135831-1135853 AGCGAGGCCTGGCCCAGCCCGGG - Intergenic
1142866902 17:2796681-2796703 AGCTGGGTCTGCTGACGCCCTGG + Intronic
1145754646 17:27381515-27381537 AGCTGGGACTGCCGCTGTCCTGG + Intergenic
1150987255 17:70212828-70212850 AGCTCCGCCTTCCGCCTCCCGGG + Intergenic
1151692194 17:75693549-75693571 TGCCAGGCCTGCCGCCCCACAGG + Intronic
1154325429 18:13387515-13387537 AGCAGGGACCGCCGCCGCCCAGG + Exonic
1158954306 18:62524159-62524181 AGCCAAGCCCGCCGCCGACCCGG - Exonic
1161048760 19:2151141-2151163 TGCTCGGCCTGCCGCCCGCCCGG - Intronic
1161812079 19:6476804-6476826 AGCAGGGCCTGGCTCCGCCCCGG - Intronic
1165924870 19:39320767-39320789 AGCGCGGCCTGCAGCGGCCCGGG - Intergenic
1166121655 19:40690566-40690588 AGCTCGGTCTGACGCCGGCCAGG + Exonic
1166688762 19:44810693-44810715 AGCCAGGCCTGGCCCTGCCCTGG + Intronic
1167134902 19:47610129-47610151 AGCTGGGCCTGCGGCCTCCCCGG + Intronic
1167612050 19:50512413-50512435 AGCCAGGGCAGCCGCCGCCATGG + Exonic
1168293784 19:55369402-55369424 AGCTCGGGCTCCCGCGGCCCGGG - Intronic
1168405600 19:56108638-56108660 AGCTGTGCCTGGCGCTGCCCTGG - Intronic
928158116 2:28894903-28894925 ACCTTGGCCTGCAGCCGCGCTGG - Exonic
932494179 2:72138361-72138383 AGCCCGCCCTGACGCCGCCCTGG - Intronic
936090672 2:109499550-109499572 AGCTGGGCCTCCCTCTGCCCTGG - Intronic
938187072 2:129240965-129240987 AGCTGGGCCTGCCACCACCATGG - Intergenic
938268116 2:129944078-129944100 AGCTAGGCCTGCAGAGGCCCCGG + Intergenic
944884727 2:204050745-204050767 AGCTGGGCCTGCTGCTGGCCAGG + Intergenic
948805935 2:240453457-240453479 CGCATCGCCTGCCGCCGCCCCGG + Intronic
1170655885 20:18287786-18287808 AGCTTGGCCTGCCGTCGGCTTGG - Intergenic
1172688276 20:36773532-36773554 AGCTCGACCCGCCGCAGCCCCGG - Exonic
1175916253 20:62427364-62427386 AGCTGGGCCTCCAGCCTCCCTGG + Intronic
1176159675 20:63641879-63641901 TGCTAGCCCTGCCCCCGCCCCGG + Intronic
1176159729 20:63642004-63642026 TGCTAGCCCTGCCCCCGCCCCGG + Intronic
1181005857 22:20013191-20013213 TCCTAGGCCTGCTGCCACCCTGG + Intronic
1181085151 22:20436469-20436491 GGCCAGGCCGGCCCCCGCCCCGG + Intronic
1183302709 22:37066142-37066164 AGTTAGGCCGGCCACAGCCCAGG + Exonic
1183776164 22:39967547-39967569 AACCAGGCCTGCCGCCGGGCTGG - Intronic
1183831210 22:40419157-40419179 AGCCAGGCCTGCTGCCACCAGGG + Exonic
1184022149 22:41827979-41828001 AGCTAGGTCTGCTGCCAACCAGG - Intergenic
1184209887 22:43029221-43029243 AGCTTGGCCTGTCCTCGCCCTGG + Intergenic
1184472336 22:44702816-44702838 AGCGAGGCCCGCCAGCGCCCGGG + Intronic
1184669846 22:46006887-46006909 AGCTGGGCCTGCCGGCGCGGAGG + Intergenic
1184766982 22:46577200-46577222 CGCTACGCCTGCCGCCCGCCCGG - Intronic
1184813177 22:46851339-46851361 AGCCATGCCTGCCCCAGCCCGGG - Intronic
1185344276 22:50304611-50304633 AGCTAGGGCAGCTGCCTCCCCGG + Intronic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
950163811 3:10779098-10779120 AGGTAGGCCTGCTGCCAGCCCGG - Intergenic
953999203 3:47542789-47542811 ATCAGGGCCTGCCGCCTCCCAGG + Intergenic
954389414 3:50260863-50260885 AGCTAGGCCTCCACCTGCCCCGG + Intergenic
955972002 3:64445454-64445476 AGCCAGGCCAGCGGCCGCCGAGG - Intronic
956148153 3:66213102-66213124 AACTAGGCCTGGCGCAGCCCAGG + Intronic
962244817 3:133783915-133783937 TGCTATACCTGCCGCCACCCAGG - Intergenic
964736754 3:159925984-159926006 AGCTGGGCCGGCCGGCTCCCTGG + Intergenic
966874699 3:184315247-184315269 AGCTAGGCCTGCCGCCGCCCAGG - Intronic
968377104 4:53094-53116 GGCTTGGCCTGACGCAGCCCAGG - Intergenic
969061091 4:4435846-4435868 AGAAAGGACTGCTGCCGCCCAGG + Intronic
969307984 4:6336528-6336550 AGCCAGGCCTGGCACCACCCTGG + Intronic
970438282 4:16056768-16056790 AGCTAGGCCAGCCGACTCCCTGG - Intronic
974047557 4:56909330-56909352 AGTTAGGAATGCCGCCGCCGAGG + Intronic
974573328 4:63684334-63684356 AGCTGGGACTGCAGGCGCCCGGG - Intergenic
977607251 4:98995629-98995651 AGCTGGGCCCGCCGCTGGCCTGG - Exonic
979406263 4:120314263-120314285 TGCAAGCCCTGCCGCCTCCCAGG + Intergenic
984699513 4:182809599-182809621 AGCGAGGCCTGATGCCGCCAGGG - Intergenic
992102400 5:73419864-73419886 CGCCAGGCCTGCGGACGCCCGGG - Intergenic
992150408 5:73896861-73896883 AGCTGGGTCCGCCGCTGCCCCGG - Intronic
992515870 5:77492054-77492076 AGCCAGCCCCGCCTCCGCCCGGG + Intronic
999282587 5:150375049-150375071 AACAGGGCCTGCAGCCGCCCAGG + Exonic
1002461088 5:179374196-179374218 TGATGGGCCTGCCGCAGCCCTGG - Intergenic
1003377760 6:5594996-5595018 AGCTAGGCCAGCAGCTCCCCAGG - Intronic
1007431487 6:41779828-41779850 AGCGGGGCCCGGCGCCGCCCGGG - Exonic
1022482241 7:30751909-30751931 AGCTGGGGCTGCAGCCGCCCTGG - Intronic
1023019402 7:35996987-35997009 AGGTAGGCCTCAGGCCGCCCAGG - Intergenic
1035381327 7:158443262-158443284 AGCCATGCCTGGCGCTGCCCTGG - Intronic
1038266078 8:26040816-26040838 AGGCAAGCCTCCCGCCGCCCTGG + Intronic
1039771729 8:40694470-40694492 AGCAAGGCCTGCTGCAGTCCTGG - Intronic
1041167369 8:55102743-55102765 AGCCCGCCCCGCCGCCGCCCGGG - Exonic
1045017363 8:98010899-98010921 GCCTAGGCCTGCCTCAGCCCTGG - Intronic
1048981674 8:139705865-139705887 AGTCAGGCCTCCCGCCGCCCTGG + Intergenic
1049536767 8:143186137-143186159 AGGGAGGCCTCCCGACGCCCAGG - Intergenic
1049790593 8:144470720-144470742 AGCCAGGCCTGCTGGAGCCCAGG - Intronic
1062133754 9:134913947-134913969 AGCCTGCCCTGCCTCCGCCCTGG + Intronic
1062351952 9:136143689-136143711 GGCCAGGCCTGCAGCCTCCCTGG + Intergenic
1203572133 Un_KI270744v1:141152-141174 GGCTTGGCCTGACGCAGCCCAGG + Intergenic
1195881391 X:109596419-109596441 AGACAGGCCTGCTGCAGCCCAGG - Intergenic
1199990901 X:152987395-152987417 GGCTGGGCCTGCAGCCTCCCCGG - Intergenic
1200103552 X:153700320-153700342 AGCGAGGCCTGGCCCAGCCCGGG + Intergenic