ID: 966875664

View in Genome Browser
Species Human (GRCh38)
Location 3:184320326-184320348
Sequence GGCTGCACACCCTGGGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 491
Summary {0: 1, 1: 0, 2: 4, 3: 59, 4: 427}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966875664_966875681 18 Left 966875664 3:184320326-184320348 CCTGGGCCCCAGGGTGTGCAGCC 0: 1
1: 0
2: 4
3: 59
4: 427
Right 966875681 3:184320367-184320389 GGTGGGGTAGGGATGAGGGAGGG 0: 1
1: 0
2: 18
3: 232
4: 1830
966875664_966875677 7 Left 966875664 3:184320326-184320348 CCTGGGCCCCAGGGTGTGCAGCC 0: 1
1: 0
2: 4
3: 59
4: 427
Right 966875677 3:184320356-184320378 TGGGGACTGCTGGTGGGGTAGGG 0: 1
1: 1
2: 6
3: 82
4: 615
966875664_966875679 14 Left 966875664 3:184320326-184320348 CCTGGGCCCCAGGGTGTGCAGCC 0: 1
1: 0
2: 4
3: 59
4: 427
Right 966875679 3:184320363-184320385 TGCTGGTGGGGTAGGGATGAGGG 0: 1
1: 0
2: 6
3: 49
4: 572
966875664_966875680 17 Left 966875664 3:184320326-184320348 CCTGGGCCCCAGGGTGTGCAGCC 0: 1
1: 0
2: 4
3: 59
4: 427
Right 966875680 3:184320366-184320388 TGGTGGGGTAGGGATGAGGGAGG 0: 1
1: 0
2: 3
3: 156
4: 1470
966875664_966875683 22 Left 966875664 3:184320326-184320348 CCTGGGCCCCAGGGTGTGCAGCC 0: 1
1: 0
2: 4
3: 59
4: 427
Right 966875683 3:184320371-184320393 GGGTAGGGATGAGGGAGGGAGGG 0: 1
1: 1
2: 67
3: 768
4: 6129
966875664_966875682 21 Left 966875664 3:184320326-184320348 CCTGGGCCCCAGGGTGTGCAGCC 0: 1
1: 0
2: 4
3: 59
4: 427
Right 966875682 3:184320370-184320392 GGGGTAGGGATGAGGGAGGGAGG 0: 1
1: 0
2: 40
3: 447
4: 3328
966875664_966875675 2 Left 966875664 3:184320326-184320348 CCTGGGCCCCAGGGTGTGCAGCC 0: 1
1: 0
2: 4
3: 59
4: 427
Right 966875675 3:184320351-184320373 TGACTTGGGGACTGCTGGTGGGG 0: 1
1: 0
2: 2
3: 31
4: 209
966875664_966875674 1 Left 966875664 3:184320326-184320348 CCTGGGCCCCAGGGTGTGCAGCC 0: 1
1: 0
2: 4
3: 59
4: 427
Right 966875674 3:184320350-184320372 CTGACTTGGGGACTGCTGGTGGG 0: 1
1: 0
2: 2
3: 26
4: 197
966875664_966875671 -3 Left 966875664 3:184320326-184320348 CCTGGGCCCCAGGGTGTGCAGCC 0: 1
1: 0
2: 4
3: 59
4: 427
Right 966875671 3:184320346-184320368 GCCACTGACTTGGGGACTGCTGG 0: 1
1: 0
2: 0
3: 15
4: 201
966875664_966875676 6 Left 966875664 3:184320326-184320348 CCTGGGCCCCAGGGTGTGCAGCC 0: 1
1: 0
2: 4
3: 59
4: 427
Right 966875676 3:184320355-184320377 TTGGGGACTGCTGGTGGGGTAGG 0: 1
1: 0
2: 0
3: 75
4: 582
966875664_966875678 13 Left 966875664 3:184320326-184320348 CCTGGGCCCCAGGGTGTGCAGCC 0: 1
1: 0
2: 4
3: 59
4: 427
Right 966875678 3:184320362-184320384 CTGCTGGTGGGGTAGGGATGAGG 0: 1
1: 0
2: 1
3: 79
4: 673
966875664_966875673 0 Left 966875664 3:184320326-184320348 CCTGGGCCCCAGGGTGTGCAGCC 0: 1
1: 0
2: 4
3: 59
4: 427
Right 966875673 3:184320349-184320371 ACTGACTTGGGGACTGCTGGTGG 0: 1
1: 0
2: 3
3: 19
4: 194
966875664_966875684 23 Left 966875664 3:184320326-184320348 CCTGGGCCCCAGGGTGTGCAGCC 0: 1
1: 0
2: 4
3: 59
4: 427
Right 966875684 3:184320372-184320394 GGTAGGGATGAGGGAGGGAGGGG 0: 1
1: 0
2: 20
3: 324
4: 2575

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966875664 Original CRISPR GGCTGCACACCCTGGGGCCC AGG (reversed) Intronic
900178628 1:1301870-1301892 CGCTGCACAGCCTGGAGGCCTGG + Intronic
900384559 1:2404144-2404166 GCCTGCGCAGCCCGGGGCCCAGG - Exonic
900422474 1:2561569-2561591 GTCTTCACTGCCTGGGGCCCTGG + Intronic
900503848 1:3019465-3019487 ACCTGCACAACCTGGGGTCCTGG - Intergenic
900592964 1:3468006-3468028 TGCTGCGTACCCTGGGACCCCGG + Intronic
900606505 1:3525946-3525968 GGCTGCACACACAGGTGTCCAGG - Intronic
900931868 1:5742964-5742986 GGCTGCACAGCCAGGGGCGCTGG - Intergenic
900933480 1:5751065-5751087 GGCTCCAGACACTGGGTCCCTGG - Intergenic
900988881 1:6088827-6088849 GGCTGAACTCCCAGAGGCCCAGG - Intronic
900990368 1:6095817-6095839 GGCTGCCCAGCCTGTGGCACAGG + Intronic
901404027 1:9034024-9034046 GGCTCCAGGCCCTGGGGCCAGGG - Intergenic
901929220 1:12586111-12586133 GGCAGGACAGCCCGGGGCCCCGG - Intronic
902173229 1:14629838-14629860 AGCTGCACACCCTGGGGCTAGGG + Intronic
902283370 1:15390480-15390502 GGCAGCAAACCCAGGGGCCGGGG - Intronic
902296436 1:15470228-15470250 GGCTGCACACACTGTGTCCCTGG - Intronic
902299237 1:15489515-15489537 GGCTGCACACACTGTGTCCCTGG - Intronic
902331893 1:15734933-15734955 GTCTGCAGACCCTCAGGCCCTGG + Intergenic
903864498 1:26388471-26388493 GTATGAAAACCCTGGGGCCCTGG - Intergenic
903884107 1:26531112-26531134 GGCAGCACACCCTGGGGGCTGGG - Intronic
904238820 1:29131098-29131120 GGCAGCTCAACCTGTGGCCCCGG - Intergenic
904341311 1:29836829-29836851 GGCTGGAGACTCTGGGGGCCTGG - Intergenic
904813867 1:33181420-33181442 GGCTGCACGCCATGGCGCCAGGG + Exonic
904892188 1:33787810-33787832 AACTGCAAACCCTGGGGCCCAGG - Intronic
906075457 1:43048860-43048882 GGCTGCAGTCACTGTGGCCCCGG - Intergenic
906676079 1:47694473-47694495 GGCTGCAGGGGCTGGGGCCCAGG + Intergenic
907371888 1:54009103-54009125 GTGTGCCCACCCTGCGGCCCTGG - Exonic
907760492 1:57353807-57353829 GGCTGAAGGCCCTGGGGCTCTGG - Intronic
910602228 1:89043929-89043951 CTCTGCACTCCCAGGGGCCCAGG - Intergenic
912798445 1:112706722-112706744 GGCCGCCCACCCTGGGGGCTGGG + Intronic
913307756 1:117450634-117450656 GGCTGCACACAAGGGGACCCTGG - Intronic
914139158 1:144929912-144929934 GGCTACCCATCCTGGGCCCCTGG + Intronic
915486802 1:156227002-156227024 GGCTGCCCACCCTGGACCCCAGG - Intronic
916589184 1:166173992-166174014 GGTTGCACAGCTTGAGGCCCTGG + Intergenic
916673564 1:167046616-167046638 GGCTGTCCACCCTGAGGGCCTGG + Intergenic
918040879 1:180913137-180913159 GGCCGCACTCCCTCCGGCCCCGG + Intronic
918292579 1:183122916-183122938 GGCTCCATACCCTGGGCCTCAGG - Intronic
920033069 1:203048843-203048865 GACTGCACACCCAGAGGCTCAGG + Intronic
920485794 1:206368786-206368808 GGCTACCCATCCTGGGCCCCTGG - Intronic
922452776 1:225750350-225750372 GGCTGCCTACCCGGGAGCCCAGG - Intergenic
922480823 1:225939369-225939391 AGCTGCACACCCTGGACCTCAGG - Exonic
922556402 1:226535781-226535803 GGCGGCCCACTCTGGAGCCCAGG - Intergenic
922572042 1:226640016-226640038 GACTTCCCACTCTGGGGCCCGGG + Intronic
922574082 1:226650885-226650907 GGATGGACACTCTAGGGCCCTGG + Intronic
922780574 1:228249644-228249666 AGCTTCAGACTCTGGGGCCCTGG + Intronic
922801466 1:228366587-228366609 GGCTGCAGAGCCTGGGGCCCAGG - Intronic
924648829 1:245904792-245904814 TGCTGTGCACCCTGGGGCCAGGG - Intronic
1062940389 10:1416600-1416622 GGCTGCACAGGCAGGGGCCCTGG + Intronic
1063449323 10:6140823-6140845 GTCTGTAGCCCCTGGGGCCCTGG + Intergenic
1063639914 10:7818948-7818970 GGATGCACACCCCGGGGACGCGG - Intronic
1064674556 10:17748225-17748247 GGCTGGACACTCTATGGCCCAGG + Intergenic
1065778227 10:29142631-29142653 GGCTCCACCCCCACGGGCCCAGG + Intergenic
1065824346 10:29556290-29556312 GGCTGGACAGCCTGGGGCCAGGG + Intronic
1066362490 10:34744919-34744941 GGGTGCACACCCAGGAGCTCGGG + Intronic
1066659899 10:37728641-37728663 GGCTGCACACCTTGGGGAACAGG - Intergenic
1066962812 10:42236293-42236315 GGCTGCACTCCTTGGGGAACAGG + Intergenic
1067098368 10:43317090-43317112 GGCTGCACTTGCTGGGGCTCTGG - Intergenic
1067381100 10:45774224-45774246 TGCTGCCCACCCTGGGCCCCAGG + Intronic
1067888797 10:50114853-50114875 TGCTGCCCACCCTGGGCCCCAGG + Intronic
1069897944 10:71690415-71690437 TGCTGCTCACCCTGGGCCCCTGG - Intronic
1070150054 10:73799999-73800021 GGATGCACACCCTAGGGGCAGGG - Exonic
1070201284 10:74208179-74208201 CCCTGCACTCTCTGGGGCCCGGG - Intronic
1070787954 10:79173083-79173105 CCCTGGACACCCTGGGGCCTGGG + Intronic
1070810953 10:79297944-79297966 GCCTGCAGAATCTGGGGCCCAGG - Intronic
1070917636 10:80165104-80165126 GGGTCCACTCCCTGGGGCCCCGG + Intronic
1073026505 10:100490735-100490757 GGCTGGATGGCCTGGGGCCCAGG + Exonic
1073037826 10:100576491-100576513 GCTTGGACACACTGGGGCCCAGG - Intergenic
1073179960 10:101577734-101577756 GCCTTCACACCCGGGGGCCCAGG + Intronic
1073207500 10:101776472-101776494 GGCTGCAAACTCTGCGGGCCGGG + Intronic
1073454701 10:103629529-103629551 GGATGCCCACACTGGGGCCAAGG + Intronic
1073475244 10:103748372-103748394 GGTTGCACAGCCCGGGGCTCAGG - Intronic
1074858627 10:117492190-117492212 GGCTGCACCCCCTCTGGCTCTGG - Intergenic
1075520024 10:123137617-123137639 GGCTGCAGCCGCGGGGGCCCCGG + Exonic
1076342618 10:129760017-129760039 GGCTGCATAGCCTGGGAGCCTGG - Intronic
1076697897 10:132255933-132255955 CTCTGCACACCCTGGAGCCCTGG + Intronic
1077320142 11:1937352-1937374 GGCGGGATACCCTGGGGCCCAGG - Intronic
1077360847 11:2139556-2139578 GGCTGGGGGCCCTGGGGCCCCGG + Intronic
1077444417 11:2583693-2583715 ACCTGCCCTCCCTGGGGCCCTGG + Intronic
1077488566 11:2850190-2850212 GGCCGCCCACCCCGGGACCCTGG + Intergenic
1077501448 11:2911409-2911431 GACGGCTCACCCTGGGGCCAGGG + Intronic
1078196896 11:9143994-9144016 AGCTGCACAGGCTGGGACCCAGG + Intronic
1078457237 11:11484824-11484846 GGCTCCACTCCTTGGGGACCTGG - Intronic
1079363011 11:19785268-19785290 GGCTGCAGGCCATGAGGCCCTGG - Intronic
1080645706 11:34186186-34186208 GGGTGCACCCCCTGAGGCACTGG - Intronic
1081716318 11:45252843-45252865 GGCTGACCACCCTGGGCACCAGG + Intronic
1083183574 11:61004452-61004474 GGCTGCCCAGCCTGAGCCCCTGG - Intronic
1083327521 11:61880322-61880344 AGCAGGACAACCTGGGGCCCTGG - Intronic
1083886946 11:65577566-65577588 GGCTGCTTAGCCTGGAGCCCAGG + Intronic
1084083407 11:66843539-66843561 AGCAGCACAGCCCGGGGCCCAGG - Exonic
1084117110 11:67048940-67048962 AGGAGCAGACCCTGGGGCCCTGG - Exonic
1084556595 11:69879573-69879595 GGCGGCACAGCCTGGGGTCCTGG - Intergenic
1084652384 11:70496755-70496777 GGCTGCCCAGCCCTGGGCCCTGG + Intronic
1086322499 11:85664941-85664963 GGCTACCCGCCCTGGGGCCTGGG - Exonic
1086566341 11:88231063-88231085 CTCTGCCCACCCTGGGTCCCAGG - Intergenic
1088585048 11:111354409-111354431 AGCTGGACAAACTGGGGCCCAGG + Exonic
1088716625 11:112554802-112554824 GGGGACACACCCTGTGGCCCGGG - Intergenic
1089108564 11:116036053-116036075 GGTGGCTCACCCTGGGGCCAGGG + Intergenic
1089494112 11:118899881-118899903 AGCTGGCCTCCCTGGGGCCCTGG + Intronic
1089497742 11:118916276-118916298 GGCCTCAGACCCAGGGGCCCTGG + Intronic
1089605015 11:119636653-119636675 GGCTTCACACCCTGGGACCCTGG - Intronic
1091360792 11:134977337-134977359 GGCTGAATTCCCTGGGGTCCTGG - Intergenic
1091750432 12:3018664-3018686 CCCAGCACACCCTGGGGCCCAGG - Intronic
1092001120 12:5033088-5033110 TGATGCATTCCCTGGGGCCCTGG + Intergenic
1092247486 12:6871764-6871786 GGATGGAGACACTGGGGCCCTGG - Intronic
1097450809 12:59734455-59734477 CCCTGCACTCTCTGGGGCCCAGG - Intronic
1101023144 12:100573664-100573686 GGCTACTGACCCTGAGGCCCAGG + Intronic
1102612949 12:114128681-114128703 GTCTGCTCAACCTGGTGCCCAGG - Intergenic
1103556134 12:121767694-121767716 ATCTGCACACCCCGGGGCTCTGG - Intronic
1103586822 12:121962377-121962399 GGACACAGACCCTGGGGCCCTGG + Intronic
1103888815 12:124223126-124223148 GGCAGCCCACCCTGTGGGCCAGG - Intronic
1103963963 12:124626388-124626410 GGCCCCACCCCCAGGGGCCCAGG + Intergenic
1108360716 13:49666038-49666060 AGTTGCACACACTGTGGCCCGGG + Intronic
1109335635 13:60990575-60990597 GACAGCAGACCCTGGGGCCTGGG - Intergenic
1109416380 13:62046486-62046508 GGCAGCTCAGCCTGTGGCCCTGG - Intergenic
1111543172 13:89695519-89695541 GACTGCAGAGCCTGGAGCCCAGG - Intergenic
1112077677 13:95931391-95931413 GGCAGCTCCCCCTGCGGCCCAGG - Intronic
1113850874 13:113417266-113417288 GGCTGCACGACCTGGGGCCCTGG - Intergenic
1114551233 14:23534008-23534030 GGCTGGACAGGCTGAGGCCCTGG + Exonic
1118612810 14:67554631-67554653 GGCAGCACACGGTGGTGCCCTGG + Intronic
1119484620 14:74979545-74979567 GGCAGCGGAGCCTGGGGCCCTGG + Intergenic
1120914766 14:89701581-89701603 GGCAGCCCACTCTGGGCCCCTGG + Intergenic
1121507141 14:94485964-94485986 GGCTGCGCACCCTGGGCTCCTGG + Intergenic
1121585565 14:95060783-95060805 GTCTTCAAACCCTGGGGCCCTGG - Intergenic
1122092884 14:99351766-99351788 CTCTTCACACCCTGGGCCCCTGG + Intergenic
1122180541 14:99951144-99951166 GGCAGCACATCCTAGGGGCCGGG + Intergenic
1122400520 14:101464779-101464801 GGCTCAGCACCCTGGGGCTCTGG - Intergenic
1122770110 14:104094040-104094062 GCCTGCCCAGCCTGGGGCCTGGG + Intronic
1123012566 14:105356448-105356470 GGCTGCACTTCCCAGGGCCCTGG + Intronic
1123422751 15:20145177-20145199 GGCTGCACTCCTTGGGGAGCAGG + Intergenic
1123531975 15:21151717-21151739 GGCTGCACTCCTTGGGGAGCAGG + Intergenic
1124215595 15:27805434-27805456 GGCTGCACACCGCGGGGACCCGG + Intronic
1128513856 15:68329842-68329864 GGCTGCACACGCACAGGCCCTGG + Intronic
1129107178 15:73318506-73318528 GGCTGCACACCCAGGTGCCGGGG - Intergenic
1129219125 15:74121241-74121263 GGTTGGACACAGTGGGGCCCTGG + Intronic
1129255573 15:74332198-74332220 GGCTGGGCACACAGGGGCCCTGG - Intronic
1129466718 15:75728260-75728282 GGCTGCCCACAATGTGGCCCCGG - Intergenic
1129876222 15:78977355-78977377 GGCTGAATCCCCTGGGGCCAGGG + Intronic
1130953730 15:88612235-88612257 GACTCCACATCCTGGGGCTCAGG + Intergenic
1132505716 16:307644-307666 GGCTGCACCCACGGAGGCCCAGG - Intronic
1132558823 16:584340-584362 GGCCGCCCACCCTGGGGTCGTGG + Intergenic
1132687865 16:1169794-1169816 CCCTGCTCACCCTGGGGCCAGGG - Intronic
1132703587 16:1231822-1231844 GGCTGCACCCCCCGGGGGACAGG + Intergenic
1132704922 16:1239539-1239561 GGCTGCACCCCCCGGGGGACAGG - Intergenic
1132707931 16:1254573-1254595 GGCTGCACCCCCCGGGGGACAGG - Intergenic
1132736312 16:1387825-1387847 GGCAGCCCACCCTGTGTCCCGGG + Intronic
1132768387 16:1546738-1546760 GACAGCAGACCCTGAGGCCCGGG - Intronic
1132878088 16:2149067-2149089 GGCTCCGCGCCCTGGGGCCGCGG - Intronic
1132886829 16:2185842-2185864 GGCTTCACAGCCTGGGCCCCTGG + Intronic
1132912382 16:2321152-2321174 GGCTGCTGAGACTGGGGCCCAGG - Intronic
1132977994 16:2720042-2720064 CGCTGCACTGCCTGGGGCTCCGG - Intronic
1132981628 16:2741200-2741222 GGCTGCAGACCCTGAGGCAGGGG - Intergenic
1132994977 16:2818100-2818122 TGCAGCACAGCCTGGGGCTCAGG - Intronic
1133029598 16:3004181-3004203 GGCGGCGCGCTCTGGGGCCCTGG + Intergenic
1134685401 16:16154891-16154913 GGCTGCACACACTGCGCTCCAGG - Exonic
1136025501 16:27465678-27465700 GGGTGGACACACTGGGCCCCTGG + Intronic
1136059915 16:27719263-27719285 GGCTGCACACTCTTGGCTCCAGG + Intronic
1136296251 16:29305045-29305067 GGATGCACAGCCTGTGCCCCAGG + Intergenic
1136402531 16:30026421-30026443 GCCCCCACACCCTGGTGCCCTGG + Intronic
1136568743 16:31084647-31084669 GGCTGCAGGCCCTAGGCCCCAGG + Exonic
1136612119 16:31372539-31372561 GGGTGCACAGCGTGGGGCCTGGG + Intronic
1137505838 16:49052992-49053014 GGCTGGACACCCTCGGGGCAAGG - Intergenic
1138581884 16:57946778-57946800 GGCCTCACACCCTCTGGCCCTGG + Intronic
1139371085 16:66469872-66469894 CGCCGCCCACCCTGGGGCCCTGG + Exonic
1139432627 16:66919185-66919207 GGCTGCAGACACTGGAGCCTGGG - Intergenic
1139691645 16:68645517-68645539 GGCTGCGCTCCCTGGGGCCAAGG + Intronic
1140097230 16:71884774-71884796 GGCTGCAGACCCAGGGGCAGGGG + Intronic
1140223005 16:73057934-73057956 GGCTGCTCAGCCCGGGGCCCCGG + Intronic
1140453173 16:75087901-75087923 AGCGGCACACCCTGGAGGCCAGG - Intronic
1141506149 16:84479981-84480003 GGATGCGGACCCTGAGGCCCAGG - Exonic
1142148978 16:88504446-88504468 GGCTAAACACCCTGGGTCCTGGG - Intronic
1142375717 16:89706208-89706230 GCCTGCACACTGTGGGGGCCGGG - Intergenic
1142505449 17:360657-360679 GGCTGGAAACCGTGGGGCGCTGG + Intronic
1142753650 17:2002903-2002925 GGCTGCACAGGCTGGGTCCGAGG + Intronic
1142905150 17:3036393-3036415 GGCTGCGTTTCCTGGGGCCCTGG + Exonic
1142990078 17:3724376-3724398 GGCCGCACACGCTGAGGTCCGGG - Exonic
1143118059 17:4591715-4591737 GGCAGCACAGCCTGGATCCCAGG + Intronic
1143470769 17:7173903-7173925 GCCTTCGCGCCCTGGGGCCCTGG - Intronic
1143493148 17:7295127-7295149 CCCTGCACACCCTGGGGCTGCGG + Intergenic
1143781426 17:9231552-9231574 GGCTCCACACCAGGGTGCCCTGG + Intronic
1143783259 17:9240306-9240328 GGCAGCCTGCCCTGGGGCCCGGG + Exonic
1143848153 17:9788696-9788718 CGCTGCACACCCTGGTGCCACGG - Intronic
1143931969 17:10438506-10438528 GGCTGCACACAGCAGGGCCCTGG + Intergenic
1144764445 17:17725031-17725053 GGCTGCTGACCCTGGGCCTCGGG + Intronic
1146616672 17:34362276-34362298 GACCCCACACCCTGGGGACCTGG + Intronic
1146662666 17:34674971-34674993 CCCTGCTCACCCTGGGGACCTGG - Intergenic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1146944134 17:36862665-36862687 GGCTGCATCTGCTGGGGCCCAGG + Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147358934 17:39919145-39919167 TGGTGCACACCGTGGCGCCCTGG + Intronic
1147456693 17:40542445-40542467 GCCCGCCCTCCCTGGGGCCCAGG + Intergenic
1147924590 17:43938699-43938721 GGCTGTCCTACCTGGGGCCCCGG - Exonic
1147976920 17:44253176-44253198 GGCTGCAGCCCCTGGGGTGCTGG + Exonic
1148115600 17:45172858-45172880 GGCAGCACCCCCTGGGGCCTGGG - Intergenic
1148219546 17:45851829-45851851 GGCTGGGCCACCTGGGGCCCTGG - Intergenic
1148861805 17:50608368-50608390 TGCTGCCCACCCTGGGCCTCTGG - Intronic
1148871088 17:50659137-50659159 TTCTGGAGACCCTGGGGCCCTGG + Intronic
1149654467 17:58302942-58302964 GGCTCCACACCCTGAAGGCCTGG - Intronic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150812410 17:68367272-68367294 GGCGGCAGACCCTGGGAGCCAGG + Intronic
1151188621 17:72381799-72381821 ACCTGCAGACCCTGGAGCCCAGG - Intergenic
1151457002 17:74232354-74232376 GGCTACAAAACCAGGGGCCCTGG + Intronic
1151473623 17:74332796-74332818 GGCTATACAGCCTGGGACCCAGG + Intronic
1151818014 17:76481102-76481124 TGCTGGTAACCCTGGGGCCCTGG - Intronic
1152225846 17:79092278-79092300 GTGTGCACACCGTGGGGTCCAGG - Intronic
1152251378 17:79214477-79214499 TGCTGCCCACCCTGGCACCCAGG + Intronic
1152325517 17:79633629-79633651 TGCTCCACACCCTGAGGGCCTGG + Intergenic
1152352597 17:79791845-79791867 GGCTGCACTTCTTCGGGCCCCGG - Intergenic
1152464499 17:80458210-80458232 GCCTGGACACCCCGGAGCCCTGG + Intergenic
1152617016 17:81342726-81342748 GGCCGCAGACCCTGGGCGCCCGG + Intergenic
1152661241 17:81543235-81543257 GGCTGCAGGCCCTGGGTCTCAGG + Intronic
1152893863 17:82898412-82898434 TGCTGCAGACCCTGGGGCTTGGG + Intronic
1153868787 18:9297343-9297365 GGCTGCTCCGCCTGTGGCCCTGG + Intergenic
1153979283 18:10295559-10295581 GCCTGCACAGCCTGGGGACCAGG - Intergenic
1155203850 18:23540154-23540176 GGAGGAGCACCCTGGGGCCCTGG - Intronic
1155407237 18:25502202-25502224 GGCTGCTCACACTGGGACCCTGG + Intergenic
1157273533 18:46294387-46294409 GCCTGCACACCTTGGGGATCAGG - Intergenic
1157485028 18:48080731-48080753 GGCTGCACACAGTGAGGCCTGGG + Intronic
1157580892 18:48773610-48773632 GCCTGCTCACCCAGGGGCTCTGG - Intronic
1157743586 18:50115176-50115198 GGCTGCCCACCTTGGGGATCAGG - Intronic
1159651705 18:70986148-70986170 GGCTGCACAGAATGGGGTCCTGG - Intergenic
1160221440 18:76980699-76980721 GGCACCACTCCCTGGGGCCTGGG - Intronic
1160581059 18:79884764-79884786 GGGGGCTCATCCTGGGGCCCAGG + Intronic
1160624708 18:80195372-80195394 GGCTGCCCACCCTGGGAACAGGG - Intronic
1160802016 19:974587-974609 TGCTGCAGACCCTGGTGCACGGG - Exonic
1161054074 19:2181173-2181195 TGCTGCAGATCCTGGAGCCCAGG - Intronic
1161393623 19:4033587-4033609 GGCCGCCCTCCCCGGGGCCCCGG - Intronic
1161404674 19:4084681-4084703 GGCAGCCCTCCCTGGGGCCAGGG - Intergenic
1162033767 19:7928235-7928257 GCCCACACACCCTGGCGCCCAGG + Intronic
1162046693 19:8005203-8005225 GGCTGCACGGCCGGGGGCCCCGG - Intronic
1162086730 19:8253922-8253944 GGCCTCATCCCCTGGGGCCCTGG - Intronic
1162967415 19:14162519-14162541 GGCTCCCCACTCTGGGACCCAGG + Intronic
1163366450 19:16878441-16878463 GGCTGGACCCCCAGGGCCCCAGG - Intronic
1163446116 19:17347467-17347489 GCCTGCCTTCCCTGGGGCCCTGG + Intergenic
1163655175 19:18541754-18541776 GGCTGAGCAGCCTGGGGCCCTGG - Exonic
1163687345 19:18719328-18719350 TGCTGCAGGCCCTGGGGACCCGG - Intronic
1164727102 19:30473358-30473380 GGTTGCATACTCTGGGGCCATGG - Intronic
1165149284 19:33751497-33751519 GGCTGCCCACACTGGGTCCCTGG - Intronic
1165173091 19:33906880-33906902 AGCCGCTCACCCTGGGCCCCGGG - Intergenic
1165354997 19:35299171-35299193 GGCTACAAACCCTGTGGCTCTGG - Intronic
1165706833 19:37982361-37982383 GGCTGCGTCCCCTGGGGCCAGGG + Intronic
1166043178 19:40215191-40215213 GGCTGCACGCTGGGGGGCCCAGG - Exonic
1166046262 19:40232835-40232857 GGCTGCAGAACGTGGGGCCCTGG + Exonic
1167593630 19:50416829-50416851 GGCCACCCACCCAGGGGCCCTGG - Intronic
925000552 2:400246-400268 TGTTCCATACCCTGGGGCCCTGG - Intergenic
925326519 2:3026316-3026338 GCCTGAACACCCTGGAGTCCTGG + Intergenic
925408777 2:3626875-3626897 ATCTGCGCCCCCTGGGGCCCGGG - Intronic
925985832 2:9213934-9213956 AGCTGCATAGACTGGGGCCCAGG + Intronic
926207722 2:10845939-10845961 CCCTGCACACCCTGGGAGCCAGG + Intergenic
926293165 2:11546969-11546991 GGCTTCTCACCCTGTTGCCCAGG + Intronic
926370722 2:12176240-12176262 GGGTGCACACTCTGGGATCCTGG + Intergenic
927682931 2:25151999-25152021 TGCTGCACACTGCGGGGCCCGGG + Exonic
927714201 2:25341854-25341876 GGCTGCGCGCCCTGGTGCCGCGG + Intronic
928174095 2:29022598-29022620 GATTCCACACCATGGGGCCCAGG + Intronic
929423606 2:41820480-41820502 GGCTACACATCCTGGGCCACTGG + Intergenic
932398358 2:71463369-71463391 CCCTGCACTCTCTGGGGCCCAGG - Intronic
932492092 2:72128661-72128683 GGCTACACATCCTGGGGCTCAGG + Intergenic
933648703 2:84831978-84832000 AGCAGCCCACCCTGGTGCCCAGG + Intronic
933759110 2:85662056-85662078 AGCTGCTGACCCTGGTGCCCAGG - Exonic
933769377 2:85733594-85733616 TCCTGCCCACCCTGGGGCCTTGG + Intergenic
933910654 2:86938381-86938403 GTCTGCTCACACTGGGGCCATGG - Intronic
933970704 2:87467812-87467834 GGCTGGACTCCCTGAGGCCATGG - Intergenic
934022074 2:87965021-87965043 GTCTGCTCACACTGGGGCCATGG + Intergenic
935400105 2:102651324-102651346 GCCTGCAGAGCCTGTGGCCCTGG - Intronic
935426770 2:102927770-102927792 GGCTGTCCATCCTGGGGACCTGG - Intergenic
935734684 2:106097269-106097291 GGCTGCACATCTTGGGTCTCAGG - Intronic
936024614 2:109021727-109021749 CCCTCCACACCCTGTGGCCCTGG - Intergenic
936111768 2:109670879-109670901 GGCTGCACTCCTTGGGGAGCAGG - Intergenic
936286947 2:111188172-111188194 GGCTGCACACTCTGCCTCCCGGG - Intergenic
936323024 2:111482370-111482392 GGCTGGACTCCCTGAGGCCATGG + Intergenic
936414609 2:112293608-112293630 GTCTGCTCACACTGGGGCCATGG - Intronic
937362529 2:121239000-121239022 GGCTGCACAGCACGGGGCCATGG - Intronic
937912402 2:127081943-127081965 GGATGCACACCCTCGTGCCCCGG + Intronic
938169866 2:129065686-129065708 GGCTGCCCACTCTGTGGCCTGGG - Intergenic
938287126 2:130128085-130128107 GGCTGCACTCCTTGGGGAGCAGG + Intronic
938364892 2:130726936-130726958 GGCTGCACTCCCTAGGGCCCCGG + Intergenic
938377139 2:130815418-130815440 AGCGGCACTCCCTGGGGCCGGGG + Intergenic
938428467 2:131210785-131210807 GGCTGCACTCCTTGGGGAGCAGG - Intronic
938469369 2:131544803-131544825 GGCTGCACTCCTTGGGGAGCAGG - Intergenic
939021522 2:136963373-136963395 GGCTGAATACCCTGGGTGCCAGG + Intronic
941177546 2:162217188-162217210 GGCTGGACACAGTGGGTCCCTGG - Intronic
941329623 2:164164138-164164160 GGCTGAAAACACTGGGGCCCTGG + Intergenic
945330246 2:208530490-208530512 GGCTGCACACTCTGTGGAGCCGG - Intronic
946401844 2:219472390-219472412 GGCAGGACACCATGGGGGCCAGG + Intronic
946690576 2:222305871-222305893 GGCCGCACTCCCTGGGGCTCAGG - Intergenic
947633849 2:231670336-231670358 GCCTGGAAGCCCTGGGGCCCAGG - Intergenic
947758559 2:232587142-232587164 GGCAGCTCCCCCTGGGGCTCTGG + Intergenic
948827141 2:240578265-240578287 GACAGCACAGCCTGGGCCCCCGG - Exonic
948856985 2:240734861-240734883 GGCTGCAAAGCGTGGGGCCTGGG + Intronic
948894802 2:240923094-240923116 GGCTGCTCACCATGGGGGACGGG + Intronic
948908437 2:240991138-240991160 GGCTGCACGGCCAGGGCCCCAGG - Intronic
1169074561 20:2752736-2752758 GGCTGCACATCCCGGGGTCCTGG + Intronic
1170570726 20:17630917-17630939 GGCTGCACAACCTGGAGCTGGGG + Intronic
1171119877 20:22558984-22559006 GGCGGCACTTCCTGGGGCTCCGG - Intergenic
1172095209 20:32457086-32457108 GGCTGCCCACCCTGAGACGCCGG - Intronic
1172293947 20:33794926-33794948 GGTGGCAGACCCTGGGGTCCTGG - Intergenic
1172684793 20:36745757-36745779 GGCTCAACACCCTGGGTCACAGG - Intronic
1172779996 20:37430955-37430977 GCCTTCACATCTTGGGGCCCCGG + Intergenic
1172938895 20:38641142-38641164 GGCTGAGCACCCTGGGCGCCAGG - Intronic
1174035355 20:47665400-47665422 GCCTGCACTCCCCGGGCCCCAGG + Intronic
1174174400 20:48635888-48635910 GAATGCACAACCTGGGGCCCAGG - Intronic
1174348883 20:49952557-49952579 GTCTGCACACCTTGGGGACAAGG - Exonic
1174768266 20:53273849-53273871 AGCTTCACACTGTGGGGCCCCGG + Intronic
1174776294 20:53345892-53345914 GGCAGCAGCCCCTGGGGCCATGG + Intronic
1175252247 20:57616683-57616705 GGCTGCGCAGCCTGGTGGCCAGG + Intronic
1175465938 20:59191400-59191422 GGCTGCCCAGCGTGGGGCCCAGG - Exonic
1175516309 20:59572329-59572351 GGCTGCACCCCGGGGGCCCCAGG - Intergenic
1175924759 20:62466249-62466271 GGCACCACCCCCGGGGGCCCGGG - Intronic
1176054337 20:63135754-63135776 AGCTGCCCACCCTCTGGCCCTGG + Intergenic
1176159389 20:63640837-63640859 GGCTGCACACGCAGGCTCCCAGG + Exonic
1179898869 21:44378610-44378632 TCCAGCACACCCTGGAGCCCAGG + Intronic
1179998836 21:44986098-44986120 GGCAGCTCAGCCAGGGGCCCAGG + Intergenic
1180179199 21:46110518-46110540 ACCTGCTCAGCCTGGGGCCCAGG - Intronic
1180699315 22:17773160-17773182 GGACGCACACCCTGGGCCGCAGG + Intronic
1180835407 22:18927114-18927136 GGCTGCAGCCTCAGGGGCCCTGG - Intronic
1180840927 22:18958483-18958505 GGCGGCACCCACTGGGGCTCGGG - Intergenic
1180877585 22:19181909-19181931 GGCTGCACAGCCTTGGCCCAGGG - Intronic
1181050187 22:20234651-20234673 GGCTTCAGAGGCTGGGGCCCTGG + Intergenic
1181060562 22:20280291-20280313 GGCAGCACCCACTGGGGCTCGGG + Intronic
1181267987 22:21642303-21642325 GGCTCCAGCCCCTCGGGCCCAGG - Exonic
1181491358 22:23262660-23262682 GGCCCCACACCCAGCGGCCCTGG - Intronic
1181590578 22:23882662-23882684 CGCCGCACACCCTGGGCCCCGGG + Intronic
1181768848 22:25111501-25111523 GGCTGCTCAGCCAGGGGACCCGG + Intronic
1182093828 22:27613298-27613320 GGCTGCACCCCCTCTGCCCCAGG - Intergenic
1183301445 22:37060993-37061015 AGCTGCAGAACCGGGGGCCCCGG + Intronic
1183343824 22:37296084-37296106 GCCCCCACACCCTGTGGCCCGGG - Intronic
1183517117 22:38272994-38273016 GGCTGCACTCCACTGGGCCCGGG - Exonic
1183743531 22:39680857-39680879 GGCTGCACGCCCCAGGACCCAGG + Intronic
1183978392 22:41526165-41526187 GGCAGCAGGCCCCGGGGCCCAGG - Exonic
1184247531 22:43243250-43243272 GTCTGCACCCGCTGGTGCCCTGG + Intronic
1184602466 22:45551782-45551804 GGCTGCACAGCCTGCAGCCAAGG - Intronic
1184772841 22:46607937-46607959 GGCTGCCCCCCCAGGGGCCGTGG + Intronic
1184800007 22:46753318-46753340 GGCTGCCCACCCAGGTGTCCTGG - Intergenic
1184850991 22:47120548-47120570 GGCTGCTTACACTGGGGACCTGG - Intronic
1184983670 22:48114699-48114721 GGCTCCACAGCCTGTGGCCTTGG + Intergenic
1185047802 22:48537691-48537713 TGCAGCTCTCCCTGGGGCCCTGG + Intronic
1185087146 22:48746997-48747019 GGCTCAACGCCCTGGAGCCCAGG + Intronic
1185126280 22:49012495-49012517 GGCTGCAGACCCAGAGGCACTGG - Intergenic
1185173075 22:49304709-49304731 GGCTGCACTGCCTGGGCCTCGGG - Intergenic
1185281282 22:49971173-49971195 GGCTGGACCGTCTGGGGCCCCGG + Intergenic
1203285495 22_KI270734v1_random:152413-152435 GGCTGCAGCCTCAGGGGCCCTGG - Intergenic
950226973 3:11243583-11243605 GGAAGCACACGCTGGGGCCAAGG - Intronic
950487148 3:13280624-13280646 CACTGCTCACCCTGGGGTCCGGG + Intergenic
950563041 3:13746857-13746879 AGCTGTCCAGCCTGGGGCCCTGG + Intergenic
951558666 3:23945416-23945438 CGCTGCACGGCCTGGGGCCCGGG + Exonic
953135277 3:40176616-40176638 GGCTGGGCACCCAGGTGCCCAGG + Intronic
955220499 3:57019348-57019370 GGGTGCACACACTTGGGTCCAGG - Intronic
957730152 3:84124762-84124784 CTCTGCACTCTCTGGGGCCCAGG + Intergenic
961455709 3:127022952-127022974 GGCTGCATGCCCAGGGGCCTTGG - Intronic
961504179 3:127359340-127359362 GAATTCACACCCTGAGGCCCAGG + Intergenic
961509176 3:127390768-127390790 GGCTGCATACCGTGGGCCCAGGG + Intergenic
961793138 3:129390825-129390847 GCCTGAACACCCTGGGTCTCAGG - Intergenic
961807019 3:129496729-129496751 GCCTGAACACCCTGGGTCTCAGG - Intronic
963069726 3:141292943-141292965 GGCTGCAAACCTTGGGAACCTGG - Exonic
965818322 3:172659543-172659565 GGCTGCACAGCTAGGGGACCGGG - Intronic
966875664 3:184320326-184320348 GGCTGCACACCCTGGGGCCCAGG - Intronic
967316189 3:188154031-188154053 GGCTGCACGGCCCGGGGCGCGGG + Intronic
968605151 4:1531934-1531956 GGCTGCACCTACCGGGGCCCAGG + Intergenic
968654055 4:1771100-1771122 AGCTGCAGAGCCTGGAGCCCTGG - Intergenic
968745307 4:2356791-2356813 TGCAGCACTCCCTGGGGCTCGGG - Intronic
968760985 4:2442740-2442762 GGCAGCCCACCCAGGGACCCCGG + Intronic
969300587 4:6294796-6294818 GACAGCACACCCAGGGGCCGGGG + Intronic
969575180 4:8032525-8032547 GGCTCTTCACCATGGGGCCCGGG - Intronic
969681288 4:8644844-8644866 GGCAGCACCCCCGGAGGCCCCGG + Intergenic
969704468 4:8784389-8784411 GGCTGCACACAGAGGAGCCCGGG + Intergenic
970697194 4:18691935-18691957 GGCTGGAAACCATGGGGGCCTGG + Intergenic
977592766 4:98844853-98844875 GGCTGCACACCCAGGAGGTCAGG - Intergenic
980633971 4:135474074-135474096 GCCTGCACCACCGGGGGCCCTGG - Intergenic
982043548 4:151419061-151419083 ACCTGGACACCCTGTGGCCCAGG - Intronic
983494506 4:168428004-168428026 AGGTGCACAGCCTGGGCCCCAGG + Intronic
984778792 4:183505679-183505701 TGCCGCAGACCCTGCGGCCCCGG + Intronic
984812514 4:183807478-183807500 GGCTGCAAACCCTGGCGGCTCGG - Intergenic
985149673 4:186933791-186933813 GGCTGCATGCCCAGGGGCTCTGG + Intergenic
985477369 5:85719-85741 GTGTCCACACCCTGGGGCCCTGG + Intergenic
985706181 5:1402726-1402748 GGACGCACACCCATGGGCCCGGG + Intronic
985842420 5:2318165-2318187 GGCTGGAAAACCTGGGACCCAGG - Intergenic
985889105 5:2701850-2701872 TGCTGCCCACCCTGAGGCCGTGG - Intergenic
989675292 5:43966044-43966066 TGCTGAAAACCCAGGGGCCCTGG + Intergenic
990008589 5:50969443-50969465 GGCTTCCCGCCCAGGGGCCCAGG + Intergenic
990960170 5:61385762-61385784 TTATGCACACCCTGGGGCACAGG - Intronic
991999141 5:72418106-72418128 GGCTGCACATCCTGCCTCCCTGG - Intergenic
992357831 5:76003809-76003831 AGCTCCACACCCTATGGCCCTGG - Intergenic
992530216 5:77645658-77645680 CGCTGCGCCCCCTGGGGGCCGGG - Intergenic
993723215 5:91342026-91342048 GGCATCTCACCCTGGTGCCCAGG - Intergenic
999715483 5:154356697-154356719 CCCTGTACACCCTGGAGCCCTGG - Intronic
999726950 5:154445747-154445769 GGCTGCAGACTCTCCGGCCCGGG - Intergenic
999768247 5:154756268-154756290 GGTAGCAGACCCCGGGGCCCTGG - Intronic
1002043132 5:176528663-176528685 GTCTGCCCATCCTGGGGCCAAGG + Exonic
1002044180 5:176532849-176532871 GGCTGAACACCATTGGTCCCTGG - Intronic
1002304466 5:178275054-178275076 GGCTGCCCATCCGGGGTCCCAGG - Intronic
1002460760 5:179372486-179372508 GGCTGCCAGCCCTGGGCCCCGGG + Intergenic
1002928789 6:1619831-1619853 AGCTGCACAGCCCGAGGCCCGGG - Intergenic
1004054557 6:12122451-12122473 GGATGCCCACTCTGGGGCACAGG - Exonic
1004360082 6:14963211-14963233 GGCTGGACATCCTGGGCGCCAGG + Intergenic
1004538190 6:16523272-16523294 AGCTGGAAACCCTGAGGCCCAGG + Intronic
1005021526 6:21423535-21423557 GCCTGCACACTCAGGGGCCCGGG - Intergenic
1005765309 6:29005460-29005482 GCCTGCAACCCCAGGGGCCCGGG + Intergenic
1005955474 6:30660426-30660448 GGTTGCAGATCATGGGGCCCTGG - Intronic
1006377416 6:33679248-33679270 TGCGCCACACACTGGGGCCCTGG - Intronic
1006644408 6:35506080-35506102 GGCAGCGCACCGTGCGGCCCTGG + Exonic
1006941784 6:37756428-37756450 GGCTGCAGGGCCTGGGGCTCGGG + Intergenic
1008569991 6:52807074-52807096 GGCTGCACACTGTAGGGCCTGGG - Intergenic
1009935961 6:70234837-70234859 CCCTGCACACCCCGGGGTCCAGG + Exonic
1010489234 6:76453510-76453532 TCCCGCACTCCCTGGGGCCCGGG - Intergenic
1011093938 6:83637468-83637490 GGCTGGAAACCCTGGGCCACAGG - Intronic
1018214988 6:161518177-161518199 GACTCCACACCATGGGGCCGGGG + Intronic
1018330971 6:162727466-162727488 GAACGCACACACTGGGGCCCCGG + Intronic
1018663847 6:166114730-166114752 GGCTGCACTCCTAGGGGCTCAGG + Intergenic
1018670446 6:166172572-166172594 GGCTGCACTCTCAGGGGCCCTGG + Intergenic
1018846457 6:167560179-167560201 GGCTGCACACGATGGGACCCAGG - Intergenic
1019342849 7:516773-516795 TGCGGCTCACCCTCGGGCCCTGG - Intronic
1019368149 7:645815-645837 GCCTGTACTCCCTGGGGCTCAGG - Intronic
1019489876 7:1307341-1307363 GGCTGCTCAGGCTGGGGACCTGG - Intergenic
1022507991 7:30918643-30918665 GCCTGGGCACCCTGGTGCCCTGG - Intronic
1023041133 7:36174110-36174132 GGCTGCACAGGCTGTGGCACTGG + Intronic
1024130258 7:46344920-46344942 GGCTGCACACCCAGAGGCAGGGG - Intergenic
1024919737 7:54544828-54544850 GGCCGGACACCCTGAGGACCGGG - Intronic
1026911510 7:74094145-74094167 GGATGCCCAGCCTGGGGCCGCGG + Intronic
1029349680 7:100004243-100004265 GGCTGCCTTCCCAGGGGCCCTGG - Intergenic
1032062913 7:128739588-128739610 GGCTGCACACAGAGGGTCCCGGG - Intronic
1032075820 7:128835662-128835684 GAATGCACACCCTGGGGCCTGGG + Intronic
1032607718 7:133374879-133374901 CGCTGCACACTCTGTGGTCCTGG + Exonic
1033256154 7:139803659-139803681 GGCTGCACACAGTGGGGGCCTGG - Intronic
1033313836 7:140281940-140281962 GGCTGCACACACTGGAGTACTGG - Intergenic
1034475590 7:151279776-151279798 GGCTTCACTCCCTTGGGCCGAGG + Intergenic
1034872448 7:154696238-154696260 TACTCCACACCCAGGGGCCCGGG - Intronic
1035192236 7:157180952-157180974 TGCTGCTCCACCTGGGGCCCCGG - Intronic
1036914725 8:12793866-12793888 GGCTGCACAGCGTGAGGCTCTGG + Intergenic
1037493966 8:19421295-19421317 GGCTTCACTGCCTGGGGCCTGGG - Intronic
1038022711 8:23563571-23563593 GGCTACCCTCCCTGGGACCCTGG + Intronic
1039560701 8:38510375-38510397 TGCTCCACACCCTGAGCCCCTGG - Intergenic
1039822630 8:41147138-41147160 AGCTGCAGACCCTGGGCCCCGGG - Intergenic
1040000943 8:42575613-42575635 GGCAGCTCTCCCTGTGGCCCTGG + Intergenic
1042151515 8:65790928-65790950 GGCTGTGCAGCCTGGGCCCCTGG + Intronic
1043087294 8:75850056-75850078 GGCTGCACACTCTGTGGCACAGG - Intergenic
1045179964 8:99770328-99770350 GGATGCACCCTCTGGAGCCCTGG + Intronic
1047645368 8:126864410-126864432 GGGTGCACACCAGGGAGCCCTGG - Intergenic
1048186822 8:132249611-132249633 GGCAGCTCAGCCTGTGGCCCCGG - Intronic
1048980524 8:139701566-139701588 GGCTTCACACCCCTGTGCCCTGG - Intronic
1049109931 8:140636000-140636022 GGCGGCACAGCCGGGGGGCCCGG - Intergenic
1049273511 8:141708301-141708323 GGCTGCACTGCATGGGGCCAGGG + Intergenic
1049357418 8:142195677-142195699 GGCTGCATCCCGTGGTGCCCAGG - Intergenic
1049426027 8:142538245-142538267 GGCTGGGCACCCCGGGACCCAGG - Intronic
1049568806 8:143358690-143358712 TGCTGCTCACCCCAGGGCCCTGG - Intronic
1049601664 8:143510594-143510616 CGCTGCACACCCTGGGGAACAGG - Intronic
1049615442 8:143573876-143573898 TGCTGCCCACCCTGAAGCCCGGG + Intergenic
1049820512 8:144630434-144630456 GGCTGCAGAAGCTGGGGGCCAGG - Intergenic
1053593176 9:39533849-39533871 TGCTGCAGACCCTGGTGCACGGG + Intergenic
1053610405 9:39707688-39707710 GGCTGCTCCCCCTGGGGCTGGGG - Intergenic
1053850910 9:42288557-42288579 TGCTGCAGACCCTGGTGCACGGG + Intergenic
1053868443 9:42465718-42465740 GGCTGCTCCCCCTGGGGCTGGGG - Intergenic
1054087846 9:60763468-60763490 GGCTGCTCCCCCTGGGGCTGGGG + Intergenic
1054243117 9:62634707-62634729 GGCTGCTCCCCCTGGGGCTGGGG + Intergenic
1054557242 9:66669225-66669247 GGCTGCTCCCCCTGGGGCTGGGG + Intergenic
1054573131 9:66831428-66831450 TGCTGCAGACCCTGGTGCACGGG - Intergenic
1056455417 9:86754888-86754910 GACTGCATACCCTGAGCCCCTGG - Intergenic
1056844215 9:90023533-90023555 GGCAGCCCACCATGGGGCCAAGG + Intergenic
1057172962 9:92974966-92974988 GGCTGGAAACTCTGGGGCCAGGG - Intronic
1057262545 9:93593241-93593263 GGCTGCACCCCCTGGACCCAAGG + Intronic
1059414500 9:114154900-114154922 AGCTGCACACCTTGGCCCCCGGG - Intergenic
1060991892 9:127854258-127854280 GTCTCCCCACCCTGGGTCCCTGG + Intronic
1061720469 9:132547892-132547914 GGCAGCCCTCCCTGGGGCCCTGG + Intronic
1061955948 9:133961436-133961458 GGCTGCAGACCAGAGGGCCCTGG + Intronic
1062099874 9:134722464-134722486 TGCTGGACACCCTGGGGTACGGG + Intronic
1062254006 9:135612629-135612651 GCCTACACCCCCTGGGGCCCTGG - Intergenic
1062281694 9:135754749-135754771 GGCTACCCAGTCTGGGGCCCAGG + Intronic
1062448525 9:136605899-136605921 GCCTGCACACACTAGGGGCCTGG - Intergenic
1062609645 9:137368259-137368281 GGCCACACAGCCTGGGTCCCAGG + Intronic
1062627316 9:137449186-137449208 GGCTGCAGTCCCTGGGGGCCGGG - Exonic
1062730565 9:138105946-138105968 GGATACCCACCCTGGGGCACTGG + Intronic
1185980771 X:4775244-4775266 GGCGGCAGACTCTGGAGCCCAGG - Intergenic
1186544452 X:10434317-10434339 GGCTTCTGACCCTGGGGCCCTGG - Intergenic
1189307176 X:39995589-39995611 GGCTGCGCAAGCTGGGGCCCAGG + Intergenic
1190218044 X:48493196-48493218 GGCAGCTTACCCTGGGCCCCAGG - Intergenic
1192184125 X:68935026-68935048 GGATGCTCACCCTGGGTCCCTGG + Intergenic
1192358732 X:70425502-70425524 TGCTCCCCACCCTGGGACCCGGG + Intronic
1194179472 X:90694968-90694990 GGCTGAACACCCTGAGGACTAGG + Intergenic
1194771753 X:97915286-97915308 GGCTACACCCCCCAGGGCCCTGG + Intergenic
1197717287 X:129718732-129718754 GGCTACAAGCCCTGGGCCCCAGG + Intergenic
1197819244 X:130529253-130529275 GGCTCCACACTCTGGAACCCTGG + Intergenic
1200526136 Y:4277141-4277163 GGCTGAACACCCTGAGGACTAGG + Intergenic
1201189642 Y:11436000-11436022 GGCTGCACTCCTTGGGGAGCAGG - Intergenic
1201310617 Y:12595588-12595610 GGCTGCCCACGCTGGGGTCATGG + Intergenic