ID: 966877075

View in Genome Browser
Species Human (GRCh38)
Location 3:184328566-184328588
Sequence ACGTTGCCCCAGAAGGAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 117}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966877063_966877075 30 Left 966877063 3:184328513-184328535 CCATGTCTAGAAAATGTTCCTGG 0: 1
1: 0
2: 1
3: 23
4: 245
Right 966877075 3:184328566-184328588 ACGTTGCCCCAGAAGGAGAGTGG 0: 1
1: 0
2: 0
3: 10
4: 117
966877069_966877075 2 Left 966877069 3:184328541-184328563 CCATAGTTGATGCCCTAGCCATG 0: 1
1: 1
2: 0
3: 6
4: 70
Right 966877075 3:184328566-184328588 ACGTTGCCCCAGAAGGAGAGTGG 0: 1
1: 0
2: 0
3: 10
4: 117
966877070_966877075 -10 Left 966877070 3:184328553-184328575 CCCTAGCCATGCCACGTTGCCCC 0: 1
1: 0
2: 0
3: 7
4: 107
Right 966877075 3:184328566-184328588 ACGTTGCCCCAGAAGGAGAGTGG 0: 1
1: 0
2: 0
3: 10
4: 117
966877068_966877075 12 Left 966877068 3:184328531-184328553 CCTGGGGGTTCCATAGTTGATGC 0: 1
1: 0
2: 1
3: 3
4: 45
Right 966877075 3:184328566-184328588 ACGTTGCCCCAGAAGGAGAGTGG 0: 1
1: 0
2: 0
3: 10
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966877075 Original CRISPR ACGTTGCCCCAGAAGGAGAG TGG Intronic
902091950 1:13910610-13910632 AGGCTTCCCCAGAAGCAGAGCGG + Intergenic
903136082 1:21310132-21310154 ACATTGCCTCAGAGGGAGGGAGG + Intronic
907322144 1:53610778-53610800 TTGTTGCCCCAGAAAGACAGGGG - Intronic
911895325 1:103426375-103426397 ACATTGCCCCAAAATGGGAGTGG - Intergenic
915362784 1:155295784-155295806 ACGTTCCCCCAGAACATGAGAGG + Intronic
915611717 1:156999028-156999050 AGGCTGCCCCAGCAGGAGGGAGG + Intronic
915670307 1:157483336-157483358 ATGTGGCCCCTGATGGAGAGAGG - Intergenic
920219352 1:204385170-204385192 ACAGTTCCCCAGAGGGAGAGGGG + Intergenic
1064977600 10:21135014-21135036 ACGTTGCCCTCGATGGAGGGTGG - Intronic
1065703086 10:28444348-28444370 CCCCTGCCCCAGAAGGAGAATGG + Intergenic
1074183892 10:111085118-111085140 CCATTGCCCTAGAAGGGGAGTGG - Intergenic
1075581953 10:123625598-123625620 ACTCAGCCCCAGAAGAAGAGTGG + Intergenic
1076171506 10:128323893-128323915 TCATTGCACCAGAAGGAGCGTGG + Intergenic
1077402033 11:2363751-2363773 ACATTCCGCCAGAGGGAGAGTGG + Intergenic
1077730966 11:4729442-4729464 AAGCTGCCCCAGACAGAGAGGGG + Intronic
1079381179 11:19938848-19938870 ACGTTTGCCCAGAATGAGAATGG - Intronic
1080761516 11:35254582-35254604 ACAGTGCCCCAGAAGGAGTGAGG + Exonic
1081142105 11:39514054-39514076 ATGGTACCCCAGAATGAGAGAGG - Intergenic
1081802289 11:45868270-45868292 AACTGTCCCCAGAAGGAGAGAGG + Intronic
1083662244 11:64256820-64256842 ACTGTGCCCCAGGAGGAGTGGGG - Intronic
1085546266 11:77321017-77321039 TCTTTGCCCCAGAAGGTGATGGG - Intergenic
1096562740 12:52448415-52448437 ACGTGGCCCAAGCAGGTGAGAGG - Intronic
1097102522 12:56599726-56599748 AGGCTGTCCCAGAAGGAGATTGG - Exonic
1097760254 12:63456708-63456730 ACAAGGACCCAGAAGGAGAGGGG + Intergenic
1102401386 12:112632669-112632691 ACATGTCCCCTGAAGGAGAGGGG - Intronic
1102591519 12:113959831-113959853 CTGTTGCCCAAGGAGGAGAGAGG - Intronic
1104751520 12:131243011-131243033 CACTTGCCCCTGAAGGAGAGTGG - Intergenic
1105209423 13:18249089-18249111 TCTGTGGCCCAGAAGGAGAGGGG + Intergenic
1112656891 13:101461132-101461154 AAGTTTCCCCAGAATGAGAAAGG + Intronic
1118335036 14:64846222-64846244 ACTCTGCCCCAGAAGTAGAGTGG + Intronic
1118522227 14:66597512-66597534 ACGTTGCTCCAAAATTAGAGTGG + Intronic
1119176965 14:72575463-72575485 ACGTTCCTTCAGAAGGAGATGGG + Intergenic
1121322654 14:93001523-93001545 ACCTGGCTCCAGAAGGAGATAGG + Intronic
1121633569 14:95438933-95438955 ATGTTGCCCCAGACAGGGAGGGG + Intronic
1124874771 15:33581492-33581514 ACATTCCCTGAGAAGGAGAGTGG - Exonic
1126872304 15:53002611-53002633 AAGTGGTACCAGAAGGAGAGTGG - Intergenic
1128549943 15:68591567-68591589 ACATTGCCCTAGAGGCAGAGAGG + Intronic
1130111386 15:80968282-80968304 AGATTGCTCCAGAAGGAGAATGG - Intronic
1131691385 15:94831451-94831473 AAGATGCCCCAGAAGTAGAATGG + Intergenic
1132767352 16:1541263-1541285 ACGGGGCCCCAGGAGGTGAGGGG + Intronic
1142219104 16:88844380-88844402 ACTTTGCTCTAGAAGGAGAAGGG + Intronic
1144766895 17:17737977-17737999 CCCTGGCCCCAGAAGGAGGGAGG + Intronic
1146054506 17:29574394-29574416 AGGGTGCCCTAGAAGGCGAGGGG + Exonic
1147400237 17:40176660-40176682 ATGCTGCCCCAGAAGGAGTGTGG - Intergenic
1147671920 17:42181198-42181220 ACGTGGCCCCACACGGGGAGGGG + Exonic
1152507217 17:80757957-80757979 ACGTTACCCCAGGAAGAGATTGG + Intronic
1153056765 18:953263-953285 ACTTAGCCCTAGAAGGACAGGGG + Intergenic
1155035302 18:22020729-22020751 ACGTTGCCTGAAAAGGAGAAAGG - Intergenic
1155235092 18:23810987-23811009 ACGGTCCCCCAGAAGGCCAGAGG - Intronic
1155333090 18:24737767-24737789 ACTTGGGCCCAGCAGGAGAGGGG - Intergenic
1159350691 18:67268966-67268988 CCGTAGCCCAATAAGGAGAGTGG + Intergenic
1159564260 18:70031359-70031381 ATGTGTCCCCAGAAGGAGAAAGG - Intronic
1160139003 18:76302524-76302546 CTGTTGCACCAGAAGGAAAGGGG + Intergenic
1161744541 19:6047678-6047700 ACTGTCCCACAGAAGGAGAGAGG + Intronic
1162177567 19:8842543-8842565 ACCTATCCCCAGAGGGAGAGAGG + Intronic
1163501064 19:17676501-17676523 GGATTGCCCCAGAAGAAGAGGGG + Intronic
1167446841 19:49542902-49542924 ACGGAGCCCCAGAAAGAGAGGGG + Intronic
1168036331 19:53722628-53722650 TCGTTTCCCCAGCTGGAGAGCGG + Intergenic
927271515 2:21215176-21215198 ACGATGGCATAGAAGGAGAGGGG - Intergenic
933702267 2:85263885-85263907 AGGGTGCCCCAGAAGCTGAGGGG + Intronic
943437313 2:187882246-187882268 ATGTTCTCCCAGAAAGAGAGAGG + Intergenic
945077702 2:206056750-206056772 CCCTTGCCCCAGGTGGAGAGAGG + Exonic
946372517 2:219289692-219289714 CTCTTGCGCCAGAAGGAGAGAGG + Exonic
1169661511 20:7983395-7983417 ACCTGGCCCCAGAAGAAGTGTGG + Intronic
1170583423 20:17716060-17716082 ATGTGGCCCAAGAAGGTGAGGGG + Intronic
1172656830 20:36542724-36542746 AAGAGGCCCCAGAAGGGGAGTGG - Intronic
1173198778 20:40938458-40938480 ATGTTGGCCCAGGAGGAGTGGGG + Intergenic
1173835927 20:46125659-46125681 AGGTGGCCCCAGGAGGAGTGGGG - Intronic
1176910290 21:14557386-14557408 CCTTTGTCCCTGAAGGAGAGAGG - Intronic
1178385763 21:32149015-32149037 ACATTGCCACTGAAGGACAGGGG + Intergenic
1179585299 21:42370587-42370609 AAATTAACCCAGAAGGAGAGGGG + Intergenic
1181849820 22:25742100-25742122 ACATTGGCCCAGAAGGAGGGTGG + Intergenic
1182367628 22:29789499-29789521 ATGTGGCCCCAGAGGGAGAAAGG - Intronic
1185025814 22:48411284-48411306 AGGTTTCTTCAGAAGGAGAGAGG + Intergenic
1185252932 22:49814971-49814993 ACGTTGCCCCACAAAGCTAGGGG + Intronic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
955875771 3:63488979-63489001 ACACTTCCCCAAAAGGAGAGTGG + Intronic
962367554 3:134796236-134796258 AAGTGGCCGCCGAAGGAGAGGGG + Intronic
966223110 3:177570032-177570054 ACATTGACCCACAGGGAGAGGGG - Intergenic
966723345 3:183086296-183086318 ACGTGGCCCTAGAATGAGACTGG + Intronic
966877075 3:184328566-184328588 ACGTTGCCCCAGAAGGAGAGTGG + Intronic
967497456 3:190157509-190157531 ATGTTGCCCCAGCTGGAGTGCGG - Intergenic
968447715 4:660691-660713 CAGGTGCCCCAGAAGGTGAGGGG + Intronic
968797974 4:2721638-2721660 ACCTTCCTCCAGCAGGAGAGAGG - Intronic
969517379 4:7655096-7655118 ATATGGCCCCAGCAGGAGAGAGG - Intronic
982533512 4:156578366-156578388 ACGCTGCCCCAGCAGCACAGGGG + Intergenic
985267975 4:188167638-188167660 ACGATGGCCCAGGAGGAGAGAGG + Intergenic
991515428 5:67429632-67429654 ACAATGCCCCAGAAGAAGAGAGG - Intergenic
995651622 5:114376237-114376259 AAGTAGCCACAGAAGGAAAGGGG + Intronic
996290026 5:121841836-121841858 ACGATGACACAGAAGGAAAGTGG - Intergenic
999266658 5:150271017-150271039 AGATTGCCCCAGTGGGAGAGAGG - Intronic
999373302 5:151069190-151069212 GCCTTACCCCAGAAAGAGAGGGG + Intronic
1001384595 5:171328399-171328421 ACCTTTCCCTACAAGGAGAGGGG + Intergenic
1003217985 6:4132484-4132506 ACCTTGCCCCAGAAGAGGTGTGG - Intronic
1005991552 6:30905990-30906012 ACCCTGTCCCAAAAGGAGAGGGG - Intergenic
1006093837 6:31643928-31643950 TCGTTGGCCCAGATGGTGAGCGG - Exonic
1018696380 6:166394809-166394831 ACAAGTCCCCAGAAGGAGAGAGG + Intergenic
1019279945 7:194518-194540 AGGTTACCCCAGCAGCAGAGGGG + Intronic
1020042114 7:5012172-5012194 TAGGTGCCCCAGGAGGAGAGGGG - Intronic
1026564025 7:71474878-71474900 AGGTGGCCCTAGAAGGAGAGAGG + Intronic
1027744233 7:82053636-82053658 ACGTATCTCCAGAAGCAGAGTGG + Intronic
1028863366 7:95679822-95679844 ACATTGCACCAGAAGAAAAGAGG - Intergenic
1028948511 7:96607844-96607866 AAGGTGCCCCAGAAGTAGACTGG - Intronic
1031770573 7:125836309-125836331 GCTTTACTCCAGAAGGAGAGGGG - Intergenic
1033554490 7:142476931-142476953 TCGTTGCCACAGAAGAATAGCGG - Intergenic
1033757868 7:144410245-144410267 GTGTTGCCCCAAAAGGATAGAGG - Intergenic
1034088791 7:148345117-148345139 ACGTTTAGCCTGAAGGAGAGGGG + Intronic
1034953301 7:155316112-155316134 CCGTTGCCACAGATGGGGAGAGG + Intergenic
1038362395 8:26893986-26894008 AGGCTGCACCAGAAGGTGAGTGG + Intergenic
1038520639 8:28229483-28229505 ACATTGCCCCAAAAGGAAAGAGG + Intergenic
1038589740 8:28825578-28825600 ACGTTGTCCTAGATGGAAAGGGG - Intronic
1040013500 8:42681767-42681789 AAGCTGCCCCAGAAGCAGATGGG - Intergenic
1044326551 8:90865298-90865320 AATTTGCCCCAGAATTAGAGAGG + Intronic
1046405122 8:113763302-113763324 ACATTGCACCAGATGGAGTGGGG + Intergenic
1049521591 8:143094263-143094285 ACCTGGACCCAGAAGGACAGAGG - Intergenic
1053448847 9:38175968-38175990 TCTTTGCCCCAGCAAGAGAGAGG + Intergenic
1055942932 9:81667541-81667563 AAGTTGCTCAGGAAGGAGAGTGG - Intronic
1056126021 9:83537505-83537527 AAGTTTCCCCAGAGTGAGAGAGG - Intronic
1057597134 9:96424087-96424109 ACCTTTCCACAGATGGAGAGAGG - Intergenic
1060666733 9:125436283-125436305 ACCTTCCCTCAGAAGCAGAGAGG + Intergenic
1188063844 X:25633408-25633430 ACTTTGCCCCTTAAGCAGAGGGG + Intergenic
1190266028 X:48827466-48827488 GCGTTGGCCCAGAAGGAGCGGGG - Intergenic
1191095645 X:56670742-56670764 AGGATATCCCAGAAGGAGAGAGG - Intergenic
1196042652 X:111222214-111222236 ACCTTGGCAAAGAAGGAGAGAGG - Intronic
1198173397 X:134130123-134130145 AGGGTACCCCTGAAGGAGAGTGG + Intergenic
1198998467 X:142604401-142604423 AAGTTGTCCCAGAAATAGAGAGG - Intergenic
1201982805 Y:19925671-19925693 AAGTAGCTCCAGATGGAGAGTGG + Intergenic
1202117596 Y:21486279-21486301 AAGTTGGGACAGAAGGAGAGGGG - Intergenic