ID: 966877173

View in Genome Browser
Species Human (GRCh38)
Location 3:184329046-184329068
Sequence GCTGTGGCCCTGAAGCTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 248}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966877170_966877173 1 Left 966877170 3:184329022-184329044 CCCACGGTGTGGTTTTGGCTGTT 0: 1
1: 0
2: 0
3: 8
4: 117
Right 966877173 3:184329046-184329068 GCTGTGGCCCTGAAGCTTCATGG 0: 1
1: 0
2: 1
3: 18
4: 248
966877166_966877173 13 Left 966877166 3:184329010-184329032 CCAGAGATGCCTCCCACGGTGTG 0: 1
1: 0
2: 0
3: 11
4: 88
Right 966877173 3:184329046-184329068 GCTGTGGCCCTGAAGCTTCATGG 0: 1
1: 0
2: 1
3: 18
4: 248
966877169_966877173 4 Left 966877169 3:184329019-184329041 CCTCCCACGGTGTGGTTTTGGCT 0: 1
1: 0
2: 0
3: 6
4: 125
Right 966877173 3:184329046-184329068 GCTGTGGCCCTGAAGCTTCATGG 0: 1
1: 0
2: 1
3: 18
4: 248
966877171_966877173 0 Left 966877171 3:184329023-184329045 CCACGGTGTGGTTTTGGCTGTTT 0: 1
1: 0
2: 1
3: 16
4: 161
Right 966877173 3:184329046-184329068 GCTGTGGCCCTGAAGCTTCATGG 0: 1
1: 0
2: 1
3: 18
4: 248
966877164_966877173 21 Left 966877164 3:184329002-184329024 CCAGGAGTCCAGAGATGCCTCCC 0: 1
1: 0
2: 4
3: 23
4: 263
Right 966877173 3:184329046-184329068 GCTGTGGCCCTGAAGCTTCATGG 0: 1
1: 0
2: 1
3: 18
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966877173 Original CRISPR GCTGTGGCCCTGAAGCTTCA TGG Intronic
900238150 1:1602089-1602111 GCTGTGGCCCTGAAGGTGGGTGG + Intergenic
901051206 1:6426678-6426700 ACTGTGGGTCTGAAGCTCCAGGG - Intronic
901460572 1:9388859-9388881 GCTGAGGCCCAGAGGGTTCAAGG + Intergenic
901953606 1:12768815-12768837 CCTCTGGCCCTGGAGCTTCCAGG + Intergenic
902268182 1:15283947-15283969 TCTGTGCCCCTGGAGCTTCCAGG - Intronic
903192099 1:21662592-21662614 GACGTGGCCCTGAAGCTTCCAGG - Intronic
903280430 1:22247097-22247119 GTTGGGGCCCTGGAGCTTCAGGG - Intergenic
903539052 1:24086575-24086597 GCTCAGGACCTGAAGCTGCAGGG - Intronic
903645272 1:24891891-24891913 GCTCTGCCCCTGTGGCTTCATGG + Intergenic
906662739 1:47593990-47594012 GCTGGGACCCTGGACCTTCATGG - Intergenic
907611405 1:55874925-55874947 GCTGTGCCTCTGAAGCTGCTAGG + Intergenic
907801749 1:57773080-57773102 GCTATGGTCCTGAAGGTTCTAGG - Intronic
907981637 1:59487458-59487480 GCTGTGGCCCAGCACCTGCATGG + Intronic
908859295 1:68465050-68465072 CCTGAGGCGCTGAAGCCTCAGGG + Intergenic
909562992 1:77025815-77025837 GCTGGGGCCCTGTAGCTGCAGGG - Intronic
910173349 1:84401432-84401454 GTTTTAGCCCTGAATCTTCAAGG + Intronic
911262426 1:95701955-95701977 GGTGTTGGCCTGGAGCTTCAGGG - Intergenic
911567136 1:99475500-99475522 GCTTTGGCCCTGAAGATTGAGGG + Intergenic
912691909 1:111810983-111811005 CCTGAGGCCCTGAAGCTGGAGGG - Intronic
912760096 1:112359164-112359186 GCTGTGCCTCTGAGGCATCAGGG - Intergenic
913969716 1:143405489-143405511 GCAGTGGCTCTGATGCTGCATGG - Intergenic
914064089 1:144231082-144231104 GCAGTGGCTCTGATGCTGCATGG - Intergenic
914115061 1:144735272-144735294 GCAGTGGCTCTGATGCTGCATGG + Intergenic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
916980382 1:170129565-170129587 CCTGTTTCCATGAAGCTTCATGG + Intergenic
918393366 1:184089494-184089516 ACTGTGGCCCTGAATCTGCCAGG - Intergenic
919674488 1:200367707-200367729 GCTGTGGGAATGAAGTTTCAGGG + Intergenic
921936072 1:220798447-220798469 GTTGTTGCCCCTAAGCTTCATGG + Intronic
922792612 1:228318426-228318448 GCAGGGGCCCAGAAGCTTAAAGG - Intronic
924937898 1:248787902-248787924 GCTGTGGCATAGAACCTTCATGG - Intergenic
1063964129 10:11332635-11332657 GCTGAGGCCAAGAAGCTTCCAGG - Exonic
1065389185 10:25164698-25164720 GCTGTGCCCATGATGCTGCATGG + Intergenic
1069827909 10:71265590-71265612 GCTGTGGCCTGGCAGCTTCCAGG + Intronic
1072923190 10:99593973-99593995 GCTGTGGCTCTGACTCCTCAGGG + Intergenic
1073047337 10:100647411-100647433 GCTGTCGCCATGAATCCTCAAGG + Intergenic
1073115865 10:101091329-101091351 GCTCAGGCCCTGGAGCTTCCCGG - Intronic
1076014586 10:127017730-127017752 GCTCTGTCCCTGAGGCCTCAGGG - Intronic
1076479077 10:130772546-130772568 CCTGTGGCCCTGCAGGTTCTTGG - Intergenic
1076816896 10:132919537-132919559 ACTGTGGCTCTGCAGTTTCAAGG + Intronic
1081966340 11:47172400-47172422 GCTCTTGCCATGAAGCTGCATGG - Intronic
1083416683 11:62530416-62530438 GATGTGGACCTGAATCTTAAGGG - Exonic
1084315148 11:68341548-68341570 GCTGTGACCCCTGAGCTTCAGGG + Intronic
1086743501 11:90397644-90397666 CCTGAGGCCCAGATGCTTCATGG - Intergenic
1087891585 11:103542996-103543018 GCTGTGGCCATGGACCTTCCAGG - Intergenic
1088878008 11:113951866-113951888 CCTGTGGCTCTGAGGCTTCTAGG + Intergenic
1088962643 11:114684879-114684901 TCTGTGTTCCTGAAGCTTCTTGG - Intronic
1089330877 11:117688254-117688276 GCTGTGCCCATGAACCATCAAGG + Intronic
1089487098 11:118854964-118854986 CCTGTGGCCCTGGGGCTCCATGG - Intergenic
1091553500 12:1554460-1554482 ACTGTGCCCCTGCAGCTGCATGG - Intronic
1091614110 12:2035937-2035959 GCTGTGGCTCTTCTGCTTCAGGG + Intronic
1091979773 12:4855590-4855612 AATGTGGCTCTGAATCTTCAAGG - Intergenic
1096676588 12:53229662-53229684 GCTGTGGCCCAGGGGCCTCAGGG - Intronic
1098106284 12:67070837-67070859 GCTCAGGTCCAGAAGCTTCAAGG + Intergenic
1098528980 12:71519163-71519185 GGTGTGGTCCAGAAGCTGCAAGG - Intronic
1099496340 12:83351463-83351485 GCTGTTGCCCTGAAGATTCATGG - Intergenic
1100252277 12:92839860-92839882 GCTGCTGCCATGAAGTTTCAGGG - Intronic
1102034264 12:109761882-109761904 GCAGTGGCCCTGAAGCCTGCCGG + Intronic
1102258709 12:111430569-111430591 GCTGTGGGCTTGGAGGTTCAGGG + Intronic
1102590248 12:113951189-113951211 GCTGGGCCCCTTAAGCTTTAGGG - Intronic
1102932019 12:116869643-116869665 GCTGAGGCAGGGAAGCTTCATGG - Intronic
1103247693 12:119472181-119472203 GCTGTGGCACTGAAGGTTTTGGG + Intronic
1103322568 12:120100576-120100598 GCTCTGGCTCTGCAGCATCAGGG - Intronic
1103466642 12:121147173-121147195 GCTGAGGCTGTGAAGCTACATGG + Intronic
1104994169 12:132643642-132643664 GCTGTGCCCCTGCAGCTGCCCGG + Intronic
1105804758 13:23946502-23946524 GCTGGGGGCCTGGAGCTGCAGGG - Intergenic
1108263004 13:48677105-48677127 TCTGTAGCCCTGAGGCCTCATGG - Intronic
1112233885 13:97617482-97617504 GAGGTGCCCCTGAAGCTGCAGGG + Intergenic
1112340701 13:98550654-98550676 GCTGTGTCCCTGAGCTTTCATGG - Intronic
1112549145 13:100403658-100403680 TCTGTGGGCCTGAATTTTCATGG - Intronic
1113904780 13:113814145-113814167 GCTGTGCCCCCGAAGCTGCCTGG + Exonic
1114459431 14:22877287-22877309 GCAGTGGCCCTGGGGCTTCAGGG - Exonic
1114775059 14:25472604-25472626 ACTGTTGACCTGAAGCTTCATGG - Intergenic
1115888779 14:38004105-38004127 GTTGAGGCCCTGAAACTTCTTGG - Intronic
1119859428 14:77925596-77925618 GCTTTGAACTTGAAGCTTCAGGG + Intronic
1121181412 14:91931913-91931935 GGTGTGGTGCTGAAGCCTCAGGG - Intronic
1121438482 14:93934111-93934133 GCTGAGGACCTCAGGCTTCAGGG + Intergenic
1121615445 14:95310860-95310882 GCTGTGGCCCAGTTCCTTCAAGG + Intronic
1122080553 14:99264030-99264052 GTTGTGGCTCTGAAGATTGAAGG - Intronic
1122108684 14:99480558-99480580 GCTGTGGCCCCGGGGCTTGAAGG - Intronic
1122122141 14:99560336-99560358 ACTGAGGCCCAGAAGATTCATGG - Intronic
1122293834 14:100693982-100694004 GCTGTGCCCCACAAGCTGCAGGG - Intergenic
1122823040 14:104356598-104356620 GCTGGGGCCCAGCAGCTCCAGGG + Intergenic
1122984950 14:105207743-105207765 GCTGTGACGCTGCAGCTGCACGG - Intergenic
1124141537 15:27081232-27081254 GCTGGGGCCCAGAGGCTACAAGG + Intronic
1125749983 15:42021476-42021498 GCTGTGGCCAGGGACCTTCATGG + Intronic
1127295400 15:57604598-57604620 CCAGTGTCCCTGCAGCTTCAAGG - Intronic
1129191925 15:73942315-73942337 GCTCTGCCCATGAACCTTCAGGG + Intronic
1129191927 15:73942322-73942344 AGTGTGTCCCTGAAGGTTCATGG - Intronic
1129454421 15:75669158-75669180 CCTGGGGCCTTGAACCTTCATGG + Intergenic
1131267179 15:90923337-90923359 GCTGTGGTACTGAGGCCTCACGG + Intergenic
1131791979 15:95975020-95975042 CTTATGGCCATGAAGCTTCAGGG + Intergenic
1131791981 15:95975027-95975049 GCCTGGGCCCTGAAGCTTCATGG - Intergenic
1132503929 16:297479-297501 GCTCTGGCCCTCAGTCTTCAGGG - Intronic
1132756398 16:1487482-1487504 CCTGTCCCTCTGAAGCTTCAGGG + Exonic
1133634152 16:7650273-7650295 GCTTTGGGCCAGAGGCTTCATGG - Intronic
1134782565 16:16911632-16911654 GCTGTGGTTCAGAAGCTTTAAGG + Intergenic
1136022232 16:27447559-27447581 GCGGTGGCCCTTAAACTTGAAGG - Intronic
1137726021 16:50657333-50657355 GCTGTGAGCCTGGAGCTGCAGGG - Intergenic
1139262234 16:65605592-65605614 GATGTGGACATGAAGGTTCAGGG - Intergenic
1142275712 16:89117821-89117843 CCAGAGACCCTGAAGCTTCAGGG + Intronic
1142540572 17:655559-655581 GCTGTGGCTCTGTACCATCAAGG - Intronic
1146403768 17:32519998-32520020 CCTGTGGGCCTGAGTCTTCAGGG - Intronic
1147360461 17:39926920-39926942 GCTGTGGTCCTGCAGCTTGGGGG - Intronic
1147861762 17:43528061-43528083 GCTGTGGCCCTGGAGGGTCCCGG - Exonic
1151395525 17:73820181-73820203 GCTGTGGCCCTGACGCTCGGGGG + Intergenic
1151885011 17:76918339-76918361 GCTGTAGCCCTGAACCCTCGAGG + Intronic
1152118032 17:78400786-78400808 GATGTGTCCCTGCAGCTGCAGGG + Exonic
1152359097 17:79822069-79822091 GCGCTGGCCCTGGAGCCTCACGG - Intergenic
1152479607 17:80541630-80541652 GCTCTCACCCTGAAGGTTCAAGG - Intergenic
1152754710 17:82082438-82082460 GGTGAGGCCCTGGAGCTGCAGGG - Intronic
1154388758 18:13918714-13918736 CCTGTAACCCTGAAACTTCATGG + Intergenic
1155175450 18:23297803-23297825 GCCGAGGCCCTGGTGCTTCAAGG - Exonic
1156263749 18:35467820-35467842 GCTGTGGTCCAGAAGCCCCAGGG + Intronic
1157582617 18:48782299-48782321 GCAGGGGCCCTGGAGCTTGATGG - Intronic
1161009873 19:1954941-1954963 GCTGTGGCCCTCAGGCAACAGGG + Intronic
1162854761 19:13459804-13459826 GCTCTGGCACTGAAGGTTCCAGG + Intronic
1163082328 19:14953048-14953070 GCTGTGGCCGTGATGCTGCAGGG + Exonic
1164933928 19:32196661-32196683 GCTGAGGCTCTGAAGCTGTAGGG - Intergenic
1165328245 19:35126448-35126470 GCTGAGGCCCTGGAGCTGGACGG - Exonic
1165673129 19:37696574-37696596 GCTGTGGCCCAGTTGCCTCACGG + Exonic
1167497548 19:49828434-49828456 GCTCTGCCCCTGCAGGTTCATGG + Exonic
1168146497 19:54422313-54422335 GCTGCGGCCCAGCAGCTGCAGGG + Exonic
925624351 2:5827162-5827184 GGTGTGGCCCTGAGGTTTCCAGG + Intergenic
926361949 2:12097426-12097448 ACTATGTACCTGAAGCTTCATGG + Intergenic
926694285 2:15760387-15760409 GGTCTGAGCCTGAAGCTTCAGGG - Intergenic
927462529 2:23311431-23311453 GCTGTGGACCTGAAATTACAGGG - Intergenic
927716439 2:25356195-25356217 CCTATGGCCCTGCAGCTGCAGGG - Intergenic
929560706 2:42954718-42954740 CTTGTGCCCCTGAAGTTTCAGGG + Intergenic
929560710 2:42954725-42954747 TCCGTGCCCCTGAAACTTCAGGG - Intergenic
930880331 2:56263204-56263226 GCTGTAGCCCTGATGCATAAGGG + Intronic
932448377 2:71794458-71794480 ACTCTGGCCCTGCAGCCTCAGGG - Intergenic
932572760 2:72946538-72946560 GCTGTGAACCTGAGGCTCCAGGG - Intronic
933940913 2:87244493-87244515 TCTGTGTCTCTGAAGCTACATGG + Intergenic
934174410 2:89566400-89566422 GCAGTGGCTCTGATGCTGCATGG - Intergenic
934284726 2:91640750-91640772 GCAGTGGCTCTGATGCTGCATGG - Intergenic
934526842 2:95057308-95057330 GCTGTGGCCCCCTTGCTTCAGGG + Intergenic
936352226 2:111721520-111721542 TCTGTGTCTCTGAAGCTACATGG - Intergenic
937365787 2:121260308-121260330 GCTGTGGTCCTGGAGTGTCAAGG - Intronic
937974860 2:127576528-127576550 TCTGAGGCCCTGAGGCCTCAGGG + Intronic
937997754 2:127708054-127708076 GGTGTGGCTCGGAAGCTTCTGGG - Intronic
942135214 2:172918818-172918840 GCTGTGGCTCTGAAGATGCAGGG - Intronic
945339998 2:208640953-208640975 TCTCTGGCCTTGAAACTTCAGGG + Intronic
946108581 2:217393776-217393798 TCTCTGGCCCTAAATCTTCAGGG - Intronic
948642696 2:239385574-239385596 GCTGTGCACGTGAAGCTGCAAGG - Intronic
948860283 2:240749613-240749635 CCTGTTGCCCTGCAGCTTCCAGG + Intronic
1169390883 20:5190049-5190071 GCTAGGGCCCGGAAGCTTCCAGG - Intronic
1170322601 20:15116785-15116807 GCTGTTGACCAGAAGCTTTATGG - Intronic
1170335816 20:15268995-15269017 GCTGTGGCTCTGAAGTGTTAAGG - Intronic
1170744784 20:19089866-19089888 GCTGTGCCCCAGAAACTTCAAGG + Intergenic
1171259463 20:23718737-23718759 CCAGCTGCCCTGAAGCTTCATGG + Intergenic
1175488067 20:59359606-59359628 GCTGTGGCTCTGATTCTTCACGG + Intergenic
1175757819 20:61540760-61540782 CCTCTGGCCTTGAAGCTGCATGG - Intronic
1175876798 20:62234037-62234059 GCTGTGTCCCTGAGGATGCATGG + Intronic
1176127878 20:63484071-63484093 GCTGGGGCCCTGAGGCTGCACGG + Intergenic
1176270129 20:64232007-64232029 GCTGAGGTCCTGGAGCCTCAGGG - Intronic
1179505690 21:41838757-41838779 GCTGTGGGTCTGCAGCTTCTAGG - Intronic
1179949298 21:44700648-44700670 GCTGAGGGGCTGAGGCTTCAGGG - Intronic
1179983245 21:44907272-44907294 GCTGTGGCCGGGAGCCTTCAGGG - Intronic
1180432282 22:15263711-15263733 GCTGTGGCCATGAGGCTTTGCGG - Intergenic
1180799255 22:18624190-18624212 GAGGAGGCCCTGAGGCTTCAAGG + Intergenic
1180959086 22:19754625-19754647 GCTGTGGGCCTGGAGCTCCTGGG + Intergenic
1181222463 22:21371076-21371098 GAGGAGGCCCTGAGGCTTCAAGG - Intergenic
1181313246 22:21956747-21956769 GCAGTGGCCCTGATGCCTTAAGG - Intergenic
1181346351 22:22222819-22222841 GCAGTGGCCCTGATGCCTTAAGG - Intergenic
1181459037 22:23075457-23075479 GCTGTGGCCATGTAGGTCCAGGG - Intronic
1181638219 22:24184062-24184084 GAGGAGGCCCTGAGGCTTCAAGG - Intronic
1183882146 22:40842083-40842105 GCTGTGGCTCTGAATTTTCAGGG - Intronic
949345736 3:3075044-3075066 GCTGTGGCCCTGAGTCATCCAGG + Intronic
949487879 3:4557618-4557640 TCTGTGGCTTTCAAGCTTCAAGG + Intronic
951593506 3:24292400-24292422 GATGTGTCCCTGATGCTTCTGGG - Intronic
953535970 3:43776999-43777021 GCTGTGGCCCAGAGGGGTCATGG + Intergenic
954199330 3:49014840-49014862 GCTGTGGGCCTGGAGAGTCAGGG - Exonic
956147940 3:66210994-66211016 GCTGTGGCACTGCACCTGCATGG + Intronic
956168638 3:66415301-66415323 GGGGTGGCCCAGCAGCTTCAAGG - Intronic
956330110 3:68097303-68097325 GTTGTGGCCTTGAAGCTGAAAGG - Intronic
957597689 3:82288415-82288437 GCAGGGGACCTGCAGCTTCATGG - Intergenic
961410539 3:126717109-126717131 GCTTTGGTCCTGTGGCTTCATGG + Intronic
961501958 3:127342608-127342630 GTTGTGGCTCTTGAGCTTCAGGG + Intergenic
961762681 3:129183438-129183460 GCCGAGGCCCTGACGCTTCGAGG - Intronic
961787868 3:129358298-129358320 GCTGTGGCCGTGGAGCCTCTTGG - Intergenic
961793362 3:129392435-129392457 GCTGTGGTCCTGGAGGCTCAGGG - Intergenic
962463482 3:135635966-135635988 GCTGTGGCCCTGCACTTTGATGG + Intergenic
964627679 3:158775136-158775158 CCTGTGGCTCTGAAACTGCATGG + Intronic
966877173 3:184329046-184329068 GCTGTGGCCCTGAAGCTTCATGG + Intronic
967122884 3:186399444-186399466 GCTGTCCCCCAGAAGCCTCATGG + Intergenic
967266221 3:187694537-187694559 TCTGTGGGCCTGGAGCTCCATGG + Intergenic
968762890 4:2451472-2451494 GCTGTGGTCCTGCAGCAACAGGG + Intronic
968890820 4:3367553-3367575 GCTGGGGCCCAGAATCTTCTGGG + Intronic
969586686 4:8097952-8097974 GCTGAAGCCCTGGAGCTCCATGG + Intronic
969828263 4:9775343-9775365 GCAGTGGCTCTGATGCTGCATGG - Intronic
972306267 4:37833007-37833029 GCTGTGGCCCCAATGCTCCATGG - Intronic
976573022 4:86635272-86635294 GCTGAGGCCCTGGAGGTTCGGGG + Exonic
978290674 4:107135746-107135768 GCTCTGCGCCAGAAGCTTCATGG + Intronic
978822850 4:112985754-112985776 GATGTGGGACTGAAGATTCAGGG + Intronic
981689448 4:147490817-147490839 GCTGTTATCCTGAAGCTACATGG - Intronic
984806767 4:183758471-183758493 GATGTGGCCCTGAAGACCCACGG - Intergenic
985970788 5:3376903-3376925 GCTGTGGCCTGGAGGCCTCAGGG + Intergenic
987245374 5:16043018-16043040 CCTGTGGCCCTTAAGCATTAAGG + Intergenic
988201741 5:28077730-28077752 GCTGTGCCCCTGGAGCCTCCCGG - Intergenic
990981036 5:61602656-61602678 AATGTGGCCCTGAAGCTGCCTGG - Intergenic
992595768 5:78345821-78345843 GCTGTAGCCCTGAAGCCACTGGG - Intergenic
998147868 5:139740505-139740527 GTTGCCGCCCTGAAGCCTCAGGG - Intergenic
998910899 5:146959294-146959316 ACTGAGTGCCTGAAGCTTCAGGG + Intronic
1001017547 5:168154951-168154973 GCTGTGGACGTGCAGGTTCATGG + Intronic
1001108957 5:168879522-168879544 GCTGAGGAGCTGATGCTTCATGG - Intronic
1001124621 5:169008311-169008333 TCTGTGGCCATGAAGCTGCAAGG + Intronic
1002681021 5:180963955-180963977 GCTTGGGTCCTGAGGCTTCAGGG + Intergenic
1005298435 6:24448715-24448737 GCTGTGGCCCGGGGGCTTCATGG - Intronic
1005403590 6:25461376-25461398 GCTGTGGCCATTAAGTTTGAGGG - Intronic
1006432497 6:34006364-34006386 GCTGTGCCCTTGAAGCATTAGGG - Intergenic
1007227109 6:40322700-40322722 ACTGTGGTTCTCAAGCTTCAGGG + Intergenic
1009675782 6:66818450-66818472 GCTCTGGACCTGAAACTTAAGGG + Intergenic
1010749981 6:79607225-79607247 GCTGTGGTTTTGAAGCTACAGGG - Intergenic
1014134373 6:117871198-117871220 GCTGTGGCCCTTAGACTTAATGG + Intergenic
1015819776 6:137248242-137248264 CCTGTGGCCTTGAAGCTGCTTGG - Intergenic
1019125478 6:169837821-169837843 GCTGTCTCCTGGAAGCTTCAGGG - Intergenic
1020009229 7:4799460-4799482 GCTGTGGACCTGATCCGTCATGG - Exonic
1020136759 7:5592216-5592238 GCTGTGGGGCTGAAGCCTCAAGG + Intergenic
1021729869 7:23585815-23585837 GCTAAGGCCCAGAAGCTCCAAGG + Intergenic
1022501556 7:30885193-30885215 GCAGTGGCCTTCAAGCTTCAGGG + Intronic
1023123589 7:36933773-36933795 GCAGCGGGCCTGAGGCTTCATGG + Intronic
1023814826 7:43941589-43941611 CCCGTGGCCCTGGAGCCTCAAGG - Intronic
1023834948 7:44062496-44062518 TAAGTGGCTCTGAAGCTTCAGGG + Intronic
1024212662 7:47218897-47218919 CCTGTGGCCCAGTTGCTTCATGG - Intergenic
1026747524 7:73024648-73024670 GCTGCAGCCCTGAAGCTCCTGGG - Intergenic
1026751174 7:73052787-73052809 GCTGCAGCCCTGAAGCTCCTGGG - Intergenic
1026754823 7:73080901-73080923 GCTGCAGCCCTGAAGCTCCTGGG - Intergenic
1026758475 7:73108935-73108957 GCTGCAGCCCTGAAGCTCCTGGG - Intergenic
1027033730 7:74909940-74909962 GCTGCAGCCCTGAAGCTCCTGGG - Intergenic
1027088930 7:75284550-75284572 GCTGCAGCCCTGAAGCTCCTGGG + Intergenic
1027092573 7:75312478-75312500 GCTGCAGCCCTGAAGCTCCTGGG + Intergenic
1027096216 7:75340445-75340467 GCTGCAGCCCTGAAGCTCCTGGG + Intergenic
1027323126 7:77027247-77027269 GCTGCAGCCCTGAAGCTCCTGGG - Intergenic
1028500592 7:91514982-91515004 TCTCTGTCCCTGAAACTTCAAGG + Intergenic
1029446642 7:100616736-100616758 GGTGTGGCCCTGATACTGCATGG + Intergenic
1029709472 7:102291804-102291826 GCTGTGTTCCTGAATCTGCAGGG + Intronic
1030162082 7:106519313-106519335 GCTGTGGCAAAGAAGTTTCAGGG - Intergenic
1032399798 7:131616852-131616874 GCAGTGGCCCTTAAACTTCTTGG - Intergenic
1032419925 7:131770337-131770359 GTCGTGGTTCTGAAGCTTCAGGG + Intergenic
1032429692 7:131850526-131850548 TCTGTGTCCCTGTATCTTCATGG + Intergenic
1036781194 8:11648972-11648994 ACTTTGTCCCTGAAGCTTCCCGG - Intergenic
1037059968 8:14495817-14495839 GCTATGGGCCTAAAGTTTCAGGG + Intronic
1037888726 8:22609853-22609875 GCTGTGACACTGAAGCATAATGG - Intronic
1038816859 8:30912955-30912977 GCTGTGTTCCTGAGGCTTCCAGG - Intergenic
1038960276 8:32510705-32510727 GCGGTGGCCCTGAGGCTTCTGGG - Intronic
1044630961 8:94278318-94278340 CCTGTGACCCTGAAGCACCAGGG + Intergenic
1044815526 8:96108532-96108554 GCTGTGGGCTGGAGGCTTCATGG - Intergenic
1045976783 8:108138323-108138345 GCCGTGGCCCTGGGGCTTCCTGG - Intergenic
1048969866 8:139639468-139639490 GCTGTGGGCCTGAGTCTCCACGG - Intronic
1053311440 9:37023344-37023366 GCTCTGGCCCTGCATCTTCTTGG + Intronic
1054737861 9:68773750-68773772 GCTGTTGCTCTGAAGTTTTAAGG + Intronic
1057801122 9:98192164-98192186 GCTGTGGCCCGGGTGCTCCATGG - Intronic
1058633211 9:107010264-107010286 GCTTGGTCCCTGAAGCCTCAAGG + Intronic
1058707992 9:107653188-107653210 CGTGTGGCCCTGAAGCCACAGGG - Intergenic
1059457785 9:114410666-114410688 ACTATGCCCCTGAAGCATCATGG - Intronic
1061255209 9:129451271-129451293 GCTGTGGCCCTGCAGGTCCGTGG - Intergenic
1061933954 9:133847080-133847102 GCTGTAGGCCTGAGGCTCCAAGG - Intronic
1061999917 9:134210763-134210785 GCTGTGGCCCTTCAGCGCCAGGG - Intergenic
1062074197 9:134575616-134575638 GCTGGGGCACTGAGGCTGCAGGG - Intergenic
1189920577 X:45899682-45899704 GGGGTGGCCCAGAATCTTCATGG + Intergenic
1191842524 X:65523499-65523521 AGTGTGGCCCTGAGGCTTGAAGG + Intronic
1192560930 X:72127465-72127487 GCTGTAGCTCTGAGGGTTCAGGG + Intronic
1196404885 X:115350679-115350701 GATGTGCTCCAGAAGCTTCAAGG - Intergenic
1198523277 X:137474100-137474122 GCTGTGGCACTGAAGGTGGATGG + Intergenic
1199451242 X:147981245-147981267 TCCGTGGCCCAGAAGCTTCCGGG - Intergenic
1199451250 X:147981272-147981294 TCCGTGGCCCAGAAGCTTCCGGG - Intergenic
1199451258 X:147981299-147981321 TCCGTGGCCCAGAAGCTTCCGGG - Intergenic
1199451266 X:147981326-147981348 TCCGTGGCCCAGAAGCTTCCGGG - Exonic