ID: 966878165

View in Genome Browser
Species Human (GRCh38)
Location 3:184335377-184335399
Sequence CACCTTCTCTAGAGGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 235}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966878165_966878172 -10 Left 966878165 3:184335377-184335399 CCCTGCTCCCTCTAGAGAAGGTG 0: 1
1: 0
2: 1
3: 22
4: 235
Right 966878172 3:184335390-184335412 AGAGAAGGTGTTTATAGGTGGGG 0: 1
1: 0
2: 1
3: 28
4: 250
966878165_966878173 7 Left 966878165 3:184335377-184335399 CCCTGCTCCCTCTAGAGAAGGTG 0: 1
1: 0
2: 1
3: 22
4: 235
Right 966878173 3:184335407-184335429 GTGGGGATCCTTCCCAGAGCTGG 0: 1
1: 0
2: 0
3: 24
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966878165 Original CRISPR CACCTTCTCTAGAGGGAGCA GGG (reversed) Intronic
900385486 1:2408704-2408726 CTCCTGCTCCAGGGGGAGCAGGG + Exonic
902553968 1:17235843-17235865 AACCTTCTCTCAAGGGTGCAGGG + Intronic
902661167 1:17904963-17904985 CACCTTCTCTGGGGGAAGCCAGG + Intergenic
902913688 1:19621868-19621890 CAACTTGTCTAGAGAGAACAGGG + Intronic
903032239 1:20472286-20472308 CACCTGCCCAAGAGGGAACATGG + Intergenic
903180685 1:21603426-21603448 CAGCTTCTCTGGAGGCAGGAAGG + Intronic
903875783 1:26472362-26472384 CACCTCCTCTGGAGGGAGTGAGG - Intergenic
904235508 1:29114086-29114108 AACCATCTCTAGAAGGGGCAAGG - Intronic
904954140 1:34268842-34268864 CACCTCTTCCAGAGGAAGCATGG + Intergenic
906117001 1:43363751-43363773 CAGCTGCTCTACAGGGACCACGG - Exonic
907333116 1:53684222-53684244 TACCCTCTCTGGAGGGAGCCAGG + Intronic
907605124 1:55808322-55808344 CATCTTCACTAGAGGGAGACAGG + Intergenic
907891231 1:58638455-58638477 CCCCTTCTCAACAAGGAGCAAGG - Intergenic
908768896 1:67577997-67578019 CAACTTCTATAGAGGGAAGAGGG + Intergenic
909720664 1:78765825-78765847 CACCTTCACTAGAGGAAGACGGG - Intergenic
910102757 1:83596383-83596405 CACCTTCACCAGAAGGAGCAGGG - Intergenic
914827272 1:151145363-151145385 CACCTTCCTCAGAGGGAGCAGGG + Intronic
914902729 1:151720264-151720286 CAGCTTCTCTGGAGGGAGTATGG + Intronic
914934787 1:151968827-151968849 CAACTTCTCAAGAGGGAAGAGGG + Intergenic
918007164 1:180552581-180552603 CTCTTTCTCTAGAGGGAAGATGG - Intergenic
918074493 1:181160062-181160084 CACCTTCCCTCCAAGGAGCAAGG - Intergenic
918682654 1:187374284-187374306 TCCCCTCTCTAGAGGGAGGAGGG - Intergenic
919682542 1:200450200-200450222 CACCTTGTATAGAGGTAGTAAGG + Intergenic
919799663 1:201345976-201345998 CACCTCCTCAAGGAGGAGCAAGG + Intergenic
920442067 1:205987758-205987780 TACCTTCTGTAGAAGGAACAGGG + Intronic
921237604 1:213150225-213150247 CACCTTCACTAGAGGAAGACAGG - Intronic
921301422 1:213754669-213754691 CACCGACTGTAGAGGAAGCACGG - Intergenic
1063323410 10:5073624-5073646 CACCTTCTCAAGAGGGCCAAGGG + Intronic
1063479937 10:6366590-6366612 CACCTTATGCAGAGGGAGAAGGG - Intergenic
1066049111 10:31618859-31618881 GACCTTTTCCAGAGGGATCATGG - Intergenic
1066825920 10:39576324-39576346 ACCTTTCTTTAGAGGGAGCAGGG + Intergenic
1069147241 10:64909182-64909204 CAGCTACTCTAGAGAGAGCGTGG - Intergenic
1070441035 10:76443657-76443679 TACCATGTCTAGAGGGAACAAGG - Intronic
1071463186 10:85917828-85917850 CAGCTTCTCTGGAGAGAGCCCGG - Intronic
1072686460 10:97540120-97540142 ACCCTCCTATAGAGGGAGCAAGG + Intronic
1074747033 10:116544828-116544850 AACCTTCCTTAGAGGGAACAAGG + Intergenic
1075466293 10:122653199-122653221 CACCTTCGATATAAGGAGCAAGG + Intergenic
1078064081 11:8066501-8066523 CTCGTTCTCTGGAGGCAGCAGGG + Intronic
1079904740 11:26231282-26231304 CACATTCTCCAAAGGAAGCATGG - Intergenic
1081020371 11:37940176-37940198 CAGCTCCTCCAGAGGCAGCAAGG - Intergenic
1082784918 11:57311490-57311512 CAGCTGCTCCGGAGGGAGCAGGG - Intronic
1082852806 11:57780404-57780426 CACTTTATCAAGAAGGAGCATGG + Intronic
1083623276 11:64059386-64059408 CACCCCCACTACAGGGAGCAGGG - Intronic
1084091182 11:66880248-66880270 CACCCTCTCTCCAGGAAGCAGGG + Intronic
1084142068 11:67239244-67239266 CACCTTGTTTAGAGGCAGGAGGG + Intronic
1084329002 11:68419108-68419130 CACCATCTTTTGGGGGAGCAGGG - Intronic
1084899773 11:72300845-72300867 CACGCTCTCTTGATGGAGCAGGG + Intronic
1086180063 11:83940134-83940156 AGCCTTCTCTAAAGAGAGCAAGG - Intronic
1087828082 11:102788967-102788989 CACCGGCTGTACAGGGAGCATGG - Intergenic
1089961894 11:122623922-122623944 GAACTTCTCCTGAGGGAGCAGGG - Intergenic
1090360927 11:126172081-126172103 CACCTGCTGTAGAGGGATCCCGG + Intergenic
1091682612 12:2537869-2537891 CACCTTCACTAGAGATGGCAGGG - Intronic
1091966952 12:4752343-4752365 CACCTTCACTAGAGGAAGACAGG - Intronic
1097563377 12:61237000-61237022 CACCTTCACTAGAGGAAGTGAGG - Intergenic
1098813652 12:75128831-75128853 CATCTTCTCTAGAGAAAACATGG - Intronic
1100201454 12:92302819-92302841 CATCATCTCTAGAAGCAGCATGG - Intergenic
1101630955 12:106494311-106494333 CACCTTCTCTTGATGGAGGGTGG + Intronic
1101828713 12:108240703-108240725 CACCTACTCTACTGGAAGCAAGG - Intronic
1102677998 12:114671689-114671711 CACATTCTCTCGAGGGAGTCCGG + Exonic
1103124589 12:118410474-118410496 TCCCTTCTGTAGAGGGACCAAGG + Intronic
1103800013 12:123532191-123532213 CACCTTTCCTTGAGGGATCAGGG - Intronic
1105759264 13:23498512-23498534 CCCCTCCTCTTGAAGGAGCAAGG + Intergenic
1107725689 13:43296812-43296834 AATCTTTTCTAGAGGGAGAAAGG + Intronic
1108715367 13:53073234-53073256 CACCTACTCTAGGGGCAGCGTGG - Intergenic
1109018409 13:57051362-57051384 CACCTTCTCAAGACTGAGCCAGG + Intergenic
1109135916 13:58650426-58650448 CACAGTCTCTAGAGGGGACAAGG + Intergenic
1109522303 13:63530043-63530065 CACCTTCTCTAGATGAAGAAAGG - Intergenic
1110880959 13:80571730-80571752 CACCTTGTCTAAGTGGAGCAGGG - Intergenic
1112482776 13:99792370-99792392 CACCCTCAGTAGAGGGGGCAGGG + Intronic
1113148869 13:107239889-107239911 CACCTGCTGGAGAGGGACCATGG + Intronic
1115543959 14:34448275-34448297 TACCTTCACTAGACAGAGCAGGG + Intronic
1115935719 14:38549954-38549976 TACCTTCTTTAGAGGAAGGATGG + Intergenic
1117264375 14:54071671-54071693 CACCTTCACTAGAGGAAGACAGG - Intergenic
1117307323 14:54489155-54489177 GTCCTCCTCTAGAGGGAGCAGGG - Exonic
1118099101 14:62575192-62575214 CACCTTCACTAGAGGAAGACAGG + Intergenic
1119030434 14:71188111-71188133 CAGCTTCTCCAGAGGCTGCAGGG + Intergenic
1119959430 14:78837640-78837662 CACCTGCTCTAGAAGTGGCAGGG - Intronic
1121848390 14:97196121-97196143 CACCTGCTCTGGAGGTAGCAGGG + Intergenic
1121996991 14:98610515-98610537 CACCTTCTCTAGAGTGGACTGGG + Intergenic
1122268848 14:100559285-100559307 CATCTTCTCCAGAGGGAGAGAGG - Intronic
1122359362 14:101150469-101150491 CACAAACTCCAGAGGGAGCAGGG + Intergenic
1122977092 14:105175203-105175225 CACCTCCTCCAGGGGGACCAAGG + Intronic
1123971388 15:25511188-25511210 AACCATCTCTAGAGGGGCCAGGG - Intergenic
1124843985 15:33272683-33272705 CACCTTCACTAGAGGAAGACAGG - Intergenic
1125337325 15:38639659-38639681 GACCTTCTCAAGAGGGATCATGG - Intergenic
1127006593 15:54577572-54577594 GACCTTGTCCAGAGGGAGCCTGG - Intronic
1127965844 15:63922448-63922470 CCCCTTCTGCAGAGGGAGGATGG - Intronic
1128610065 15:69066106-69066128 CATGTTCCCTAGAAGGAGCATGG + Intergenic
1129389211 15:75212252-75212274 CACCTTCTGGACTGGGAGCAGGG - Intergenic
1130628212 15:85538196-85538218 GACTTGCTCTAGAGGAAGCAGGG + Intronic
1132368202 15:101273654-101273676 CACCTTCTCTACAGCAAGCCAGG + Intronic
1134864892 16:17597173-17597195 GACATTCTCTAGAAAGAGCATGG - Intergenic
1142414051 16:89931836-89931858 CACCTGCTCTAGGGGGAGAGAGG + Intronic
1142566214 17:841844-841866 CACCTGCTCTAGGTGGCGCACGG + Intronic
1142799471 17:2336524-2336546 GACCTTCGCGAGAGGGCGCAGGG - Exonic
1143780773 17:9228191-9228213 CCCATTCTTTAGAGGGGGCAAGG + Intronic
1146551551 17:33784386-33784408 CACATTCACTTGAGGGAGGAGGG - Intronic
1146937922 17:36824097-36824119 CACCTTCCCCAGAGGCACCATGG + Intergenic
1148548423 17:48534221-48534243 CACCTTCTCTTGTGTTAGCAGGG + Intergenic
1150863268 17:68823095-68823117 CACCTACTCTAACAGGAGCAGGG - Intergenic
1155004405 18:21715079-21715101 CACTTTCTCCAGAGGGTTCATGG - Intronic
1155223103 18:23703170-23703192 CAGCATCTCTAGTGGGAGCTAGG - Intronic
1157167973 18:45375864-45375886 CCCCTTCCCTAGAGGGAACAGGG + Intronic
1157559020 18:48633059-48633081 CACCTTCTCCAGGGTCAGCACGG - Intronic
1159533978 18:69691857-69691879 CACCTCCCCTTCAGGGAGCAGGG + Intronic
1162309944 19:9900297-9900319 GACCTTCTCCAGCTGGAGCAGGG + Intronic
1164434801 19:28219858-28219880 CAGCTTCTCTAACGGGAGCAGGG + Intergenic
1164452979 19:28382618-28382640 CACCATCTCTCGACAGAGCAAGG - Intergenic
1166235958 19:41456805-41456827 CAGCATCTCGAGATGGAGCAGGG + Intergenic
1168295455 19:55375418-55375440 CACCTGCATTAGAGGGAGAAGGG - Intergenic
925605721 2:5657972-5657994 CCCCATCTTTAGAGTGAGCATGG - Intergenic
929878248 2:45814789-45814811 CATCCTCTCTGGAGGGAGGAGGG + Intronic
929926326 2:46214751-46214773 CACCTTCCCTAGAGGAAGACAGG - Intergenic
930290821 2:49490961-49490983 CCCCACCACTAGAGGGAGCATGG - Intergenic
930935442 2:56944481-56944503 CACCTTCACTAGAGGAAGACAGG - Intergenic
931477463 2:62603777-62603799 CACCATTTCTAGAGTAAGCAAGG + Intergenic
933833051 2:86225836-86225858 CAGCTTCTCTATGGGGAGCCAGG + Intronic
936484985 2:112917946-112917968 CTCCTTCCCTAGAAGGGGCAAGG - Intronic
938310044 2:130283942-130283964 CACCTTCTCCAGGGGGGTCAGGG - Intergenic
938444875 2:131368427-131368449 CACCTTCTCCAGGGGGGTCAGGG + Intergenic
938467075 2:131531223-131531245 CACCTTCTGCAGAGTGAGCCGGG + Intronic
940049120 2:149442451-149442473 CACCTTCTCTTAAGGGACCAAGG + Intronic
941302813 2:163825422-163825444 CACCTTCACTAGAGGAAGACAGG - Intergenic
942425957 2:175861091-175861113 CATCTCTTCTAGAGGGAACATGG - Intergenic
943357965 2:186882469-186882491 CTCCTGCTCTAGAGGGCCCATGG - Intergenic
945976563 2:216275709-216275731 TTCCTTCCCTGGAGGGAGCACGG - Intronic
946778751 2:223171388-223171410 CACCTTCTCTACAGGGTGGCAGG + Intronic
948017891 2:234704957-234704979 CAGCTTCTGCAGAGGGGGCAGGG + Intergenic
948044023 2:234928821-234928843 CAGCTTCTCTAGTGGGAGGTGGG + Intergenic
1170488892 20:16850412-16850434 CACCTTCTTTTGAGGTAGAAAGG - Intergenic
1170770981 20:19332313-19332335 CACCCCCTCAACAGGGAGCAAGG + Intronic
1172649215 20:36491291-36491313 AAGCTTCTCTAGAAGAAGCAAGG + Intronic
1174103635 20:48146669-48146691 CACCTCCTGGAGAGGGACCACGG + Intergenic
1174384021 20:50176082-50176104 CACCAGCCCTAGAGGGTGCAAGG + Intergenic
1174455867 20:50648434-50648456 CCGCTGCTTTAGAGGGAGCATGG - Intronic
1174708070 20:52677094-52677116 CACCTTACCTAGAGGGAGGCAGG - Intergenic
1176126979 20:63479960-63479982 CACCTTCCCGAGAGAGACCAGGG - Intergenic
1176197935 20:63846251-63846273 CGACTTCCCTGGAGGGAGCAAGG - Intergenic
1178728295 21:35075204-35075226 CATCTTTTCTGTAGGGAGCAAGG + Intronic
1178957098 21:37032428-37032450 CTCCTTCTCAGCAGGGAGCATGG + Intergenic
1179908159 21:44434824-44434846 CACCTTCTCCCCACGGAGCATGG - Intronic
1180746842 22:18095230-18095252 CTCTTTCTCTGGAGGGAGCTGGG - Exonic
1180943986 22:19679683-19679705 CACCTGCTCCAGAGGACGCATGG + Intergenic
1183273298 22:36875519-36875541 CTTCTTCTGTAGAGGGAGGAGGG - Intronic
1183985720 22:41569101-41569123 CTCCCTCTCTCTAGGGAGCAGGG - Intronic
1184277699 22:43419598-43419620 CAGCTGCTCTAGAGGGTGCTGGG + Intronic
949788080 3:7763447-7763469 CACATATTTTAGAGGGAGCATGG + Intergenic
950837935 3:15938516-15938538 GACCTAATCTAGTGGGAGCAGGG + Intergenic
955783664 3:62513092-62513114 CAAAATCTCTAGAGGGAACAAGG + Intronic
956956967 3:74352379-74352401 CACCTTCACTAGAGGCAGGATGG + Intronic
958484007 3:94680143-94680165 CACCTTCTCAAGAGTGAACCAGG + Intergenic
959042090 3:101433305-101433327 CACCTTCACTAGAGGAAGACAGG + Intronic
959116690 3:102186910-102186932 AGCCTGGTCTAGAGGGAGCAAGG + Intronic
960700374 3:120433597-120433619 TACATGCTCTAGAGGGAGGAAGG + Intronic
961617421 3:128193817-128193839 CTCCTCCTCTGGAGGGAGGAAGG - Intronic
961668508 3:128509222-128509244 CACCTCCCCCAGAGGGAGCATGG - Intergenic
962465754 3:135657069-135657091 CACCTTCACTAGAGGAAGACAGG + Intergenic
966878165 3:184335377-184335399 CACCTTCTCTAGAGGGAGCAGGG - Intronic
967514753 3:190353981-190354003 CACTTTCTCTAGAGGGTCTAAGG + Intronic
972909504 4:43797297-43797319 CCTCTTCTCTAGAGGAAGAAAGG - Intergenic
974123341 4:57665977-57665999 CAGCTGCCCTAGAGGCAGCAAGG - Intergenic
976451597 4:85197018-85197040 CACCTTCTCTAAAGGAAGACAGG - Intergenic
978684653 4:111425303-111425325 CACCTTCACTAGAGGAAGAGAGG + Intergenic
981115258 4:140982610-140982632 CAGCTTCTCTGTAGTGAGCATGG + Intronic
985350233 4:189053503-189053525 CCCCTTTTCTAGAGGGATAATGG - Intergenic
985724165 5:1506953-1506975 CACCTTCACCAGAGGCAGCAGGG + Intronic
986805499 5:11305077-11305099 CACCACCTCTGAAGGGAGCAAGG - Intronic
987813528 5:22870936-22870958 CAGTTTCTCTATAGTGAGCATGG - Intergenic
990977417 5:61571895-61571917 CATCTTGTCTAGAGGCAGAAAGG - Intergenic
991988078 5:72310000-72310022 CACTGTCTCTAGTGGGAGCCAGG + Intronic
992650609 5:78855650-78855672 CTCCTTCTCTGGGGGAAGCACGG + Intronic
993756877 5:91742660-91742682 CAGGCTCCCTAGAGGGAGCAAGG - Intergenic
994633667 5:102318060-102318082 CACCTTATCTAGAGGAAGACAGG - Intergenic
995353133 5:111205350-111205372 CAGCTCCTCCAGAGGGACCAAGG + Intergenic
995501672 5:112813846-112813868 CTCCTACTCTAGAGGGTACAAGG - Intronic
995650003 5:114360531-114360553 CACCTTCTTTAGGGGGAGACGGG + Intergenic
998932324 5:147194911-147194933 CATCTTGTCTGGAGGAAGCAGGG - Intergenic
999345900 5:150819298-150819320 CACCTTCACTAGAGGAAGACAGG + Intergenic
1000404114 5:160868143-160868165 CAGCTTCTCTAGATGCAGAAAGG - Intergenic
1002025150 5:176391775-176391797 CAGCTCCTTCAGAGGGAGCATGG + Intronic
1004345620 6:14846560-14846582 CAGGTGCTCAAGAGGGAGCAGGG + Intergenic
1004660490 6:17705912-17705934 CATGTTCTCTCGAGGGAGAAAGG - Intronic
1006252298 6:32797915-32797937 CACCTTCTCCACTTGGAGCAAGG - Intergenic
1006295669 6:33168963-33168985 CACCTTCTCCAGGGGGGCCAGGG + Exonic
1007219325 6:40265960-40265982 CACCTTCACCAGAGGCAGCTGGG - Intergenic
1008177377 6:48285770-48285792 CACCTTCACTAGAGGTAGACAGG - Intergenic
1008291076 6:49716776-49716798 TTCCTTCACTAGAGAGAGCAAGG + Intergenic
1008956462 6:57221767-57221789 CACCTTCTCTAGCTGGAACTTGG + Exonic
1009866974 6:69409493-69409515 CACCTGCTCTGGAGGTACCAGGG - Intergenic
1010272455 6:73929558-73929580 CATCTTTTCTGGAGGGAACATGG + Intergenic
1010299283 6:74241315-74241337 CACCTTCACTAGAGGAAGACAGG - Intergenic
1010639531 6:78307292-78307314 CACCTTCACTAGAGGAAGACAGG - Intergenic
1011706284 6:90004436-90004458 CCCCTTCTCTAGAGGGTACAAGG + Intronic
1012395448 6:98791000-98791022 CTCCTACTCTAGAGGGACCAAGG + Intergenic
1015095064 6:129406503-129406525 GTACTTCTCTAGAGGGTGCAAGG + Intronic
1016135301 6:140533100-140533122 CACCTTCACTAGAGGAAGAACGG + Intergenic
1017393194 6:153963961-153963983 CATCTTCCCTAGAGGCAGGAAGG + Intergenic
1018512487 6:164540452-164540474 CCCCTGCTCTAGAGGGAGCATGG - Intergenic
1019305869 7:335496-335518 GACCTGCTCTAGAGAGCGCAGGG + Intergenic
1020159289 7:5756179-5756201 CACCTTCTCAGGAGGCAGGATGG - Intronic
1022005728 7:26263824-26263846 GACCTTGTCTAGAGGAATCAGGG - Intergenic
1022470456 7:30678951-30678973 CACCATCTGGAGAGGGAGCCTGG - Intronic
1023212320 7:37819996-37820018 CAGCTTCTCTGGGTGGAGCAGGG + Intronic
1024176333 7:46844628-46844650 CAACATCTGCAGAGGGAGCATGG - Intergenic
1024889252 7:54182143-54182165 CTCCCTCTTTAGAGGGAGAATGG - Intergenic
1025937490 7:66048927-66048949 CAACGGCTCTAGAGGAAGCATGG + Intergenic
1027443499 7:78245809-78245831 CTTCTTTTCTGGAGGGAGCATGG - Intronic
1028339256 7:89697507-89697529 CACCTTCACTAGAGGAAGACAGG + Intergenic
1028697446 7:93731411-93731433 TACCATCTCTAGAAGGAGAATGG + Intronic
1028971293 7:96861278-96861300 CACCTACTCTAGGGGGAGGCAGG + Intergenic
1030306779 7:108026837-108026859 CCCCTTCTCAAGTGGCAGCATGG + Intronic
1031965776 7:128027299-128027321 CACCTTCTCCTGAGGGGGCCTGG + Exonic
1033576749 7:142692668-142692690 CACCTTCACTAGATGGGTCAAGG - Intergenic
1036709335 8:11068255-11068277 CACCTCCTCTAGAGGCAGCCTGG + Intronic
1036754392 8:11462790-11462812 CATCTGCTCCAGAGGCAGCAGGG + Intronic
1037670806 8:21013610-21013632 CACCTTATCCAGAGGAAGGAGGG - Intergenic
1037784384 8:21893799-21893821 TACCTTCTTTTGAGGGAGGAGGG - Intergenic
1038328241 8:26588524-26588546 CACCTCCTCTAGAGAGAGCCTGG - Intronic
1040105477 8:43539145-43539167 CACCTTCTCGACATGCAGCAGGG - Intergenic
1040710042 8:50176956-50176978 CACCTTCTCTTGACTGAACAGGG - Intronic
1041082134 8:54224029-54224051 CACCTGGTCTAGTGTGAGCAGGG - Intergenic
1043338489 8:79207167-79207189 CACCCTATTTAGAGGTAGCATGG - Intergenic
1043367117 8:79545637-79545659 CACCTTCACTAGAGGGAGACAGG + Intergenic
1044714529 8:95088340-95088362 TACCTTTTCTAGAGGGAATATGG - Intronic
1046332437 8:112737025-112737047 CAACTTTTCTAAAGTGAGCACGG - Intronic
1046404208 8:113751190-113751212 CATTTTCTCTGGAGGGAGGAGGG + Intergenic
1048448339 8:134509841-134509863 CGCCTTCTCCAGAGGATGCATGG + Intronic
1049830898 8:144700248-144700270 CTCCTTCTCCTGAGGGAGCCAGG + Intergenic
1050177714 9:2885531-2885553 CACCTTCTCTAGTGAGATTAGGG - Intergenic
1050182713 9:2937392-2937414 CTCCTTCTCCAGAGAGACCAGGG + Intergenic
1055000815 9:71447113-71447135 CGCCTTCTCTGGAGAGTGCAGGG + Intergenic
1056189250 9:84168265-84168287 CACCTTCGCTGGAGGGACCCAGG - Intergenic
1056534207 9:87513833-87513855 CACCTGGTTTAGAGGAAGCAAGG - Intronic
1056541271 9:87573379-87573401 CACCATCTCTCCAGGGAGCAGGG - Intronic
1057297588 9:93858565-93858587 TTCCTGCTCTAGAGGGAGAAAGG - Intergenic
1058768036 9:108201151-108201173 CACCTTCACTAGAGGAAGACAGG + Intergenic
1058836688 9:108863601-108863623 CACCTTCTGTAGAGGAAGAAAGG - Exonic
1059106451 9:111515910-111515932 CACCTTCTCTTGGGGCAGGAGGG - Intergenic
1061195115 9:129103248-129103270 CATAACCTCTAGAGGGAGCATGG + Intronic
1061915330 9:133749187-133749209 CACCTTCACTAGAGGAAGACAGG - Intergenic
1186202434 X:7168105-7168127 CACCTTCTCTTGAGTGAGGGTGG - Intergenic
1187447252 X:19370697-19370719 CACAATCTCAAAAGGGAGCATGG - Intronic
1188068568 X:25692434-25692456 CACCTTCACTAGAGGAAGATAGG - Intergenic
1188486400 X:30686974-30686996 CAACGTGTCTAGAGGGAACAGGG - Intronic
1189013167 X:37067602-37067624 CATCTTCTCTAGATGAAGAAAGG - Intergenic
1189289348 X:39874264-39874286 CACCACCTCTTGAGGGAGTAAGG - Intergenic
1190530612 X:51371102-51371124 CACCTTCACTAGAGGAAGACAGG + Intergenic
1191812188 X:65201261-65201283 CACCTTCTCAAGACTGAACAAGG - Intergenic
1191957374 X:66658941-66658963 CACCTTCACTAGAGGAAGACAGG + Intergenic
1193528380 X:82622007-82622029 TACCTTCTCTAGAGTGAACCAGG + Intergenic
1193670500 X:84378702-84378724 CACTTTCTCTAGAGGAAGAAAGG + Intronic
1194605927 X:95977502-95977524 CACCTTCACTAGAGGAAGACAGG + Intergenic
1197362944 X:125530083-125530105 CACCTTCACTAGAGGAAGAGAGG - Intergenic
1197681188 X:129387011-129387033 TAGCATCTTTAGAGGGAGCATGG + Intergenic
1199207928 X:145170966-145170988 CAGCTTATAGAGAGGGAGCAAGG + Intergenic
1199299539 X:146196846-146196868 CAACTTCTCAGGAGGGATCATGG - Intergenic
1199454806 X:148016544-148016566 CACCTTCACTAGAGGAAGACAGG - Intronic
1200894600 Y:8361472-8361494 CACCCTGTCTACAGGGAACATGG - Intergenic
1201229358 Y:11848765-11848787 CACCTTCCCTAGACTGAGCCAGG + Intergenic