ID: 966881611

View in Genome Browser
Species Human (GRCh38)
Location 3:184354054-184354076
Sequence GGCTGTGGGTGAAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 935
Summary {0: 1, 1: 0, 2: 7, 3: 112, 4: 815}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966881611_966881623 7 Left 966881611 3:184354054-184354076 CCCTCTGCCCTTCACCCACAGCC 0: 1
1: 0
2: 7
3: 112
4: 815
Right 966881623 3:184354084-184354106 CACCCAGCCCTCCGTACTGGTGG 0: 1
1: 0
2: 1
3: 13
4: 129
966881611_966881626 10 Left 966881611 3:184354054-184354076 CCCTCTGCCCTTCACCCACAGCC 0: 1
1: 0
2: 7
3: 112
4: 815
Right 966881626 3:184354087-184354109 CCAGCCCTCCGTACTGGTGGCGG 0: 1
1: 0
2: 0
3: 5
4: 114
966881611_966881630 27 Left 966881611 3:184354054-184354076 CCCTCTGCCCTTCACCCACAGCC 0: 1
1: 0
2: 7
3: 112
4: 815
Right 966881630 3:184354104-184354126 TGGCGGCCCCAGCCGAGCTCAGG 0: 1
1: 0
2: 1
3: 16
4: 174
966881611_966881622 4 Left 966881611 3:184354054-184354076 CCCTCTGCCCTTCACCCACAGCC 0: 1
1: 0
2: 7
3: 112
4: 815
Right 966881622 3:184354081-184354103 TGGCACCCAGCCCTCCGTACTGG 0: 1
1: 0
2: 0
3: 4
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966881611 Original CRISPR GGCTGTGGGTGAAGGGCAGA GGG (reversed) Intronic
900136437 1:1119413-1119435 GGCTGTGAATTAAGAGCAGAAGG + Intergenic
900243410 1:1627242-1627264 GTCTGAGAGTGAGGGGCAGAGGG + Intronic
900288791 1:1915066-1915088 GGCTGGGGGTGAAGGGGGAAAGG - Exonic
900399015 1:2465364-2465386 GCCGGAGGGTGGAGGGCAGAGGG - Intronic
900461219 1:2802842-2802864 GTCTGAGGGTGCAGGGCAGGGGG + Intergenic
900514326 1:3074023-3074045 GGCTGTAGGGGGAGGGAAGACGG + Intronic
900670532 1:3851067-3851089 GCCTGTGGCTGGAGGGCAGGAGG - Intronic
900753300 1:4415160-4415182 GGGGTTGGGTGGAGGGCAGAAGG - Intergenic
900796400 1:4711246-4711268 GGCTCTGGGTGAGGGGCAGCGGG + Intronic
900825209 1:4920846-4920868 GGCAGTGGGTGAGGGGCAGGTGG - Intergenic
901002543 1:6155756-6155778 GGATGGGGGTGCAGGTCAGAAGG - Intronic
902209345 1:14893535-14893557 GGGTGTGGAGGAAGGGAAGATGG - Intronic
902315597 1:15616470-15616492 GGCTGTGGGTGCAGGTAAGTAGG - Intergenic
902768158 1:18630574-18630596 GGCTGGGGGAGAAGGGGAGGGGG - Intergenic
903031847 1:20469264-20469286 TGCTGTGGGTGCAGAGAAGAGGG - Intergenic
903043896 1:20552216-20552238 TGCTGTGGGTGAGGGGCAGCAGG + Intergenic
903623962 1:24718043-24718065 GGCTGTGGCTGCTTGGCAGAAGG + Intergenic
904082769 1:27882428-27882450 GGCTGTGGGTGACCGGCTGGAGG + Exonic
904326109 1:29727880-29727902 GGCTGTGGGGGAGGGGGTGAGGG + Intergenic
904482088 1:30800515-30800537 GGCCCTGGGTGAAGGGCGGAAGG - Intergenic
904621162 1:31776198-31776220 GGCTGTGGGTGAAGATGACATGG - Intergenic
905406411 1:37735440-37735462 GGCTGGGGGTGCGGGGAAGAGGG + Intronic
905767379 1:40612654-40612676 GGCTGTGGGAGGTGGGCACAGGG - Intergenic
905874791 1:41426013-41426035 GGCTGGGGGTGAGGAGCGGATGG + Intergenic
906095321 1:43219361-43219383 GCCTTTGGGAGAAGGACAGAAGG - Intronic
906625193 1:47319324-47319346 GGTTGGGGGAGAAAGGCAGAGGG + Intergenic
906986108 1:50685125-50685147 GGCTGAGGGAGAAGAGCTGAGGG + Intronic
907326021 1:53638957-53638979 GGCAGGGAGTGGAGGGCAGAAGG + Intronic
907853561 1:58279857-58279879 GGCTCTGACTGATGGGCAGAAGG - Intronic
908001540 1:59685100-59685122 GGCTGTGGGGGATACGCAGAGGG - Intronic
908098200 1:60762814-60762836 GGCTGTGTGTGGTGGGAAGAGGG + Intergenic
908110440 1:60891828-60891850 GGCTGTGAGTGAGAGGCATATGG - Intronic
908460460 1:64343999-64344021 GCCTTTGGCTGGAGGGCAGATGG - Intergenic
908577520 1:65476558-65476580 GGATGTGGATAAAGGTCAGAGGG - Intronic
909942533 1:81626919-81626941 GGGTGTGGGTGGAGGGTAGGTGG + Intronic
910626850 1:89316459-89316481 GGCAGTGGGTGCAGTGCAGAGGG + Intergenic
910715135 1:90222403-90222425 GGCTGTGGGTGAGGCTCTGAGGG + Intergenic
911472674 1:98337497-98337519 GGCAGAAGGTGAAGGGAAGAAGG + Intergenic
911695059 1:100881614-100881636 GGGGATGGGTGAAGGACAGAAGG - Intronic
912496333 1:110094485-110094507 GGTTGGGGGTAAATGGCAGAAGG - Intergenic
912515945 1:110216666-110216688 GGGTGGGGGTGAAGGGCCCAGGG - Intronic
912552704 1:110494408-110494430 GGCTGTGGCAGAAGGACAGACGG - Intergenic
912941823 1:114051806-114051828 GGCTATGGGTGAAATGGAGAGGG - Intergenic
912945509 1:114081000-114081022 GGCAGTGGGTGAAGTGGAGGTGG + Intergenic
913090504 1:115473612-115473634 GGATGTGGGGTAAGGGCAGATGG + Intergenic
913130505 1:115834348-115834370 GGCTGTGGGCAAAGAGAAGAAGG + Intergenic
913258266 1:116974867-116974889 GGCAGTGGGTGCAGGACAGTAGG + Intronic
913997084 1:143660543-143660565 GGCTGTGTGTGCAGGCCAAATGG - Intergenic
914505169 1:148282244-148282266 GGCTGTGTGTGCAGGCCAAATGG + Intergenic
914507396 1:148301904-148301926 GGCTGTGTGTGCAGGCCAAATGG - Intergenic
915205000 1:154263556-154263578 TGCTGTGGATGAAGGGTGGAGGG + Intronic
915592810 1:156880240-156880262 GGCTGTGGCAGAGGGGCAGAAGG - Intronic
915954428 1:160210668-160210690 GGCTTTGGGAGAATGGCAAAAGG - Intronic
917580991 1:176377584-176377606 GGCTAGGGGTGAAGGTGAGAGGG + Intergenic
918103929 1:181400438-181400460 GGCCGTGGCTGCAGGGAAGAGGG + Intergenic
918737869 1:188089227-188089249 TGCTGTGGGTGACATGCAGAGGG - Intergenic
919726694 1:200889042-200889064 GAGAGTGGGTGAAAGGCAGAGGG - Intergenic
919743195 1:200992681-200992703 GGCTGTGGGTGAGGGCCACCAGG - Intronic
919745029 1:201003505-201003527 GGGTGAGGCTGCAGGGCAGAGGG + Intronic
920066345 1:203272591-203272613 GCCTGAGGGTGAAGGTTAGAGGG - Intronic
920560125 1:206932809-206932831 AGCCATGGGAGAAGGGCAGAGGG + Intronic
920694852 1:208174432-208174454 GGCTGTGGAGGGAGGGAAGAAGG + Intronic
921081150 1:211739150-211739172 GGCGGGGGGTGAAGGGGAGCTGG + Intergenic
921389656 1:214605758-214605780 CGCTGTGGGTGGAGGGCACCAGG - Intronic
921594768 1:217042594-217042616 GCCTGTGGGGCAAGGGCAGGGGG - Intronic
922121286 1:222671629-222671651 GGATGTGGGTGAGGGAGAGATGG + Intronic
922188309 1:223295567-223295589 TGCTGTGGGTGCAGGTCGGAAGG + Intronic
922481271 1:225941264-225941286 GGCCTGGGGTGAAGGGAAGAGGG + Exonic
922557312 1:226542244-226542266 GGCTGTGCGTGAAGTGCTGCAGG - Intergenic
922727192 1:227927961-227927983 GGAGGAGGGTGAAGGGAAGAGGG + Intronic
924436106 1:244044507-244044529 TGCTGAGGCTTAAGGGCAGAGGG - Intergenic
924503209 1:244655885-244655907 GGGCTTGGGTGAAGGGCTGAGGG + Intronic
924716228 1:246576848-246576870 GGATGTGGGTGGAGGGTAGGGGG - Intronic
1062805114 10:413682-413704 GGGGGTGGGCAAAGGGCAGAGGG + Intronic
1062805130 10:413778-413800 GGGCGTGGGCAAAGGGCAGAGGG + Intronic
1063191156 10:3696186-3696208 TGCTGTGGGAGAAGGACACAAGG - Intergenic
1063477426 10:6341053-6341075 GGTGGAGGGTGAAGGGCAGTAGG + Intergenic
1063721275 10:8584089-8584111 GGCTGTGGGTGTAGGGGAGCAGG + Intergenic
1063841320 10:10075319-10075341 GACAGTGGGTGTAGGGCAGTGGG - Intergenic
1063929125 10:11011403-11011425 GGAGGTGGGTGAGGGGGAGAGGG + Intronic
1063961932 10:11314003-11314025 GGCTTTGGGTGAAGGACATGTGG - Intronic
1064301716 10:14128841-14128863 GGGTGAGAGTGTAGGGCAGATGG - Intronic
1064811658 10:19206873-19206895 GTCTTTGGCTGTAGGGCAGAAGG - Intronic
1065204511 10:23344219-23344241 GGATGGGGGGGAAGGGGAGAGGG + Intronic
1065261203 10:23925441-23925463 GGAGGTGGGTTGAGGGCAGAAGG - Intronic
1065340218 10:24697273-24697295 GGGTCTGGGTGAAGGGGTGAGGG + Intronic
1065382431 10:25103339-25103361 GGCTGTGGAGACAGGGCAGAAGG - Intergenic
1065722596 10:28641208-28641230 GGCTCTGGGAGATGCGCAGATGG + Intergenic
1066425804 10:35306673-35306695 GCATGTGGGAGAAGGGGAGAGGG - Intronic
1066447576 10:35497910-35497932 GGCAGAGGGAGATGGGCAGAAGG - Intronic
1066996048 10:42563933-42563955 GGCTGTGGAAGAAGGAAAGAAGG - Intergenic
1067187592 10:44043747-44043769 GATTCTGGGTGAAAGGCAGAGGG + Intergenic
1067455798 10:46418616-46418638 GGATGTGGGAGGAGGGCAAAGGG - Intergenic
1067544601 10:47183939-47183961 CTCTGTGGTTGGAGGGCAGAGGG + Intergenic
1067565880 10:47336456-47336478 GGCTGTGGCTGCCTGGCAGACGG - Intergenic
1067631402 10:47966023-47966045 GGATGTGGGAGGAGGGCAAAGGG + Intergenic
1067668108 10:48295871-48295893 GGGTGTGGGTGAAGCGCAGAAGG + Intergenic
1067668767 10:48301014-48301036 GGGTGAGGGTGAAGGCCAGGAGG + Intergenic
1068544094 10:58327119-58327141 TGCTGTGGGTGACGGTCATATGG + Intergenic
1068620453 10:59176444-59176466 GGCAGTGGCTGGAGGGCAGGTGG + Intergenic
1068955113 10:62814713-62814735 GGCTGGGGGTGGAGGGGAGTTGG - Intronic
1069090475 10:64194170-64194192 GTCGGGGGGTGAAGGGCAGGGGG + Intergenic
1069552999 10:69377358-69377380 GGGTGGGGGTGATGGGCTGATGG - Intronic
1069568467 10:69479516-69479538 GGCTGGGGGTGGGGGGCACACGG - Intronic
1069594806 10:69663742-69663764 GGCAGAGGGTGGAGGGCAGCTGG - Intergenic
1069725222 10:70573254-70573276 GGCAGGGGGTCAGGGGCAGAGGG + Intergenic
1069909598 10:71751324-71751346 GGTTGAGGGTGAGGGGCAGAGGG - Intronic
1069909622 10:71751392-71751414 GGTTGAGGGTGAGGGACAGAGGG - Intronic
1069909645 10:71751460-71751482 GGTTGAGGGTGAGGGACAGAGGG - Intronic
1069909668 10:71751528-71751550 GGTTGAGGGTGAGGGACAGAGGG - Intronic
1070367415 10:75750481-75750503 GGCGGGGGGTGGGGGGCAGAGGG + Intronic
1070813969 10:79311910-79311932 GGCTGGGGGTGAAGAACAGGAGG - Intronic
1070839673 10:79475406-79475428 GGCTGTGAGGGGTGGGCAGAGGG + Intergenic
1072001708 10:91201581-91201603 GGCTGTGGGTGGAGGGAGGAGGG - Intronic
1072384288 10:94908623-94908645 GGCAGTGGGTGCAGGACAGTGGG + Intergenic
1072914172 10:99527012-99527034 GGAAGTGGGGGAAGGGCAGAAGG + Intergenic
1073432389 10:103494609-103494631 GGCTGGGGGTGGAGGGCAGCCGG + Intronic
1075077647 10:119361641-119361663 GGCAGTGGGGGAGGCGCAGAGGG + Intronic
1075165719 10:120066620-120066642 GTCTGTGGTTGAAGGCCCGAGGG + Intergenic
1075165901 10:120068098-120068120 GGCTGTGGGTGAGGGGAATTGGG - Intergenic
1075520330 10:123139859-123139881 GGCTCTGGTTGGAGGGAAGAAGG + Intergenic
1076364649 10:129914199-129914221 GGATGTGGGTGCAGGGCTGGAGG - Intronic
1076407167 10:130220308-130220330 GCTTGTGGGTGAAGGGCTGAGGG + Intergenic
1076623796 10:131809395-131809417 CACTGGGGGTGAATGGCAGATGG - Intergenic
1076754968 10:132564672-132564694 GGCAGTGAGTGCAGGGCAGACGG + Intronic
1076791580 10:132779539-132779561 GGCTGTGAGTGAATGGAAAACGG - Intronic
1076839888 10:133040683-133040705 GGCTGTGGGTGAGGTGGGGAAGG + Intergenic
1076873837 10:133206422-133206444 GACTGTGGGTGAGGGGCGCAGGG + Intronic
1076888877 10:133274473-133274495 GGCGGGGGGCGGAGGGCAGAGGG + Intronic
1076907938 10:133372762-133372784 GGCTGTGGGTGCGGGTCAGGTGG + Intronic
1077015136 11:395988-396010 GGCAGAGGGTGGAGGGCGGAGGG - Intronic
1077700030 11:4432532-4432554 GGCTGTGGGTGGTGGGCAAGTGG + Intergenic
1077771326 11:5221978-5222000 GGCAGTGGGTGCAGGACAGTAGG - Intergenic
1077905203 11:6527320-6527342 GGCTGGGGGAGGAGGGCAGGTGG + Intronic
1078475066 11:11622537-11622559 GCCGGTGGCTGAAGGGCAGAGGG - Intergenic
1079242271 11:18729350-18729372 GGCGGGGGGTGAGGGGCAGATGG - Intronic
1079334523 11:19559607-19559629 GGCTGAGGGTGGATGGCAGGAGG + Intronic
1079384141 11:19963988-19964010 TGCAGTGGGTGAGGGGCTGAGGG - Intronic
1080392296 11:31859666-31859688 GGCTGAGTGTGAAGAGCACAGGG + Intronic
1081704106 11:45170680-45170702 GGTTTTGAGTGGAGGGCAGAGGG + Intronic
1081909947 11:46694341-46694363 GGCTCTCGGTGGAGGCCAGATGG - Intronic
1081965224 11:47165212-47165234 AGCTGTGGGGGCAGGACAGAAGG + Exonic
1082619156 11:55399259-55399281 GACTGTGGGTGCAGGACAGTGGG - Intergenic
1083294458 11:61707635-61707657 GGCTGGGGCTGAAGGCCAGCTGG + Intronic
1083327561 11:61880583-61880605 AGCAGTGGGTGAAGGGTAGGTGG + Intronic
1083664597 11:64267591-64267613 GGCGCTGGGTGGAGGGCAGGAGG + Intronic
1083681044 11:64352044-64352066 GGCGGGGGGCTAAGGGCAGACGG - Intronic
1083734074 11:64669728-64669750 GGTTGTGGGAGAAGGGCCAAGGG + Intronic
1083740220 11:64706024-64706046 AGCTGGGAGTGAAGTGCAGAGGG - Intronic
1083763859 11:64832958-64832980 GGCTGTGGGGAAAGTGGAGAAGG + Exonic
1083861648 11:65423216-65423238 GGCAGTGGGTGCAGGGCTGCAGG + Intergenic
1084001000 11:66295437-66295459 GGCTGCGGCTGAAGGGCAGGCGG - Exonic
1084116431 11:67045334-67045356 GGCAATAGGTGATGGGCAGACGG + Intronic
1084167671 11:67383573-67383595 GGCTGGAGGTGGAGGGGAGATGG - Intronic
1084465586 11:69321134-69321156 AGCTGTAGGTGAAAGGGAGAGGG + Intronic
1084545181 11:69811835-69811857 TGCAGTGGGGGAAGGGCAGAAGG + Intronic
1084557892 11:69885720-69885742 GGCTGAGGGGGGAGGGCAGAAGG + Intergenic
1084592608 11:70099190-70099212 GGCTGGGGGCGAAGGGGACACGG + Intronic
1084752791 11:71215062-71215084 GGCTGTGGGAGAATGGCTGGTGG - Intronic
1084962793 11:72726125-72726147 GGCAGTGGGAGAAGGGGACAGGG + Intronic
1084988501 11:72900227-72900249 GGGTGTGGGTCAAGGGCGGGAGG - Intronic
1085049923 11:73375233-73375255 GGTTGTGGGGGAAGGGCATAAGG - Intergenic
1085471101 11:76758658-76758680 GGCTGAGTGTGAAGGGCATAGGG + Intergenic
1085710264 11:78823212-78823234 TGCTGTGGGTTAAGGGTGGAGGG - Intronic
1085740112 11:79071068-79071090 GGGTGTCAGTGTAGGGCAGAAGG - Intronic
1086222919 11:84471382-84471404 GGTTGTTGGAGAAGGACAGAGGG - Intronic
1086232670 11:84589116-84589138 GGTTGTGGCTGAAGGGTTGAAGG + Intronic
1087006460 11:93476743-93476765 GGATGTGGGGGCAGTGCAGATGG + Intergenic
1087138251 11:94741084-94741106 GGCTGGGGTTGGAGGGCGGAGGG + Intronic
1087195270 11:95298671-95298693 TGCACTGGGAGAAGGGCAGAGGG + Intergenic
1087338091 11:96868668-96868690 GGCTGTGGGTGAAGGTGAGTAGG + Intergenic
1088561646 11:111121627-111121649 GGAGTTGGGTGAGGGGCAGAGGG + Intergenic
1088878106 11:113952456-113952478 GGCTGTGGGAGAGGTACAGAGGG - Intergenic
1089080435 11:115772113-115772135 GGCTGTGGGATAAGGGCTGTGGG + Intergenic
1089110682 11:116053441-116053463 GGTTGGGGGTGCAGGGCAGTGGG - Intergenic
1089127855 11:116190029-116190051 AGCTGGGGGTGGAGGGGAGAGGG + Intergenic
1089197544 11:116703491-116703513 GGCTGTGGGGGAAGGGAAGAGGG - Intergenic
1089220409 11:116866294-116866316 GGCTGTGGAGGAAGGGAAGAAGG + Intronic
1089264245 11:117246927-117246949 AGCTTTGTGAGAAGGGCAGAAGG + Exonic
1089307442 11:117535496-117535518 GGCTGTGGGTGAGGACGAGAAGG + Intronic
1089422331 11:118341137-118341159 GGCTGTGGGTGGAGACCAGCTGG + Intronic
1090210800 11:124920056-124920078 GCATGTGGGAGCAGGGCAGATGG + Exonic
1090247023 11:125223849-125223871 GGCTGTGAGTGAAGGCCACAAGG + Intronic
1090501215 11:127263237-127263259 GGCTCTGGGCAAAGGGCAGAAGG + Intergenic
1090613921 11:128497482-128497504 GGAGGTGGATGAAGGGAAGAGGG - Intronic
1090977749 11:131691172-131691194 GGCTGTGGGTGCAGGGCCGGGGG - Intronic
1091273289 11:134332521-134332543 GGGCCTGGGGGAAGGGCAGAGGG - Intronic
1091840629 12:3617908-3617930 GGCTGGGTGAAAAGGGCAGAGGG - Intronic
1091842292 12:3629817-3629839 GGCTGGGTGTGAAGGACACAAGG + Intronic
1093005429 12:14046036-14046058 GACTCTGGGTAAAGGACAGATGG + Intergenic
1093225200 12:16474643-16474665 GGCAGTAGGGGAAGGACAGAGGG - Intronic
1093682065 12:22014139-22014161 TTCTGTGGGGGAAGGGAAGAGGG - Intergenic
1094491671 12:30964520-30964542 AACTCTGGGTGAAGGGAAGATGG - Intronic
1094810516 12:34133464-34133486 GACAGTGGGTGCAGGACAGAGGG + Intergenic
1094873588 12:34614510-34614532 GACAGTGGGTGCAGGGCAGTGGG - Intergenic
1095665151 12:44788808-44788830 GGCTGTTGGGGCAGGGCACAGGG + Intronic
1096230461 12:49894003-49894025 GGGTCTGGAGGAAGGGCAGAGGG + Intronic
1096488015 12:51996646-51996668 GTGTGTGGGGTAAGGGCAGAAGG - Intronic
1096623336 12:52878139-52878161 GGCGGAGGGGGAAGGGCACAGGG - Intergenic
1096627921 12:52906588-52906610 TGCTGTGGGTGGAAGGCAGGAGG + Intronic
1096636157 12:52960906-52960928 GCCTGTGTTTAAAGGGCAGATGG - Intergenic
1096801867 12:54115718-54115740 GGCTGTGTCTGAAGGGCAGCAGG + Intergenic
1096806964 12:54146852-54146874 GGGTATGGGTGAGTGGCAGAGGG - Intergenic
1096812736 12:54182169-54182191 GCCTGTGGGTTACGGGGAGAGGG + Exonic
1096829260 12:54301539-54301561 GGCTGAGGGGGGAGGGGAGAAGG - Intronic
1096868505 12:54578879-54578901 GGTAGTCGGTGAAAGGCAGATGG + Exonic
1097149498 12:56966119-56966141 GACTGTGGGTGCAGGACAGTGGG + Intergenic
1097304222 12:58051942-58051964 GACAGTGGGTGAAGGACAGTGGG + Intergenic
1098601035 12:72332063-72332085 AGCAGAAGGTGAAGGGCAGAGGG + Intronic
1101032978 12:100678136-100678158 GGCAGAGAGGGAAGGGCAGAGGG - Intergenic
1102425071 12:112837830-112837852 GCCTGGGGATGAAGGACAGAGGG - Intronic
1102483760 12:113242351-113242373 GGCTGGGGGTGTAGGCCAGGCGG - Intronic
1102567064 12:113803652-113803674 GGCTGGGGTTGGAGGGCAGCTGG + Intergenic
1102797349 12:115700344-115700366 ATCTGTGTGGGAAGGGCAGAAGG - Intergenic
1102823365 12:115926600-115926622 GGCTGGGGGTGAGGGGTAGGGGG + Intergenic
1102952326 12:117039124-117039146 GGCGGTGGGTCAGTGGCAGAGGG + Exonic
1104074152 12:125374620-125374642 GTCGGGGGGTGCAGGGCAGAGGG - Intronic
1104370166 12:128217321-128217343 GGCTGTATGTGAAGGGGAGAGGG - Intergenic
1104462030 12:128963833-128963855 GGCTGTGGGTGGTGCGCAGATGG + Intronic
1104969814 12:132526192-132526214 GCCTGTGGGTGGAGGGCAGGCGG + Intronic
1105280466 13:18960002-18960024 GTCTGCGGGTGGAGGACAGATGG - Intergenic
1105503679 13:20992376-20992398 GGCTGTGGGTGCAGAGCTGGAGG + Intronic
1105585901 13:21742525-21742547 GGCTGGAGGTGGAGGGCACATGG - Intergenic
1105820796 13:24079108-24079130 GGCAGTGGCAGAAGGGAAGAGGG + Intronic
1105983661 13:25544853-25544875 GGCTACGGGGGAGGGGCAGAAGG + Intronic
1106014595 13:25856747-25856769 GGCTGGGGAGGAAGGGGAGAAGG - Intronic
1107585902 13:41848083-41848105 GGGTGAGGGTGATGGGGAGAAGG + Intronic
1107985066 13:45768517-45768539 GGCTGGGAGAGAGGGGCAGAGGG - Intergenic
1109323006 13:60833196-60833218 GGCAGTGGGTGCAGGACAGTGGG - Intergenic
1109995927 13:70125903-70125925 GGTTGTGGGAGGAGGGCAGAGGG + Intergenic
1110120187 13:71870194-71870216 GGTTGTGGGGGAAGGGAGGACGG - Intergenic
1110339304 13:74370313-74370335 GTCTGAGGCTGAAGGGCCGAGGG - Intergenic
1110884714 13:80618510-80618532 GGCAGAAGGTGAAGGGGAGATGG - Intergenic
1111542241 13:89684299-89684321 GTCTGTGGGGGAAGGGGAGGGGG + Intergenic
1111690235 13:91555121-91555143 GGAACTGGGTGAAGGGCATATGG - Intronic
1112193765 13:97204183-97204205 GCCTGTGGGAGAAGGTCACATGG - Intergenic
1112237437 13:97649051-97649073 GGATGTGGGTGGAGGGGAGAGGG - Intergenic
1113293438 13:108931343-108931365 GTCTGTGAATGAAGGACAGAAGG + Intronic
1113505398 13:110812850-110812872 GGCTGTGGCAGAAGGGGAGGCGG + Intergenic
1113540867 13:111108161-111108183 GGAGCTGGGTGAAGGGCACATGG + Intergenic
1113571689 13:111362444-111362466 GGCTGGGGCTGAAGGGCAGAGGG + Intergenic
1113657186 13:112074123-112074145 GAGTGTGGGTGAAGAGGAGAGGG + Intergenic
1113865258 13:113517803-113517825 GACTGTGGGTGGAGGGAAGAGGG + Intronic
1113865277 13:113517862-113517884 GAGTGTGGGTGGAGGGAAGAGGG + Intronic
1114241838 14:20875170-20875192 GGCTATGGGTGAGCAGCAGATGG - Intergenic
1114492561 14:23112642-23112664 GGCTGGGGATGGAGGGGAGAAGG + Intergenic
1114807817 14:25857850-25857872 GGCTGTGGGTGCAGGACAGTGGG - Intergenic
1115241818 14:31257398-31257420 GGCTGTGGAGGAAAGGCAGAAGG + Intergenic
1115280925 14:31662465-31662487 GTCGGTGGGTGGGGGGCAGAGGG - Intronic
1115613056 14:35067186-35067208 GGCTGGGGGTTAAGGGGAAATGG - Intronic
1115796649 14:36944382-36944404 GGTTGCGGGTGGAGGGCATAGGG + Intronic
1117643415 14:57824953-57824975 GACTGAGAGTCAAGGGCAGAAGG + Intronic
1118362631 14:65069226-65069248 GGCTGTTGGTGAAGGGAGGGTGG - Intronic
1119420967 14:74507945-74507967 GGCTCTGGGGGGAGGGCACAGGG - Intronic
1119740006 14:77008103-77008125 AGGTGTGGGTGAAGGGCAGCAGG + Intergenic
1120039197 14:79733134-79733156 AGGTGGGGGTGAAGGGAAGATGG + Intronic
1121241892 14:92436877-92436899 GGGTGTGGGTAAAGGGGAGAAGG - Intronic
1121455434 14:94035838-94035860 GGCCCTGGGTGAATGGAAGATGG + Intronic
1121698534 14:95933111-95933133 GGCAGAGTGTGAAGGGTAGAGGG - Intergenic
1121711155 14:96039821-96039843 AGCAGTGGGGGATGGGCAGAAGG - Intronic
1122266730 14:100550181-100550203 GGCTCTCGGTGGAAGGCAGAAGG - Intronic
1122414838 14:101544171-101544193 GGGGCTGGGGGAAGGGCAGAAGG + Intergenic
1122430764 14:101640244-101640266 AGCTGTGGGGAAAGGGGAGATGG + Intergenic
1122811118 14:104288587-104288609 GGCTGTGAGTGAATGACGGAGGG - Intergenic
1122857974 14:104569016-104569038 GGCAGTGGGAGCAGGACAGAAGG - Intronic
1122951554 14:105047809-105047831 GGCTGTGGGCGGAGGGCAGCAGG - Intergenic
1123061589 14:105597071-105597093 GGCTGTGGATGGATGGCAGGAGG + Intergenic
1123086153 14:105718309-105718331 GGCTGTGGATGGATGGCAGGAGG + Intergenic
1123086182 14:105718391-105718413 GGCTGTGGATGGATGGCAGGAGG + Intergenic
1123086211 14:105718473-105718495 GGCTGTGGATGGATGGCAGGAGG + Intergenic
1123086240 14:105718555-105718577 GGCTGTGGATGGATGGCAGGAGG + Intergenic
1123086269 14:105718637-105718659 GGCTGTGGATGGATGGCAGGAGG + Intergenic
1123086298 14:105718719-105718741 GGCTGTGGATGGATGGCAGGAGG + Intergenic
1123086327 14:105718801-105718823 GGCTGTGGATGGATGGCAGGAGG + Intergenic
1124892235 15:33744020-33744042 GGAGGTGGCTGGAGGGCAGAGGG - Intronic
1125335107 15:38619214-38619236 GGCAGAGGGTGGAGAGCAGACGG + Intergenic
1125997830 15:44181411-44181433 GAAGGTGGGTGAAGGGCACATGG - Intronic
1127681381 15:61301934-61301956 GGCTGAGGATGAGGGGCAGGCGG + Intergenic
1127978731 15:64018445-64018467 GCCTGTGGGTGAAGAGGAGTTGG - Intronic
1128014836 15:64334392-64334414 GACTGGGGGTGGAGGGCAGGGGG + Intronic
1128130547 15:65224462-65224484 GGCAGTGGGAGAGGGGTAGATGG + Intergenic
1128213296 15:65916960-65916982 GGATGTCGGTGAAATGCAGAGGG + Intronic
1128214090 15:65922471-65922493 GACTGAGGGTGAAGGGAAGATGG + Exonic
1128657162 15:69470723-69470745 GGGTGGGGGTGAGGGGCAGAAGG - Intergenic
1128718452 15:69927677-69927699 GGCTGTGGGTTAAAGGCACTGGG - Intergenic
1129119193 15:73385244-73385266 GGGTGTGGGTGAAATTCAGAAGG + Intergenic
1129272354 15:74425861-74425883 GGCTGTGGGACAAGGTCAGCAGG - Intronic
1129295557 15:74598252-74598274 AGGCGTGGGTGAAGGGGAGAAGG - Intergenic
1129326731 15:74803738-74803760 GGTTGAGGATGCAGGGCAGAGGG + Intergenic
1129744261 15:78007306-78007328 AGCTGTGGGTGAGTGGCAGCAGG + Intronic
1130157058 15:81359917-81359939 GACCGTGGGTGAAGGGTACACGG + Intronic
1130239403 15:82172363-82172385 GGCTGTGGGTGATGTGCTGTTGG - Intronic
1130367535 15:83253862-83253884 GGCTCTCAGTGAAGGGGAGAGGG - Intergenic
1130561206 15:84960632-84960654 GGATGTGGGTGATGGGCAGGTGG + Intergenic
1130891273 15:88135851-88135873 GGCTGTGTGTGAGGGGCAACTGG - Intronic
1131309040 15:91271043-91271065 TCCTGTGGATGATGGGCAGACGG + Intronic
1131510165 15:93045298-93045320 GGCTGTGGGTGCAGGGCTGGCGG + Exonic
1132399855 15:101498579-101498601 GGCTGCGGGTGCAGGTCAGAAGG - Intronic
1132571866 16:647762-647784 GGCTGTGGGAGGAGGGCAGTCGG - Exonic
1132719116 16:1307344-1307366 GGATGTGGGTCCAGGGCAGCAGG - Intergenic
1132740813 16:1412099-1412121 GGCGGAGGGTGGAGGGCGGAGGG - Intronic
1132991524 16:2798192-2798214 GGTGGTGGGTGGAGGGCAGGGGG + Intergenic
1133002479 16:2858256-2858278 GGCTGTGGGTCCTGGGCAGAGGG + Intergenic
1133701186 16:8310636-8310658 GGGGGTGCATGAAGGGCAGAAGG + Intergenic
1133732700 16:8590216-8590238 GGCTGGGCGTGGAGGGCCGAGGG - Intergenic
1134215060 16:12310965-12310987 AGCTGTGGGAGAAGGGAAGGAGG + Intronic
1134397327 16:13877111-13877133 GTCTGTGGCTGAAGGCCTGAGGG - Intergenic
1135745762 16:25015152-25015174 GGCTGGGGGCGGAGGGCGGAGGG - Intronic
1135843209 16:25895108-25895130 GGCTGAGAGGGAAGGGTAGATGG + Intronic
1136072003 16:27792808-27792830 GGCTGGGAGTGAAGGGGGGAAGG + Intronic
1136349585 16:29698145-29698167 GGCTGTGAGTGCACAGCAGATGG + Exonic
1136607828 16:31348442-31348464 GTCTGTGGGTGTAGGACGGATGG + Intergenic
1137056887 16:35750256-35750278 GGCTGTGGCGGAAGCGCAGGTGG - Intergenic
1137410021 16:48220484-48220506 AGCTGTGGGTCAAGTGCAGGAGG + Intronic
1137523489 16:49213359-49213381 GAAGGTGGGTGAAGGGGAGAGGG + Intergenic
1137576285 16:49602414-49602436 GGGTGGGGGTGAAGGTCAGGAGG + Intronic
1137731810 16:50695162-50695184 GGGGGTGGGGTAAGGGCAGAAGG + Intronic
1138184201 16:54963838-54963860 GGCAGTGGGGGAAGAGGAGAAGG + Intergenic
1138519294 16:57561902-57561924 AGCTGAGGATGAAGGGCAAAGGG - Intronic
1139692615 16:68650806-68650828 GGCTGTGGGGGAAGGGGTTAAGG - Intronic
1140543487 16:75783170-75783192 GGCTGTGGGAGGAGGGTGGATGG - Intergenic
1140736032 16:77898602-77898624 GGCTGTGTGTGCAGGGCTTAAGG + Intronic
1141693285 16:85608235-85608257 GGCTGGGGGCTGAGGGCAGATGG + Intergenic
1142008262 16:87700646-87700668 GGCAGAGGGAGGAGGGCAGAGGG + Intronic
1142186575 16:88697689-88697711 CTGTGTGGGTGATGGGCAGAGGG - Intronic
1142247100 16:88975210-88975232 GGCTGCAGGTGAGGAGCAGAGGG - Intronic
1142252597 16:88999607-88999629 GGCGGAGGGAGGAGGGCAGAGGG + Intergenic
1142350573 16:89577449-89577471 GGGCGTGGGTGAGCGGCAGAGGG + Intronic
1142368440 16:89663685-89663707 GGGTGTGTCTGAAGGGCAGCAGG + Intronic
1142401748 16:89862478-89862500 GGCTGTGAGCCCAGGGCAGATGG - Intronic
1142600312 17:1050633-1050655 GTCTGTGGGGGAAGGACAGACGG + Exonic
1142638154 17:1270497-1270519 GGCAGTGGGCAGAGGGCAGAGGG + Intergenic
1143012813 17:3875615-3875637 GGCTGTGGGTGAGAGGCATTTGG - Intronic
1143012845 17:3875784-3875806 GGCTCAGGGTGGGGGGCAGAGGG - Intronic
1143306906 17:5954539-5954561 GGCTGGGGGTGGATTGCAGAAGG + Intronic
1143517156 17:7425633-7425655 GGCCGGGGGTGGGGGGCAGAGGG + Exonic
1143614231 17:8039881-8039903 GGCTGTGGGAGAAGGGGAGTAGG - Exonic
1143882489 17:10040291-10040313 GGCTGTGGGGGAAAAGCAGGTGG + Intronic
1144877999 17:18412320-18412342 GGCTGCGGGCGAAAGGCAGTGGG + Intergenic
1145716562 17:27028734-27028756 GGCAGTGGGTGCAGGACAGTAGG + Intergenic
1145936100 17:28715747-28715769 GGGTGTGGGTGCTGGGGAGAAGG + Intronic
1146272731 17:31495017-31495039 GGCTGGAGGTGAAGGGCAGGTGG - Intronic
1146273568 17:31500029-31500051 GGCTCTGTTTGCAGGGCAGAGGG + Intronic
1146506258 17:33408359-33408381 GGTTGTAGGTGAAGGGTAGTGGG + Intronic
1146804806 17:35856674-35856696 GGCTGTGGGAAGGGGGCAGAGGG - Intronic
1146915541 17:36676183-36676205 GGCTGTGTTTGAGGGTCAGAGGG - Intergenic
1147149906 17:38508718-38508740 GGCTGTGGGTGGAGGAGAGAGGG + Intronic
1147175879 17:38655902-38655924 GGCTCTGGCCCAAGGGCAGATGG - Intergenic
1147546838 17:41408371-41408393 GAGTTTGGGTGAAGGGCAGTTGG - Intergenic
1147549751 17:41432067-41432089 GGCTGTGGGAAAAGGGGAAATGG + Intergenic
1147595254 17:41712583-41712605 GGCTGCGGCAGAAGGGCAGGTGG - Intronic
1147673748 17:42191316-42191338 GGATGTGGTGGAAGGGCAGCAGG - Intronic
1147811570 17:43173822-43173844 GGGTGGGGGTGGGGGGCAGAGGG - Intronic
1147965523 17:44192477-44192499 GGCTGAAGGTGAAGGGAGGAAGG - Exonic
1147976901 17:44253064-44253086 GGCCGGGGGTGAGGGGCAGGAGG + Intronic
1148331338 17:46815598-46815620 GGCTGGGGCTGTAGGGTAGATGG - Intronic
1148445614 17:47735147-47735169 GGCTTGGGGTGGAGGGGAGAGGG + Intronic
1149207625 17:54266594-54266616 GTCTGGGAGTGAAGGGAAGAAGG + Intergenic
1149427630 17:56570285-56570307 GGCTGTGAGAGGAGGGGAGATGG - Intergenic
1150121474 17:62606891-62606913 GGCTGTGGGTATAAGCCAGATGG + Intronic
1150161418 17:62901303-62901325 GGCTGTGGGTGAAGGGCTGTAGG + Intergenic
1150423102 17:65056269-65056291 GGCCGGGGGTTAAGGGCAGGGGG - Intronic
1150667333 17:67153674-67153696 TGCTGTGGGTGAAGGGAAGTGGG - Intronic
1150935348 17:69629064-69629086 GGCTGGGGCTGAAGGGAAGGGGG + Intergenic
1151316241 17:73324321-73324343 GCCCGTGGGGGAGGGGCAGAAGG - Intergenic
1151404551 17:73878052-73878074 GGCCGGGGGTGAAGGGCAGAGGG + Intergenic
1151557610 17:74854549-74854571 TGATGTGGGTGATGGGGAGATGG - Intronic
1151654332 17:75488802-75488824 GGGTGAGGGTGGAGGGGAGAAGG - Exonic
1151725623 17:75882102-75882124 GGCTGTGGGTGGGGAGCAGAGGG - Intronic
1151846718 17:76661320-76661342 GAATCCGGGTGAAGGGCAGATGG + Intergenic
1152065887 17:78112362-78112384 GGCTGTGGGGGGTGGGCACAGGG - Exonic
1152353094 17:79794193-79794215 GGCTGTGGGAGAAGGGAGGAGGG + Exonic
1152380601 17:79940767-79940789 GGCTGGGCGTGAAGGGGACAGGG - Exonic
1152570487 17:81119342-81119364 GGCTGTGGCAGAAGGGCACGCGG - Intronic
1152585642 17:81188346-81188368 GGCAGGGGGTGCAGGGCAGTGGG - Intergenic
1152599023 17:81252264-81252286 GGCGGTGGGTGGAGGGGAAAAGG - Exonic
1152784567 17:82241120-82241142 GGGTGGGGGTGGGGGGCAGAGGG + Intronic
1152790560 17:82276562-82276584 GGCAGAAGGTGAAGGGCAGCTGG + Intergenic
1152811329 17:82384143-82384165 GGGTGTGGGTGGAGGGTAGCAGG - Intergenic
1153229892 18:2925490-2925512 GGATATGGGAGAATGGCAGAAGG - Intronic
1153736769 18:8078772-8078794 GGCAGAGGGTGAAGGGCAGCAGG + Intronic
1154329989 18:13421689-13421711 GGCGGTGGGTGGGGGGCAGGGGG - Intronic
1154437470 18:14357819-14357841 GGCTGTGGGGGAAGGGATCAAGG - Intergenic
1156061823 18:33086807-33086829 TGGTGTGTGTGAAGGGGAGAGGG + Intronic
1156451132 18:37266974-37266996 GGCTGTGGGGAAAGGGGAGGGGG + Intronic
1156455248 18:37289550-37289572 GGCTGTGGGGGAAGGGAGGTGGG - Intronic
1156464715 18:37341508-37341530 GGCAGTGAGTGGAGGGCATAAGG + Intronic
1156475433 18:37402885-37402907 GGCTGGGGGAGAAGGGCCCAGGG - Intronic
1156477179 18:37412976-37412998 GGCTGCGGGGGCTGGGCAGAGGG + Intronic
1156596954 18:38558491-38558513 GGCTATGTGGGAAAGGCAGAAGG + Intergenic
1157006626 18:43590443-43590465 GGCAGTGGGTGAGGTGCAGGTGG + Intergenic
1157208235 18:45718835-45718857 GGTTGTGGGGCAAAGGCAGAAGG - Intergenic
1157296483 18:46448463-46448485 GTCTGTGGGTAAAGGGCTCAGGG + Intronic
1157302478 18:46489026-46489048 GAGTGAGGGTGACGGGCAGACGG - Exonic
1157920181 18:51706579-51706601 GACAGTGGGTGCAGGACAGAGGG - Intergenic
1157952983 18:52061068-52061090 GGCTGCAGGTGAAGGCCAGCTGG - Intergenic
1158054373 18:53261201-53261223 GGCAGTGGGTGCAGGACAGTGGG - Intronic
1158246573 18:55439064-55439086 GGCAGTGGTTGAAAGGCAGGGGG + Intronic
1160201130 18:76796336-76796358 GGCTGGGGGTGAGGGGCTGGGGG - Intronic
1160507946 18:79437678-79437700 GGCAGAGGGTGGAGGGCAGAGGG - Intronic
1160816437 19:1038096-1038118 GGCTGTGGGGGAAGGGGTCAAGG + Exonic
1161201826 19:3019409-3019431 GGCGGGGGGTGAGGGGCACAGGG + Exonic
1161224464 19:3136614-3136636 GGCGGTGGGTGGTGGGCAGTGGG + Intronic
1161287139 19:3474461-3474483 GGCAGTGGGTGCATGGGAGAGGG + Exonic
1162327398 19:10007258-10007280 GGCAGTGGGAGAAGGTCAGGGGG - Intronic
1162343265 19:10105242-10105264 GGCTGAGGGTGGGGGGCCGAGGG - Intergenic
1162858302 19:13486904-13486926 GGCTGCGTGTGTAGGGAAGAAGG - Intronic
1163529279 19:17840340-17840362 GACTGTGGGGGAAGGTGAGAGGG + Exonic
1163574578 19:18103107-18103129 AGCTGTGGGTGGAAAGCAGATGG + Intronic
1164157932 19:22607744-22607766 GGCAGTGGGAAAAAGGCAGAGGG - Intergenic
1164626195 19:29729791-29729813 GGCTGAGGGAGAAGTTCAGAGGG + Intergenic
1164734775 19:30532695-30532717 GGGAGTGGGAGAAGGGTAGAAGG + Intronic
1165093845 19:33400154-33400176 AGCTGTGGGTGAGAGGCAGTGGG + Intronic
1165148548 19:33748103-33748125 GGCTTTGGGTGAGTGGCAGGCGG - Intronic
1165346207 19:35250003-35250025 TGTTGTGGGTGAATGGCAAAGGG + Intronic
1165778960 19:38421054-38421076 AGCTATGGGTGGAGGGCAGAGGG - Intronic
1166105925 19:40598098-40598120 GGGTGGGGGTGCTGGGCAGACGG - Intronic
1166137416 19:40786071-40786093 GGATGGGGGGCAAGGGCAGAGGG + Intronic
1166747522 19:45148462-45148484 GGCCATGGGTGAAGGGAAGAAGG + Intronic
1166761027 19:45224609-45224631 GGCTGTTGGTGGAGTGGAGAGGG - Intronic
1166944801 19:46390263-46390285 GGCTGTGGGACCAGGGCAGGTGG - Exonic
1167270439 19:48502874-48502896 GGGGGTTGGGGAAGGGCAGAGGG - Intronic
1167428159 19:49440269-49440291 GGCTGTGGGCCAAGGGGACAGGG + Intronic
1167603641 19:50468454-50468476 GGCTGCGTGTGAGGGGCTGAGGG - Intronic
1167618496 19:50548872-50548894 GGCTGTGGGTGGGGGAGAGAAGG + Exonic
1167636835 19:50660142-50660164 TGCTGTGGGTAAAGGGGGGAGGG - Intronic
1168124603 19:54276500-54276522 AGCTGTGTGTGCAGGGCAGGGGG - Intronic
1168177384 19:54635038-54635060 AGCTGTGTGTGCAGGGCAGGGGG + Intronic
1168241571 19:55091613-55091635 GGCTGTGGGCAGAGGGCCGAGGG - Intronic
1168295164 19:55374592-55374614 GGCCGGGGGTGAGGGTCAGAGGG - Intergenic
925058747 2:874934-874956 GGGTGTGGGTTAAAGGCGGAAGG + Intergenic
925157457 2:1658582-1658604 GGCTGTGGATGAAGGGTCCAGGG - Intronic
925200031 2:1959675-1959697 GGAGGTGTGTGAGGGGCAGAGGG - Intronic
925409432 2:3631557-3631579 AGCTATGGGTTTAGGGCAGAAGG + Intronic
925505100 2:4553858-4553880 GGCTTTGTGTAGAGGGCAGAGGG - Intergenic
925510264 2:4617714-4617736 ATCTGTGGGTGAGAGGCAGAAGG + Intergenic
925904178 2:8529499-8529521 GGCTGAGGGTGAGGGGGAGGTGG - Intergenic
925923239 2:8652183-8652205 GGCGGAGGGTGAAGGGAAGCCGG + Intergenic
926034628 2:9626361-9626383 GGATGTGAGGGAAGGGCAAATGG - Intronic
926045937 2:9709678-9709700 GGCCCTGGGTGAAGGAAAGAGGG - Intergenic
926061775 2:9809001-9809023 GTCTCAGTGTGAAGGGCAGAGGG - Intergenic
926296753 2:11574477-11574499 GCCTGTGGGTGGAGGGCAGTGGG + Intronic
927067434 2:19487569-19487591 GGCAATGAGTGATGGGCAGAAGG - Intergenic
927283839 2:21336066-21336088 GACAGTGGGTGAAGGACAGTGGG + Intergenic
927428614 2:23007993-23008015 GGGTGGGGCTGAAGGGGAGAGGG + Intergenic
927468445 2:23354177-23354199 GACTGTGGGGAAAGGGCAGGAGG + Intergenic
927475951 2:23414321-23414343 GGCTGTGGGGGCCGCGCAGACGG + Intronic
927515956 2:23671808-23671830 GGCTGGGGATGGAGGGCAGCGGG + Intronic
927596112 2:24399493-24399515 GGCTGTCAGAGAAGGGAAGATGG - Intergenic
927637602 2:24827505-24827527 GGCTGTGAGTGCAGGCCAGGAGG + Intronic
927696463 2:25242728-25242750 GGCTGGGGGGGCAGGGCAGAGGG + Intronic
927863028 2:26572164-26572186 GGGGGTGGGTGGAGGGGAGATGG - Intronic
929078550 2:38098735-38098757 AGCTGTGGGGAAAAGGCAGAAGG + Intronic
929259682 2:39851760-39851782 CACTGTGGGTGCAGGGGAGAGGG - Intergenic
931476802 2:62596119-62596141 AGCTGGTGGGGAAGGGCAGAAGG - Intergenic
932273501 2:70433011-70433033 AGCTGGGGGAGAAGGACAGAGGG - Intergenic
932413748 2:71561731-71561753 GGCTGTGAGGGACGGACAGATGG - Exonic
932440458 2:71731449-71731471 GGCTGGGGGTAAAGGGAGGAGGG - Intergenic
932495365 2:72143424-72143446 GGCCGTGGGGGAAGGGCGGGCGG - Intronic
932791070 2:74654713-74654735 GGCTGGGGATGAGGGGCTGAGGG - Intronic
934488369 2:94738440-94738462 GGCTGTGGGGGAAGGGATCAAGG + Intergenic
934680128 2:96277781-96277803 GAGTGTGGGTGTGGGGCAGAGGG - Intronic
934875392 2:97914533-97914555 GGCTTGGGGGGAAGGGCAGGAGG - Intronic
935019732 2:99218157-99218179 GGCTAGAGGTGCAGGGCAGATGG + Intronic
935057343 2:99579061-99579083 GGCTGTCTGTGAAGACCAGAAGG + Intronic
935640284 2:105283661-105283683 AGCTGTGGGACAAGGGCAGCTGG + Intronic
935749573 2:106219400-106219422 GGCGGGGGATGAAGGGCAGTAGG + Intergenic
936121725 2:109751917-109751939 GGCGGGGGATGAAGGGCAGTAGG - Intergenic
936222970 2:110619555-110619577 GGCGGGGGATGAAGGGCAGTAGG + Intergenic
936259752 2:110948618-110948640 GGCTGTAGAGGAAGGGCAGAGGG + Intronic
936756668 2:115722089-115722111 GGCTGAGGGAGAAGGGAAAATGG + Intronic
936779210 2:116011887-116011909 GCCTGTTGGGGAAGGGCAGGTGG + Intergenic
937083311 2:119155874-119155896 AGTTGTGGGTGGAGGTCAGAGGG - Intergenic
937090916 2:119205612-119205634 GGCTGTGTGTGGAAGGCAAAGGG + Intergenic
937288457 2:120767666-120767688 GGCAGTGGGGGCTGGGCAGAGGG - Intronic
938086423 2:128405059-128405081 GGCTCTGGGAGAAGGCCAGCAGG + Intergenic
938383716 2:130850469-130850491 GGCTGTGGATGATGGACAGCTGG - Intronic
938899672 2:135789520-135789542 GCCTAAGGGTGAAGGGCAGGTGG - Intronic
940292930 2:152095392-152095414 GGCTGTTGGTGAAGCAGAGAAGG - Intronic
941029420 2:160493856-160493878 GGCCGTGGGGGAAGGGCGGGCGG + Intergenic
941043462 2:160648453-160648475 GGCAGTGGGTGAGGTGCAGGTGG - Intergenic
942062880 2:172244081-172244103 GGCAGGGGGTGAAGGGAGGAAGG - Intergenic
942726022 2:179008951-179008973 GGCAGTGGCTGAAATGCAGAAGG - Intronic
944063968 2:195599862-195599884 GTCAGTGGGTGGAGGGCAAAGGG - Intronic
944133017 2:196367618-196367640 GGTTGCGGGGGAAGTGCAGATGG - Intronic
944496847 2:200315740-200315762 GGCTTTGAGGGAAGGGCATACGG + Intronic
945570105 2:211456679-211456701 GGATGTGGGAGGAGGGGAGAGGG + Intronic
945906295 2:215597307-215597329 GGGTGTGGAGGAAGGGCAGAGGG - Intergenic
946487580 2:220115506-220115528 TGCTCTGCTTGAAGGGCAGAGGG - Intergenic
947142988 2:227036767-227036789 TGCTGTGGGGGAAGGGCAGGAGG + Intronic
947518937 2:230829161-230829183 GGCTTGGGGTGCAGTGCAGAAGG + Intergenic
947577739 2:231289846-231289868 GGCAGTGAGAGAAGAGCAGAGGG - Intronic
947914471 2:233822568-233822590 GGCGGTGGGTGCAAGGCAGCAGG + Exonic
948371775 2:237494208-237494230 GGCAGAGGGTGGAGGGCAGAGGG + Intronic
948540198 2:238685900-238685922 GGCAGTGGGTGTGGGGCAGGGGG - Intergenic
948564645 2:238876131-238876153 GGGTGTGGGTGGAGGGCGGATGG + Intronic
948710448 2:239821866-239821888 GGCTCTGGCTGGAAGGCAGAGGG + Intergenic
948833363 2:240611800-240611822 CTCTAGGGGTGAAGGGCAGAGGG + Intronic
948870285 2:240794422-240794444 GTGTGTGGGTAAAGGGCAGATGG - Intronic
948883356 2:240871310-240871332 GGCTGTGGGTGGAGCTCAGAGGG - Intronic
949049060 2:241887516-241887538 GGGTGGGGGTGAGGGGCAAATGG - Intergenic
949050852 2:241896589-241896611 GGGTGTGGGTGAAGGGGTGTGGG + Intronic
949050868 2:241896631-241896653 GGGTGTGGGTGAAGGGGTGTGGG + Intronic
949050873 2:241896645-241896667 GGGTGTGGGTGAAGGGGTGTGGG + Intronic
949050883 2:241896673-241896695 GGGTGTGGGTGAAGGGGTGTGGG + Intronic
949050902 2:241896730-241896752 GGGTGTGGGTGAAGGGGTGTGGG + Intronic
949050941 2:241896837-241896859 GGGTGTGGGTGAAGGGGTGTGGG + Intronic
1168800335 20:640625-640647 GGGTGTGTGTGAAGGGTGGAGGG + Intergenic
1168857589 20:1019678-1019700 GGGTGGGGGTGAATAGCAGATGG - Intergenic
1169235625 20:3927719-3927741 GCCTGGGAGGGAAGGGCAGATGG + Intronic
1169315086 20:4583815-4583837 GGCGGTGGGTGGAGGGTAGAAGG + Intergenic
1170204712 20:13785388-13785410 GGCTGCTGGTCAAGGTCAGACGG - Intronic
1170881970 20:20304760-20304782 AGCTGTGGGTGGAGAGGAGAGGG + Intronic
1171008775 20:21494644-21494666 GAGTCTGGGTGAAGGGTAGATGG + Intergenic
1171451540 20:25239412-25239434 GGCAGTAGGTGCAGTGCAGATGG + Intergenic
1171794844 20:29558748-29558770 GGCTGTGTCTGAAGGGCAGCAGG - Intergenic
1171853612 20:30325517-30325539 GGCTGTGTCTGAAGGGCAGCAGG + Intergenic
1173154563 20:40596750-40596772 GGCAGTGGGAGAAGGGCACGAGG - Intergenic
1173410095 20:42802409-42802431 GGCTGTTGGAGTTGGGCAGAGGG - Intronic
1173430409 20:42982745-42982767 GGGTGTGGGAGAGGAGCAGAGGG - Intronic
1173437636 20:43047131-43047153 GGATGGGGGAGAAAGGCAGAGGG - Intronic
1174388046 20:50198440-50198462 TGCAGTCGGTGAAGGGCACAGGG + Intergenic
1174407139 20:50309936-50309958 GGGAGTGAGTGAGGGGCAGAGGG + Intergenic
1174413197 20:50349343-50349365 GGCTGGGCCTGAATGGCAGAGGG - Intergenic
1174428287 20:50448873-50448895 GGCGGCGTGTGCAGGGCAGAGGG - Intergenic
1174459412 20:50672239-50672261 GGCTGCGGGTGAAGTGAGGACGG - Intronic
1174571570 20:51505823-51505845 GGGTGTGAGTTAGGGGCAGACGG - Intronic
1175224952 20:57439386-57439408 AGCTGGGGGTGCAGGGCAGAGGG - Intergenic
1175605842 20:60311637-60311659 GGCTGTGCGGGAAGAGAAGATGG + Intergenic
1175628350 20:60509521-60509543 TGCTGTGGATAAATGGCAGAGGG - Intergenic
1175711826 20:61227388-61227410 GCCTCTGAGTGATGGGCAGAGGG - Intergenic
1175825870 20:61936364-61936386 GGGTGTGGGGGAAGGGGAGGGGG - Intronic
1175988472 20:62776120-62776142 AGCTGTGGGTGCTGGGCAGGTGG - Intergenic
1176227081 20:64006828-64006850 GGCTCTGAGTGATGGGCACATGG + Intronic
1176338896 21:5624510-5624532 GGCTGTGCGTGAGGTGCAGCAGG - Intergenic
1176340304 21:5687583-5687605 GGCTGTGCGTGAGGTGCAGCAGG - Intergenic
1176472558 21:7119736-7119758 GGCTGTGCGTGAGGTGCAGCAGG - Intergenic
1176504523 21:7636873-7636895 GGCTGTGCGTGAGGTGCAGCAGG + Intergenic
1176839582 21:13827820-13827842 GGCTGTGGGGGAAGGGATCAAGG + Intergenic
1177247754 21:18551864-18551886 GGCAGTGGGTGTTGGGCAAAGGG + Intergenic
1178286520 21:31329946-31329968 GGCTGTGCGTGTGGGGCAGGAGG - Intronic
1178858114 21:36266939-36266961 GGCAGGGTGTGAAGGGCACAAGG - Intronic
1179654805 21:42838235-42838257 GGCTGTGGAAGGAGGCCAGAAGG - Intergenic
1179925922 21:44533970-44533992 GGGTGCGGGGGCAGGGCAGATGG + Intronic
1180129621 21:45819217-45819239 GGCTGTGGGGGATGGGCCGTGGG + Intronic
1180210954 21:46295377-46295399 GGGTTTGGGTGGAGGGAAGAGGG - Intronic
1180693054 22:17733761-17733783 GGCTTTGGGAGAAGGGGTGACGG + Intergenic
1180834452 22:18922861-18922883 GGCTGTGGAGCAAGGGCAGGCGG - Exonic
1181368568 22:22398654-22398676 GGCTGTGGGTGAATGGAACGAGG + Intergenic
1181387675 22:22557788-22557810 GGCAGTGGGGGAGGGGCAGTGGG + Intronic
1181516717 22:23418307-23418329 AGCTGTGGGAGCAGAGCAGAGGG - Intergenic
1181539366 22:23565320-23565342 GGCTGTGGCTGGCAGGCAGAGGG + Intergenic
1181911230 22:26239888-26239910 GGTTGTGGGGGGATGGCAGAGGG - Intronic
1181982646 22:26776593-26776615 GGCTGTAGCTGAAGGGTGGAGGG - Intergenic
1182113555 22:27741956-27741978 GGTTGTGTGTGAAGAGAAGAGGG - Intergenic
1182442133 22:30370796-30370818 GGAGGAGGCTGAAGGGCAGAAGG + Exonic
1182622743 22:31626855-31626877 GGCTGGGGGTGAAGGACTGGAGG - Intronic
1183188969 22:36309254-36309276 GGCAGGGGGCGAAGGGCAAAGGG + Intronic
1183306527 22:37085908-37085930 GGGAGGGGGTGAGGGGCAGAGGG + Intronic
1183340457 22:37277787-37277809 GGATGGGGGTCAAGGGCAGTGGG - Intergenic
1183704259 22:39467282-39467304 TGCAGAGGGTGAAGGGCAGGGGG + Intronic
1184067520 22:42129014-42129036 TCCGGTGGGTGATGGGCAGAAGG - Exonic
1184070251 22:42142709-42142731 GCCGGTGGGTGATGGGCAGAAGG - Intergenic
1184071989 22:42152328-42152350 GCCAGTGGGTGATGGGCAGAGGG - Intergenic
1184304159 22:43584106-43584128 GGTTGTGGCTGCAGGACAGAAGG + Intronic
1184452820 22:44592968-44592990 TGGTGTGGGGGATGGGCAGAGGG - Intergenic
1184468952 22:44684721-44684743 GGGTGTGGGTGCAGAGCACAGGG + Intronic
1184552746 22:45213273-45213295 GGCTGAGGGCAGAGGGCAGAGGG - Intronic
1184961140 22:47929510-47929532 GGTTGTGGGGAAAGGGAAGAGGG + Intergenic
1185273828 22:49941367-49941389 GGCTGTGGCTGATGCTCAGAGGG + Intergenic
1185329660 22:50246527-50246549 GGGTGTGGGAGAAGGGCTGCTGG - Intronic
1185416888 22:50715458-50715480 GGCTGTGTGGGCAGTGCAGATGG - Intergenic
1203239569 22_KI270733v1_random:2041-2063 GGCTGTGCGTGAGGTGCAGCAGG - Intergenic
1203284541 22_KI270734v1_random:148160-148182 GGCTGTGGAGCAAGGGCAGGCGG - Intergenic
949477181 3:4459028-4459050 GGCTGGGGGAGAGGGGAAGATGG + Intronic
949813976 3:8038971-8038993 GGCAGAAGGTGAAGGGGAGATGG + Intergenic
950634260 3:14303846-14303868 GGGTGGGGGTGAGCGGCAGATGG + Intergenic
950689544 3:14644773-14644795 GGCTGTGGGAGAGGGGTGGATGG + Intergenic
951587551 3:24230975-24230997 GGCTGTCTGTGAATGTCAGATGG - Intronic
951673896 3:25215543-25215565 GCCTGTGGTTGAAGTGCAGCAGG + Intronic
952964123 3:38610554-38610576 GGCTGTGGGTGACGGTCTGGCGG + Intronic
953563861 3:44014614-44014636 GGGTGGGGTTGAGGGGCAGATGG - Intergenic
953930952 3:47005409-47005431 TGCTGTGGCTGGAGGGAAGAAGG - Intronic
954676077 3:52316099-52316121 GGCTGTGGCTGCTGGACAGATGG - Intergenic
954677693 3:52324804-52324826 GGCTGGGGGTGATTGGCAGATGG + Intronic
954797159 3:53167320-53167342 GGCTCTAGGAGAAGGGCAGGGGG + Intronic
955408651 3:58641975-58641997 CGCTGTGGGGTGAGGGCAGATGG + Intronic
955854208 3:63255740-63255762 GACAGTGGGTGAAGGACAGTGGG + Intronic
955941759 3:64152696-64152718 GGCAGTGGGGGAAGCTCAGAAGG - Intronic
956591919 3:70924313-70924335 GGATGTGAGGGAAGGGAAGAGGG - Intergenic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
957452516 3:80397914-80397936 AGCTGAGGGTGAAAGGAAGATGG - Intergenic
957878563 3:86180982-86181004 GACTTAGGCTGAAGGGCAGATGG + Intergenic
958185202 3:90110989-90111011 GACAGTGGGTGCAGGGCAGCAGG - Intergenic
958195731 3:90239946-90239968 GGCTGAGGCAGAAGGGAAGAAGG + Intergenic
959590785 3:108078096-108078118 GGGACTGGGTGAAGGGCACATGG + Intronic
960488504 3:118281753-118281775 GCCTGTGGGTGCATGGCACATGG + Intergenic
960594501 3:119395771-119395793 AGCTATGTGCGAAGGGCAGAAGG + Intronic
960603791 3:119484176-119484198 GGCTGAGGGTGGAGGTCTGAGGG + Intronic
960900326 3:122548028-122548050 AGCTGTGGGTGAGGCGCAGTGGG + Intronic
960994566 3:123332418-123332440 GCCTGCTGGTGATGGGCAGAGGG - Intronic
961384223 3:126515532-126515554 GGTGGTGGGTGCTGGGCAGATGG - Intronic
961384246 3:126515596-126515618 GGTGGTGGGTGCTGGGCAGATGG - Intronic
961495254 3:127286943-127286965 GGCGGTGGGGGAGGGGCAGAGGG + Intergenic
961762649 3:129183339-129183361 GGCTGCGGATGAAGGGGGGATGG - Intronic
961820178 3:129571878-129571900 GGCGGTGGGTGAGCAGCAGAAGG - Intronic
962866189 3:139449599-139449621 GGCAGTGGGTGATGGGAACAGGG - Intergenic
962947557 3:140185667-140185689 GGATGGGGGTGCAGGGCAGATGG + Intronic
963686084 3:148436216-148436238 GGTTGTGGGGGAAGTACAGATGG - Intergenic
965445872 3:168772519-168772541 GACAGTGGGTGAAGGTCAGTGGG - Intergenic
965557901 3:170036732-170036754 GGCTCTGCGTGAAGAGGAGAAGG + Intergenic
965788594 3:172363263-172363285 AGCTGTGGGTGATGTACAGATGG + Intronic
965886449 3:173452057-173452079 GACAGTGGGTGCAGGACAGAGGG - Intronic
966861404 3:184232859-184232881 GGCAGGGGGAGAGGGGCAGAGGG + Intronic
966881611 3:184354054-184354076 GGCTGTGGGTGAAGGGCAGAGGG - Intronic
967253971 3:187571039-187571061 TGCTGGGGGTGAAGGGCAGTAGG - Intergenic
968009040 3:195260967-195260989 GGCTGTGGGTGTGGGGATGAGGG - Intronic
968621897 4:1607438-1607460 GGCCGTGGGTGAATGGCACGAGG - Intergenic
968876490 4:3270414-3270436 GGCTGTGGCTGTGGGGCAGGTGG - Intronic
968887348 4:3341656-3341678 GGGTGTGGGGGGAGGGGAGATGG + Intronic
969189522 4:5505909-5505931 GGGTATGGGTGTTGGGCAGAGGG - Intergenic
969490276 4:7495763-7495785 GGCTGAGGGAGAAGTGCAGAGGG - Intronic
969507856 4:7599233-7599255 AGCAGAGGCTGAAGGGCAGAAGG - Intronic
969699936 4:8762416-8762438 GTCTGTGGCTGGAGGGCAGAGGG - Intergenic
970155997 4:13142309-13142331 GGATGTAGGAGAAGGGAAGAGGG + Intergenic
970451992 4:16178111-16178133 GGGTGTCCATGAAGGGCAGAGGG - Intronic
971261683 4:25062983-25063005 GGCTGTGGTGGGAGGGCAGTTGG + Intergenic
972356077 4:38280518-38280540 GGCTGGGGGTGAGGGGAGGAAGG - Intergenic
973956099 4:56064985-56065007 AGCTGTGGTTGCAGGGCAGTGGG + Intergenic
974208607 4:58740743-58740765 GCCTGGGGGTAAAGGGCAGAAGG - Intergenic
975353604 4:73373232-73373254 GGTTGTGAGGTAAGGGCAGATGG - Intergenic
975423818 4:74202560-74202582 TGCTGTGGGAGGAGGGCACAAGG + Intronic
975960515 4:79898458-79898480 GGGTATGGGTGAAGGGTGGAAGG - Intergenic
976998169 4:91462501-91462523 GACAGTGGGTGAAGGACAGTGGG + Intronic
977108715 4:92922344-92922366 GACAGTGGGTGCAGGACAGAGGG - Intronic
978133818 4:105233042-105233064 GGCTGGAGGGGAAGGGCAGACGG + Intronic
979302542 4:119103304-119103326 GGCTTTTTGTGAAGGCCAGATGG - Intergenic
980538901 4:134166830-134166852 GTCAGTGAATGAAGGGCAGAGGG - Intergenic
980643078 4:135604366-135604388 GGCTGTCAGAGAAGGGAAGATGG - Intergenic
981338586 4:143594226-143594248 GACAGTGGGTGCAGGGCAGTGGG - Intronic
982002145 4:151030928-151030950 GGCTGTGTGTGAAGAACAGATGG + Intergenic
982107350 4:152022543-152022565 GGCTGTGGATGAAGAGCAGTAGG - Intergenic
982547393 4:156751325-156751347 GTCTGTGGATAAAGGGTAGAGGG + Intergenic
984192953 4:176626061-176626083 GGCTGGCGGAGAAGGGAAGATGG - Intergenic
984555465 4:181208805-181208827 GGCTGTGGAGGAAGATCAGAGGG + Intergenic
985043381 4:185915696-185915718 TGCTGGGGGTGGGGGGCAGAAGG - Intronic
985058474 4:186056581-186056603 AGCTGGGGGTGGAAGGCAGAAGG - Intergenic
985438862 4:189963878-189963900 GGCAGTGGGTGCAGGACAGTGGG + Intergenic
985489487 5:171140-171162 GGCTGTGGGGGGCGGGCCGAGGG - Intronic
985576368 5:675227-675249 GGCTGGGGGTGCAGTGCAGGGGG + Intronic
985576410 5:675369-675391 GGCCGGGGGTGCAGCGCAGAGGG + Intronic
985589293 5:756441-756463 GGCTGTGTGTGCAGGGCCGATGG - Intronic
985604010 5:849105-849127 GGCTGTGTGTGCAGGGCCGACGG - Intronic
985622856 5:964623-964645 GGCTTTGGGGGCAGAGCAGAGGG - Intergenic
985659990 5:1152229-1152251 GGCCGGGTGTGCAGGGCAGAGGG - Intergenic
985892155 5:2724421-2724443 GGCTGAGGGAGAAGGGAGGAGGG - Intergenic
987332148 5:16866869-16866891 GGCTGTGGGTGGAGACCAGCAGG - Intronic
988169470 5:27635084-27635106 GGGTGTGGGAGAATGGTAGAAGG - Intergenic
988548174 5:32176658-32176680 GGCTGGGGGTGGAGGGCAGCTGG - Intergenic
988548192 5:32176689-32176711 GGGTGGGGGTGGAGGGCAGCTGG + Intergenic
988661691 5:33277240-33277262 GGAAGTGGGTGATGGGAAGAAGG - Intergenic
988985607 5:36615596-36615618 GGCAGAGACTGAAGGGCAGAAGG - Intronic
989451528 5:41592120-41592142 GTCTGTGGCTGAAGGAGAGAAGG - Intergenic
989681998 5:44041032-44041054 GACAGTGGGTGAAGGACAGTGGG + Intergenic
989844839 5:46129078-46129100 GACAGTGGGTGAAGGACAGTGGG + Intergenic
990798264 5:59568970-59568992 GGCAGTGGGTGAGGGGTATATGG + Intronic
990940152 5:61193987-61194009 GGCTGTGTGTGAGGAGAAGATGG + Intergenic
991703449 5:69336160-69336182 ACTTGTGGGTGAAGGGGAGATGG + Intergenic
992169319 5:74086422-74086444 GGCAGTGGGGCAAGGGAAGAAGG - Intergenic
993244228 5:85431597-85431619 GGCAGTGGGTGCAGGACAGTGGG + Intergenic
993319552 5:86456328-86456350 GGGTGTGGGATAAGGGTAGAAGG + Intergenic
993398033 5:87414920-87414942 AGGTGTGGGTGGAGGGTAGAAGG - Intergenic
993483927 5:88458504-88458526 TGGGGTGGGGGAAGGGCAGAGGG + Intergenic
993589186 5:89773078-89773100 GCATGTGTGTGAAGGGAAGAAGG + Intergenic
994236502 5:97369241-97369263 CGCAGTGGTTGATGGGCAGATGG + Intergenic
994757163 5:103808760-103808782 AGCTATGGGTGAAGGTCAAATGG - Intergenic
995478889 5:112575883-112575905 GGTAGTGGGTGAGGGACAGAGGG - Intergenic
996514846 5:124358374-124358396 GACAGTGGGTGAAGGACAGTGGG + Intergenic
997206057 5:132050852-132050874 GGCTTTGAGTGAAGGGCATGGGG + Intergenic
997473299 5:134128681-134128703 GGCAGGGGCTCAAGGGCAGAGGG - Intronic
997980495 5:138465153-138465175 GGCTCTGGGAGGAGGGAAGAAGG + Intergenic
999093740 5:148959415-148959437 GGCAGAGGTTGATGGGCAGATGG - Intronic
999106049 5:149072076-149072098 GGATGTGGATGAACGCCAGATGG - Intergenic
999779540 5:154837947-154837969 GGTTGTGGGTAAAAGGCAGTTGG + Intronic
1000133796 5:158324768-158324790 GGTGGTGGGAGAAGGCCAGATGG - Intergenic
1000526091 5:162359293-162359315 GCCTGTGGGTGAAGTACAGAAGG + Intergenic
1001092128 5:168749442-168749464 GGCTGTGGGTCAAGGTCTGCGGG - Intronic
1001171073 5:169419501-169419523 AGCTGTGGATGAAGGGCACTCGG + Intergenic
1001327770 5:170741912-170741934 GGCTTTGGGATGAGGGCAGAAGG - Intergenic
1001705202 5:173736603-173736625 GGGTGTGGGGGCAGGGCGGAGGG - Intergenic
1001904256 5:175458159-175458181 GGTTGTGGGGGCTGGGCAGAGGG + Intergenic
1002280114 5:178124860-178124882 GGCTGTGGGCGCAGGGAGGAGGG - Exonic
1002371041 5:178754879-178754901 GGCTGTGGGTGAAGAGAAAAGGG + Intergenic
1002398011 5:178972782-178972804 AGATGTGGGGGAAGGGCAGGCGG + Intergenic
1002521189 5:179794035-179794057 GGCTGTGTGTGAAGGCGAGCTGG - Exonic
1002662140 5:180798428-180798450 TGCTGTTGGTGAAGGGTAGGTGG - Intronic
1002892426 6:1347162-1347184 TCCTGTGGGTCAAGGGAAGAAGG - Intergenic
1003129253 6:3381288-3381310 TGCTGTGGTTAATGGGCAGATGG - Intronic
1003573405 6:7270792-7270814 GGGTGAAGGTGAAGGGCACAGGG + Intronic
1004357661 6:14944092-14944114 GGAAGCGGGTGCAGGGCAGAGGG + Intergenic
1005164896 6:22908535-22908557 GACTATGGGTGGAGGGCAGCAGG + Intergenic
1005284510 6:24310915-24310937 GGCTGTGGGGGCAGGTAAGAAGG - Intronic
1005601066 6:27426452-27426474 GGTTGTGGGTGGGGAGCAGATGG - Intergenic
1005827327 6:29641882-29641904 CACTGTTAGTGAAGGGCAGAAGG - Intergenic
1005916344 6:30355343-30355365 GGATGTGGGTCAGGGGCAGATGG + Intergenic
1006021567 6:31120818-31120840 GACTGCGAGTGGAGGGCAGATGG - Intronic
1006295014 6:33166451-33166473 GGCTGTGGGTGGGCAGCAGAGGG + Intronic
1006432317 6:34005197-34005219 GGCTGTGGGCCCAGGGCAGTGGG - Intergenic
1006839928 6:37022218-37022240 AGCTGTGGGTTAAGGGGAGTTGG - Exonic
1006873872 6:37278519-37278541 GGGGGTGGGGTAAGGGCAGAGGG + Intronic
1007094182 6:39203336-39203358 GGCTGGGAGTCAGGGGCAGAGGG + Intronic
1007416669 6:41694981-41695003 GGCTGTGGGTGGACAGCAGCAGG - Intronic
1007732320 6:43954692-43954714 GGGGGAGGGTGGAGGGCAGAGGG - Intergenic
1007841584 6:44720454-44720476 GGGTGGGGGTGAGGGGTAGATGG + Intergenic
1007925544 6:45646770-45646792 AGCTGAGGGTAGAGGGCAGAGGG + Intronic
1008537762 6:52520209-52520231 GGCTGGGGGTGTGGAGCAGAAGG + Intronic
1009431647 6:63572623-63572645 GGCGGTGGCTGCAGGGCAGGAGG - Exonic
1010285924 6:74077693-74077715 TACTGAGTGTGAAGGGCAGATGG + Intergenic
1010350736 6:74871326-74871348 GGCAGTGGGTGAATGACAAAAGG + Intergenic
1010482840 6:76375442-76375464 GGCAGTGGGTGCAGGACAGTGGG - Intergenic
1011033083 6:82943759-82943781 TGCTGTGGGGGAATGGGAGAGGG - Intronic
1011801043 6:91016706-91016728 GTCTGTGGGTGGTGGGCTGAGGG - Intergenic
1012454847 6:99392527-99392549 GTGTGTAGGTGGAGGGCAGAAGG - Intronic
1012930507 6:105311330-105311352 GGGAGTGGATGAAGGGCAGGGGG - Intronic
1013350144 6:109298271-109298293 GGCGGTGGGGACAGGGCAGAGGG - Intergenic
1013908845 6:115250199-115250221 GGCAGTGGGTGCAGGACAGTGGG + Intergenic
1013968426 6:115984720-115984742 GACTTTGTGTGAATGGCAGAGGG - Intronic
1014565717 6:122945400-122945422 GACTGTGGGTGCAGGACAGTGGG - Intergenic
1014566567 6:122956386-122956408 TGCTGTGGGGGATGGGCAGGTGG - Intergenic
1015138966 6:129908520-129908542 TGCTGAGGGTGAAGGGAATAGGG - Intergenic
1015828600 6:137343055-137343077 GGGTGCGGGTGAGGGGCTGAGGG + Intergenic
1016018431 6:139210624-139210646 GACAGTGGGTGAAGGACAGTGGG + Intergenic
1016331880 6:142961365-142961387 GTCTGTGGCTGAAGGCCTGAGGG - Intergenic
1017096779 6:150811825-150811847 GGCTTTGGAGGAAGGGGAGATGG + Intronic
1017273053 6:152531655-152531677 GGTAGAGGCTGAAGGGCAGAGGG - Intronic
1017488326 6:154922943-154922965 TGCCGTGGGTGAAAGGTAGAAGG + Intronic
1017771828 6:157650063-157650085 CGCTGTGGGTGCACGGGAGAGGG + Intronic
1019029775 6:169000261-169000283 CGCTGTGGGTGAAGAGAAGACGG - Intergenic
1019548344 7:1589456-1589478 GGCTGTGGGTGCAGGGGTGCTGG - Intergenic
1019593517 7:1847646-1847668 GGCTTTGGGAGATGGGCCGAGGG - Exonic
1019775383 7:2909446-2909468 GGCAGAGGGTGAGGGACAGAGGG - Intronic
1019862269 7:3670329-3670351 GGCTGTGGCTGGACGTCAGAGGG - Intronic
1020550194 7:9594791-9594813 GGATCTGGGTAATGGGCAGAGGG + Intergenic
1021227962 7:18050797-18050819 GACAGTGGCTGAAGGTCAGAGGG + Intergenic
1021351732 7:19602386-19602408 GCCTGAGGGTGGAGTGCAGAGGG + Intergenic
1021357890 7:19676169-19676191 GTCAGTGGGTGAAGGGTGGAAGG + Intergenic
1021768124 7:23969690-23969712 GAGTGTGGGGGAAGGGCAGGGGG + Intergenic
1021769239 7:23982338-23982360 GATTGTGGTTGAAGTGCAGATGG + Intergenic
1023755929 7:43416904-43416926 GGCAGTGGGTGCAGGCCAGTGGG - Intronic
1023965279 7:44960875-44960897 GGCTGAGGGCTAAGGGCTGAGGG + Intergenic
1024191222 7:47012512-47012534 GGCATTGGGTGAAGGGAAGGAGG + Intergenic
1024317186 7:48032089-48032111 GCCAGTGGCTGATGGGCAGAGGG + Intergenic
1024339213 7:48239898-48239920 GGATGTTGGTGTGGGGCAGAGGG + Intronic
1024674063 7:51622390-51622412 GGATTAGGATGAAGGGCAGAGGG + Intergenic
1025803053 7:64805596-64805618 GGCTGTGTCTCAAGGGAAGATGG + Intronic
1026440328 7:70438394-70438416 GGCTGGGGGTGCAGGGCAGGAGG - Intronic
1026968395 7:74454213-74454235 GGGTGGGGGAGAAGGGGAGAAGG - Intronic
1027052267 7:75027874-75027896 AGCTGGGGGACAAGGGCAGACGG - Intronic
1029127287 7:98303374-98303396 ACCTGTGGGTGAAGGGGAGGAGG - Intronic
1029375106 7:100172377-100172399 GGCTGGGGGTGAAATGGAGAGGG - Intronic
1029479053 7:100802084-100802106 GGCTGTGGGGGAAGGGAAGAAGG - Intergenic
1031435303 7:121725332-121725354 GACAGTGGGTGAAGGACAGTGGG - Intergenic
1032153688 7:129451379-129451401 GGCTGTGTGTGGAGGACAGAGGG + Intronic
1032180281 7:129670175-129670197 GTCTGGGGGTGAGGGACAGATGG + Intronic
1032922728 7:136567443-136567465 GGCACTGGGAGAAGGGCACAGGG - Intergenic
1033207594 7:139436309-139436331 GACAGTGGGGGAAGGGCAGACGG - Intergenic
1033242379 7:139690758-139690780 GGCTGAAGGTGAAGGGGAGCTGG - Intronic
1033426832 7:141252327-141252349 GGCTGTGCCTGCAGGACAGAGGG - Intronic
1033447622 7:141436531-141436553 GGGTGTTGGTGAAGGGTAGAGGG + Intronic
1033478690 7:141716453-141716475 GGCAGAAGGAGAAGGGCAGAAGG - Intronic
1033800776 7:144899317-144899339 GGTATTGGGTGAAGGGAAGAAGG + Intergenic
1034161037 7:148994522-148994544 AGCTGGGTGTGAAGGTCAGAGGG - Intergenic
1034202341 7:149290273-149290295 GGCTTGAGGGGAAGGGCAGAGGG + Intronic
1034227468 7:149495152-149495174 GCTTGTGGGGGAGGGGCAGATGG - Intronic
1035301609 7:157901238-157901260 GGATGTGGGGGAGGGACAGATGG - Intronic
1035305555 7:157929220-157929242 GGCTGTGGGTTATGGGGAGGGGG - Intronic
1035643796 8:1203018-1203040 GGATGTGGGTGCCCGGCAGATGG - Intergenic
1035714098 8:1740632-1740654 GGCTATGCGTGCAGGGGAGAGGG - Intergenic
1036131887 8:6123131-6123153 GTCTGTGGCTGAAGGCCTGAGGG + Intergenic
1036599955 8:10251674-10251696 GGATGTGGGTGTGGGGAAGATGG - Intronic
1036635542 8:10547712-10547734 GGGGGTGGGGGAAGGGGAGAGGG - Intronic
1037521256 8:19682458-19682480 GTGTGTGGGTGAGTGGCAGAGGG - Intronic
1037606612 8:20443162-20443184 TTCTGTGGGTGAAAGGCAGAGGG + Intergenic
1038366513 8:26940938-26940960 GGCAGTGGGTGCAGGACAGTGGG - Intergenic
1038412084 8:27366804-27366826 GGCTGTGTGTGGAGAGCAGAGGG + Intronic
1038509003 8:28113249-28113271 GAATGTGGATGCAGGGCAGAAGG - Intronic
1038750693 8:30292733-30292755 GGTTGTGGGGGAAAGGTAGAGGG - Intergenic
1039147654 8:34466775-34466797 GGCTCTGGGGTGAGGGCAGAAGG + Intergenic
1039829338 8:41200568-41200590 GGATGGGGGTGAGGGCCAGAAGG - Intergenic
1040802497 8:51358743-51358765 GGTTGTGGGGGAGGGGAAGAAGG - Intronic
1041469207 8:58190294-58190316 GGCTGTGGCTGAAGGGAATGGGG + Intronic
1041694121 8:60717555-60717577 GGGTGTAGGGGAAGGGCAGGTGG + Intronic
1041768434 8:61445492-61445514 GGCTGAAGGTGAAGGGGAGCAGG - Intronic
1041941569 8:63393854-63393876 GGCTGTGCGTATAGGGCAGGGGG - Intergenic
1042730230 8:71925455-71925477 TGCTGAGTGTGGAGGGCAGATGG - Intronic
1043130569 8:76455841-76455863 GGCTGGGGGTGTAGGGAACAGGG + Intergenic
1043477260 8:80617426-80617448 GGCTGTGGGGGAAGGGGGGATGG - Intergenic
1043762332 8:84082852-84082874 GACAGTGGGTGCAGGACAGAGGG - Intergenic
1043876060 8:85487672-85487694 GGCTGTGGGTGTATCGTAGATGG + Intergenic
1044092246 8:88016166-88016188 GTCTGTGGGTGTCTGGCAGAGGG + Intergenic
1044178722 8:89163000-89163022 GGCAGTGGGTGCAGGACAGTGGG + Intergenic
1044618378 8:94165393-94165415 GACGCTGGGTGAAGGGGAGATGG - Intronic
1044848779 8:96407782-96407804 TGCAGGGGGTGAAGAGCAGAGGG + Intergenic
1044874402 8:96650156-96650178 AGGTGTGGGTGCTGGGCAGAGGG + Intronic
1046352097 8:113028671-113028693 GGCTTTGGCTGAAGGGAATATGG - Intronic
1046503882 8:115112054-115112076 TGCAGTGGGGGAAGGGCAGCTGG - Intergenic
1047016083 8:120724836-120724858 GACTGTGGGTGAAATGCACAAGG + Intronic
1047435696 8:124834032-124834054 TGCTGAGGGTAAAGGGGAGAGGG - Intergenic
1047498847 8:125427402-125427424 GGCTGTGGGAGAAAGGAAAAAGG + Intergenic
1048289114 8:133166248-133166270 GACCGTGGGTGAAGAGCAGTTGG - Intergenic
1048295851 8:133212843-133212865 GCCTGCGGGGGGAGGGCAGAGGG - Exonic
1048355873 8:133653725-133653747 GGGTGTGGGTGCAGGGCACAGGG + Intergenic
1048941345 8:139403306-139403328 GGCTGTGGGTGTGAGGGAGAAGG - Intergenic
1049069164 8:140343890-140343912 AGCTGAGTGTGGAGGGCAGAGGG + Intronic
1049256015 8:141614352-141614374 GGCTGGGGGTGGAGGGGAGCAGG - Intergenic
1049372226 8:142273384-142273406 GGCAGAAGGTGATGGGCAGAAGG - Intronic
1049433188 8:142574670-142574692 GGCTGTGGGGGACGGGCAGTGGG + Intergenic
1049584759 8:143427787-143427809 GGCTGGGGGTGCAGGGCAGGAGG - Intronic
1050297563 9:4221261-4221283 GAATCTGGGTGAAGGGCATATGG + Intronic
1051398980 9:16659120-16659142 AGGTGTGGGTAAATGGCAGATGG + Intronic
1051421025 9:16889456-16889478 CCCTGTGGTTGAAGGACAGAAGG + Intergenic
1051456946 9:17269037-17269059 GGCAGTGGGTGCAGGACAGTGGG - Intronic
1051502452 9:17792764-17792786 GGTTGTGGGTGAAGGTGGGAAGG - Intronic
1051609479 9:18947417-18947439 GGGTGTGGCTGAAAGGCAGACGG - Intronic
1052495214 9:29215148-29215170 GGCTGTGGGTTTAGGGGTGATGG + Intergenic
1052973873 9:34398143-34398165 GGGTGTGGGCAAGGGGCAGATGG - Intergenic
1053347082 9:37385782-37385804 GGATGAGGGAGAAGAGCAGAGGG - Intergenic
1053669421 9:40345925-40345947 GGCTGTGGGGGAAGGGATCAAGG - Intergenic
1053670724 9:40358880-40358902 GGCTGTGGGGGAAGGGATCAAGG + Intergenic
1053919217 9:42972166-42972188 GGCTGTGGGGGAAGGGATCAAGG - Intergenic
1053920526 9:42985253-42985275 GGCTGTGGGGGAAGGGATCAAGG + Intergenic
1054380551 9:64485945-64485967 GGCTGTGGGGGAAGGGATCAAGG - Intergenic
1054381845 9:64498942-64498964 GGCTGTGGGGGAAGGGATCAAGG + Intergenic
1054513890 9:66017421-66017443 GGCTGTGGGGGAAGGGATCAAGG - Intergenic
1054515195 9:66030366-66030388 GGCTGTGGGGGAAGGGATCAAGG + Intergenic
1054805974 9:69396058-69396080 GGCTGTGGGCCAGGGGCTGAGGG + Intergenic
1055237835 9:74145604-74145626 GGCTGCTGGATAAGGGCAGAGGG - Intergenic
1055513161 9:77014858-77014880 GCCCGAGGGTGGAGGGCAGAAGG - Intergenic
1056173639 9:84012885-84012907 GATTGGGGGTGAAGGGCAGATGG + Intergenic
1056586895 9:87932919-87932941 GGCTCTGTGGGAAGGGCAGTGGG - Intergenic
1056624889 9:88245226-88245248 GGGTGTGGCTGCCGGGCAGAGGG + Intergenic
1057131413 9:92656815-92656837 CGCTTTGGGAGAAGGGCAGACGG - Intronic
1057272439 9:93658572-93658594 GTCTGTGGGTGGGGGACAGATGG + Intronic
1057277296 9:93682770-93682792 GGCTGTGGGTGTGGGGCAAGGGG + Intergenic
1057314319 9:93958889-93958911 GGGTGTGGGTGGAGGGGAGGTGG - Intergenic
1057919279 9:99083207-99083229 TGCTGTGGCTGAGGGGCAGAAGG + Intergenic
1058858566 9:109091082-109091104 GGAAGTGGGTGAAGGGGAGGAGG + Exonic
1058978016 9:110142668-110142690 GGCTCAGGGTGTAGGGGAGAAGG + Intronic
1059340503 9:113595020-113595042 GGATGGGGGCGAAGGGGAGAGGG - Intronic
1059344186 9:113616998-113617020 GGCCGTGGTTGGAGGGCAGGGGG - Intergenic
1059382464 9:113937177-113937199 GAATGTGGGTGAAGGGCAGGTGG - Intronic
1059507074 9:114809196-114809218 GGCAGTGGGTGAGGGGGAGTGGG + Intergenic
1059635155 9:116163164-116163186 GGCAGTGGGTGTTGGGGAGAAGG + Intronic
1059989748 9:119853911-119853933 GGCAGTGGCTGAAGGACGGAGGG + Intergenic
1060275287 9:122177881-122177903 CTCTGTGGGAGAAGGGGAGAGGG - Intronic
1060510926 9:124231638-124231660 TGCTGGGAGTGAAGGGTAGATGG - Intergenic
1061001269 9:127904356-127904378 GACTGTGGGGGAAGGGCTGGGGG - Intronic
1061063452 9:128262769-128262791 GGTTGTGGGGCAAGGGTAGAGGG - Intronic
1061275508 9:129567828-129567850 GGCTGTGGCTGGCAGGCAGAGGG + Intergenic
1061609715 9:131738740-131738762 GGCTGTGGTTGAAGCACAGAAGG - Intronic
1061809908 9:133156183-133156205 GGCTGTGGGGGAAGGTCAGAGGG - Intronic
1061968641 9:134031238-134031260 GGCTGTGGGGGCAGCGCAGCAGG - Exonic
1062020386 9:134316541-134316563 GGCAAGGGGTGGAGGGCAGAGGG - Intergenic
1062031791 9:134365146-134365168 GGCTGTTGCTGGAGGGCTGATGG + Intronic
1062139112 9:134945680-134945702 GGCAGAGGGTGGAGGGCAGAGGG + Intergenic
1062139117 9:134945694-134945716 GGCAGAGGGCGGAGGGCAGAGGG + Intergenic
1062139123 9:134945715-134945737 GGCAGAGGGCAAAGGGCAGAGGG + Intergenic
1062244711 9:135559664-135559686 GGCTGAGGCTGAAGGGCAAATGG + Intergenic
1062345832 9:136114749-136114771 GGCTGAGGGTGAAGGTGGGACGG - Exonic
1062623512 9:137433136-137433158 CCCTGTGGGTGGAGGGCAGCCGG - Intronic
1203422763 Un_GL000195v1:10410-10432 GGCTGTGCGTGAGGTGCAGCAGG + Intergenic
1186290853 X:8097002-8097024 GGCTGAGGTTGAAGGACTGATGG - Intergenic
1186416908 X:9391777-9391799 GGCTGTGGGTGGAGGGCAACGGG + Intergenic
1186459962 X:9740082-9740104 AGCAGTGGGAGAAGGGGAGAGGG + Intronic
1186485665 X:9932604-9932626 GGCTGTGGGAGAGGGACAGGCGG - Exonic
1186565995 X:10663289-10663311 GGCTAGGGGTGAAGGGTAGGGGG - Intronic
1187426269 X:19180146-19180168 GGGTGTGGGAGAAGGTCAGCAGG + Intergenic
1188481191 X:30638519-30638541 GGCAGTGGGTAAAGTACAGATGG + Intergenic
1189081226 X:37974818-37974840 CACTGAAGGTGAAGGGCAGAAGG + Intronic
1189267035 X:39725170-39725192 GGATGTGGGGGGAGGGCAAAGGG - Intergenic
1189271551 X:39755539-39755561 TACTGTGGGGGAAGGACAGAGGG + Intergenic
1189446625 X:41086160-41086182 GGATGTGGGTGAGGGGAGGAGGG + Intronic
1190074252 X:47304327-47304349 GGCTGAGGGTGAGGGGAATAGGG - Intergenic
1190323723 X:49193682-49193704 GGCTGTGGGTGTTGGGGGGAGGG + Intronic
1190508812 X:51156440-51156462 GGCAGTGGGATATGGGCAGAAGG - Intergenic
1191646931 X:63492221-63492243 GACAGTGGGTGCAGGGCAGTGGG + Intergenic
1191697365 X:64003813-64003835 TTCTGTAGGTGATGGGCAGAAGG - Intergenic
1191874007 X:65775824-65775846 GGCTGGGGGTAAAGGGCAGTGGG - Intergenic
1191902319 X:66053797-66053819 GGCTGAAGGTGAAGGGAGGAAGG - Intergenic
1192554623 X:72079934-72079956 GGCTGTGGGTGGAGTGCAGCGGG + Intergenic
1192608370 X:72543384-72543406 GGCTGTGGCTGGAGAGCAGGTGG + Intronic
1193029495 X:76882335-76882357 GACAGTGGGTGAAGGACAGTGGG + Intergenic
1194211897 X:91080923-91080945 GGCAGAAGGTGAAGGGCAGAAGG + Intergenic
1195976481 X:110532887-110532909 GACTATGGCTGAAGAGCAGAAGG - Intergenic
1196205960 X:112939688-112939710 GGCTGGGGGTGATGTGCGGATGG + Intergenic
1196442398 X:115728610-115728632 GGACGTGGGGGAAGGGCAGGTGG - Intergenic
1196443159 X:115732294-115732316 GGACGTGGGGGAAGGGCAGGTGG + Intergenic
1196443818 X:115735262-115735284 GGACGTGGGGGAAGGGCAGGTGG + Intergenic
1196444355 X:115737629-115737651 GGACGTGGGGGAAGGGCAGGTGG - Intergenic
1196445480 X:115844209-115844231 GGACGTGGGGGAAGGGCAGGTGG + Intergenic
1196446151 X:115847190-115847212 GGACGTGGGGGAAGGGCAGGTGG + Intergenic
1196446822 X:115850171-115850193 GGACGTGGGGGAAGGGCAGGTGG + Intergenic
1196447490 X:115853154-115853176 GGACGTGGGGGAAGGGCAGGTGG + Intergenic
1196448161 X:115856133-115856155 GGACGTGGGGGAAGGGCAGGTGG + Intergenic
1196448830 X:115859124-115859146 GGACGTGGGGGAAGGGCAGGTGG + Intergenic
1196449501 X:115862115-115862137 GGACGTGGGGGAAGGGCAGGTGG + Intergenic
1196450170 X:115865098-115865120 GGACGTGGGGGAAGGGCAGGTGG + Intergenic
1196450840 X:115868083-115868105 GGACGTGGGGGAAGGGCAGGTGG + Intergenic
1196451511 X:115871062-115871084 GGACGTGGGGGAAGGGCAGGTGG + Intergenic
1196452182 X:115874049-115874071 GGACGTGGGGGAAGGGCAGGTGG + Intergenic
1196452852 X:115877018-115877040 GGACGTGGGGGAAGGGCAGGTGG + Intergenic
1196453522 X:115880011-115880033 GGACGTGGGGGAAGGGCAGGTGG + Intergenic
1196454191 X:115883020-115883042 GGACGTGGGGGAAGGGCAGGTGG + Intergenic
1196454858 X:115886009-115886031 GGACGTGGGGGAAGGGCAGGTGG + Intergenic
1196455272 X:115888091-115888113 GGACGTGGGGGAAGGGCAGGTGG + Intergenic
1196621903 X:117833443-117833465 GGCAGTGGGTGCAGGACAGTGGG - Intergenic
1197738581 X:129871786-129871808 TGCTGTTGGTGCTGGGCAGAGGG - Intergenic
1198005474 X:132489321-132489343 GGCTGTGGGAGGAGGGGACAAGG + Intronic
1198648040 X:138830949-138830971 GGTTTTGGGTGAAGGGCTTAGGG + Intronic
1198968233 X:142250425-142250447 GCCTGTGTGTGGAGTGCAGAGGG + Intergenic
1199055453 X:143288636-143288658 GACTGAGGGTGAAAGGAAGAAGG - Intergenic
1199380368 X:147165277-147165299 TGCTGTGGGAGAGGGGCTGATGG + Intergenic
1199641643 X:149868060-149868082 GAAGGTGGGTGAAGGGCAGGTGG + Intergenic
1199990909 X:152987432-152987454 GGCTGTCGGGGAGGGGCAGGGGG - Intergenic
1200033996 X:153316906-153316928 GGCTGTCGGGGAGGGGCAGGGGG - Intergenic
1200051006 X:153431689-153431711 GGCTGGGGGTGAGGGAGAGAAGG + Intergenic
1200120184 X:153786469-153786491 GAGAGTGGGTGGAGGGCAGAAGG + Intronic
1200272985 X:154704268-154704290 GGCTGTGGGGGAAGTGGGGATGG + Intronic
1200871402 Y:8102432-8102454 GGCTGTGGGTGCAGGACAGTGGG - Intergenic
1201146142 Y:11066624-11066646 GGGAGTGGGAGAAGGGAAGAAGG + Intergenic
1201748040 Y:17402239-17402261 GGCTGTGAGTGAAGTGCTGCAGG + Intergenic
1201795722 Y:17894682-17894704 GGCAGTGGGTGCAGGACAGTGGG + Intergenic
1201805833 Y:18011303-18011325 GGCAGTGGGTGCAGGACAGTGGG - Intergenic
1202357147 Y:24063774-24063796 GGCAGTGGGTGTAGGACAGTGGG + Intergenic
1202513630 Y:25606340-25606362 GGCAGTGGGTGTAGGACAGTGGG - Intergenic