ID: 966882435

View in Genome Browser
Species Human (GRCh38)
Location 3:184357922-184357944
Sequence AATGAAGGAGTCCCTCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 202}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966882435_966882445 25 Left 966882435 3:184357922-184357944 CCACCAGGAGGGACTCCTTCATT 0: 1
1: 0
2: 1
3: 22
4: 202
Right 966882445 3:184357970-184357992 CAAGCGGCATCCCGCTGCCTAGG 0: 1
1: 0
2: 1
3: 3
4: 65
966882435_966882446 26 Left 966882435 3:184357922-184357944 CCACCAGGAGGGACTCCTTCATT 0: 1
1: 0
2: 1
3: 22
4: 202
Right 966882446 3:184357971-184357993 AAGCGGCATCCCGCTGCCTAGGG 0: 1
1: 0
2: 0
3: 2
4: 32
966882435_966882442 9 Left 966882435 3:184357922-184357944 CCACCAGGAGGGACTCCTTCATT 0: 1
1: 0
2: 1
3: 22
4: 202
Right 966882442 3:184357954-184357976 GCAGTTACCTCTTTGCCAAGCGG 0: 1
1: 0
2: 0
3: 11
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966882435 Original CRISPR AATGAAGGAGTCCCTCCTGG TGG (reversed) Intronic
900115130 1:1025068-1025090 CAGCCAGGAGTCCCTCCTGGGGG - Intronic
901419648 1:9142423-9142445 GGTGAAGCAGTGCCTCCTGGTGG - Intergenic
903179587 1:21598455-21598477 GATGAAGGAGTCCCGCTTGTGGG + Exonic
903188506 1:21642950-21642972 AATCAAGGAGGGCTTCCTGGAGG - Intronic
903350753 1:22715227-22715249 AATCAAGGAGGTCTTCCTGGAGG + Intronic
904353474 1:29923918-29923940 AAGGAGGGAGCCCTTCCTGGGGG - Intergenic
907324303 1:53626874-53626896 AATGAATGAATCCCCCATGGTGG - Intronic
907382001 1:54098739-54098761 AATCAGGGAGTGCTTCCTGGAGG + Exonic
919596533 1:199570731-199570753 AAGGAAGGAGTCCATTCAGGGGG - Intergenic
921806550 1:219461916-219461938 AATCAAGGAGAACCTCATGGAGG - Intergenic
922057782 1:222057904-222057926 AATTAAAGAGTCCCTCTTGGAGG - Intergenic
922349054 1:224721006-224721028 AATGAAGGAGGGCCCCTTGGAGG - Intronic
922726113 1:227923819-227923841 AACCAAGGACACCCTCCTGGTGG + Intronic
923105272 1:230849435-230849457 AAGGAAGCCGTCCCTCCTGACGG + Intronic
924708238 1:246515100-246515122 GATGAAGGAATCGCTCCAGGAGG - Intergenic
1064020370 10:11804551-11804573 AATCCAGAAGTCACTCCTGGGGG - Intergenic
1067749281 10:48959505-48959527 AAGCAAGGAGGGCCTCCTGGAGG + Intronic
1069873185 10:71545645-71545667 ACTGATGGAGTCCCTGCTGTTGG + Intronic
1070314455 10:75296584-75296606 TATGAAGGACTCCAGCCTGGTGG + Intergenic
1070677238 10:78420550-78420572 AATGATGGACTCCTTCCTGCAGG + Intergenic
1071876873 10:89851987-89852009 GATCAAGGACTCTCTCCTGGTGG + Intergenic
1074126758 10:110534752-110534774 AATCCAGGAGGCCTTCCTGGAGG + Intergenic
1074453945 10:113581281-113581303 AATCAAGGAGGACTTCCTGGAGG - Intronic
1077712593 11:4551767-4551789 AATGAAGGAGTGACCCCTGCTGG + Intergenic
1078696871 11:13642891-13642913 AATTAAGCACTACCTCCTGGAGG - Intergenic
1079764432 11:24373646-24373668 AATGAATGAGTCAGCCCTGGTGG - Intergenic
1080660929 11:34295343-34295365 GAGGAACGAGTCCCTGCTGGAGG + Intronic
1083512840 11:63227567-63227589 AATGAAGGAGTCTATTTTGGAGG + Intronic
1084399850 11:68937176-68937198 AAGGAAGGGCTTCCTCCTGGTGG + Intronic
1087882010 11:103427724-103427746 AATGGAGCAGCCCCTCGTGGTGG - Intronic
1088746509 11:112808836-112808858 AAGGAATGAGTCTCTACTGGTGG + Intergenic
1089345655 11:117789872-117789894 AAGGAAGGAGTCCCTGTTGCAGG + Intronic
1089771939 11:120809238-120809260 GATGAAGAAGTCCCTCCATGGGG + Intronic
1090045739 11:123331372-123331394 AATGCAGGAATCCCTTCTGCAGG + Intergenic
1092154707 12:6274642-6274664 CTTCTAGGAGTCCCTCCTGGAGG - Intergenic
1092209788 12:6638793-6638815 AATGGAGGAGAGCCTGCTGGTGG + Intronic
1092917884 12:13204420-13204442 AAGGAAGCACTCCCTTCTGGGGG - Intronic
1093779036 12:23112744-23112766 ACTGAAGCTGTCCCTCCTCGTGG - Intergenic
1094169144 12:27473275-27473297 GAAGAAGGATTCTCTCCTGGAGG - Intronic
1095977290 12:47948486-47948508 AATCAAGGAGTGCTCCCTGGAGG + Intergenic
1096570931 12:52522756-52522778 AATAATGGAGCCGCTCCTGGTGG + Intergenic
1096800199 12:54105582-54105604 AATCAAGGAGTACTTCCTGGAGG - Intergenic
1102463086 12:113112263-113112285 TTTGAAGGAGATCCTCCTGGAGG + Exonic
1103452460 12:121038915-121038937 CACGAAGGAGTCCAGCCTGGAGG + Exonic
1104359782 12:128121697-128121719 CATGAAGGAGCCCAGCCTGGGGG + Intergenic
1105948112 13:25206972-25206994 ACTTACTGAGTCCCTCCTGGGGG - Intergenic
1108835034 13:54533794-54533816 GATGAATGAGTCTCTCCTTGTGG - Intergenic
1110249068 13:73361183-73361205 CATCAAGGAGTCCCTCCATGTGG + Intergenic
1113425044 13:110200838-110200860 AGTTAAGGAGTCTCACCTGGAGG + Exonic
1113558597 13:111258330-111258352 AAGGAAGGAGTCTCTCCTGGAGG - Intronic
1113708600 13:112449629-112449651 ACTGAAGGAGACCCTGGTGGTGG - Intergenic
1116788074 14:49309774-49309796 AATCAGGGAAGCCCTCCTGGAGG + Intergenic
1118380497 14:65214016-65214038 AATGTAGCAGTTCCTCCAGGTGG - Intergenic
1120921698 14:89761279-89761301 ACTGAAGCAGGCCCACCTGGAGG - Intergenic
1122153881 14:99738841-99738863 TACGAAGGAGGCCCTGCTGGAGG - Intronic
1122722322 14:103729161-103729183 ACAGAAGGCTTCCCTCCTGGAGG + Exonic
1123219271 14:106841355-106841377 AAAGAAGGAGCCCCTCCTCTGGG - Intergenic
1123895455 15:24824935-24824957 AATGAAGGACTCATTCCTGCAGG + Intronic
1123918548 15:25054793-25054815 GATGAAGAAATCCCTGCTGGGGG - Intergenic
1129034817 15:72642575-72642597 AATGAAAGGGGCCCTGCTGGAGG - Intergenic
1129215065 15:74094641-74094663 AATGAAAGGGGCCCTGCTGGAGG + Intergenic
1129390305 15:75216975-75216997 AATGAAAGGGGCCCTGCTGGAGG - Intergenic
1129732207 15:77938987-77939009 AATGAAAGGGGCCCTGCTGGAGG + Intergenic
1132545482 16:531131-531153 AATGAGGGAGTTCCTCCTCATGG + Intronic
1133203969 16:4221785-4221807 AACGAAGGAGTCTCTCCTGTGGG - Intronic
1134059874 16:11192792-11192814 ACTGTAGGAGTGCCTGCTGGGGG - Intergenic
1137527586 16:49249869-49249891 AATGAACAAAACCCTCCTGGTGG - Intergenic
1137580492 16:49630824-49630846 AATAACTGAGCCCCTCCTGGTGG + Intronic
1138245745 16:55466135-55466157 AATCAAGGAGGACTTCCTGGAGG + Intronic
1140683710 16:77412108-77412130 GATGAATGAGACCCACCTGGTGG - Intronic
1140936640 16:79676892-79676914 GATCAAGGAGTGCTTCCTGGAGG - Intergenic
1142371718 16:89686395-89686417 CATGAAGGACTCCCACCTGGAGG + Intronic
1143018459 17:3904194-3904216 CAGGAGGGAGTCCCTCCCGGAGG + Intronic
1143204955 17:5134882-5134904 GATGATGGAGTCGCTCCAGGAGG + Intronic
1143713899 17:8753524-8753546 CAGGCAGGGGTCCCTCCTGGTGG - Intronic
1145718920 17:27049918-27049940 ACTGAAGCAATCCCTCCTGGTGG - Intergenic
1145752992 17:27368502-27368524 CATGAAGGAGGGCCTTCTGGAGG - Intergenic
1145760635 17:27423556-27423578 GATGAAGGAGTCGCTCCAGAAGG + Intergenic
1145798401 17:27668739-27668761 GATGAAGGAGTCACTCCAGGAGG - Intergenic
1146160687 17:30557872-30557894 GATGAAGGAGTCGCTCCAGGAGG + Exonic
1146262985 17:31433750-31433772 AAGGAAGGAGGCCTTCCTGGGGG - Intronic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1148155556 17:45423497-45423519 AATCCAGGAGTGCTTCCTGGAGG - Intronic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150013688 17:61531252-61531274 AATGAAACAGACCCTGCTGGTGG + Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1152696622 17:81800829-81800851 ATTGCAGGGGGCCCTCCTGGAGG - Intergenic
1154470228 18:14693444-14693466 AATGAAGCAGTCCTTCAGGGTGG + Intergenic
1156117373 18:33802226-33802248 ACTGTAGAAGTCCCTCCTAGTGG - Intergenic
1156855195 18:41773880-41773902 AATGAAGAAGTCCATCCACGAGG + Intergenic
1158157653 18:54443589-54443611 AATTTAGGAGTGCCTCCCGGGGG - Intergenic
1162180242 19:8863806-8863828 AATTAAGGAGGGCTTCCTGGAGG - Intronic
1162326694 19:10003749-10003771 AATGATGGGGTCTCTGCTGGTGG - Intronic
1162803427 19:13123564-13123586 AATGAAGAAGGCCTTCCTTGGGG + Intronic
1164635183 19:29786397-29786419 AATGCTGGAGGCCTTCCTGGAGG + Intergenic
1165896803 19:39146332-39146354 AATCAAGGAAGGCCTCCTGGAGG + Intronic
1166076384 19:40415978-40416000 AATCAAGGAGGGCTTCCTGGAGG + Intergenic
926250776 2:11154712-11154734 ACTGAAGGCTTCCCTCCTAGCGG - Intergenic
927089839 2:19701933-19701955 AACCAAGGAGTCCCCCCAGGTGG + Intergenic
928371451 2:30742836-30742858 AAAGAAAGAGTCCATCATGGAGG - Intronic
929569331 2:43010228-43010250 AATGTAGGCCTCCTTCCTGGAGG + Intergenic
930033407 2:47071532-47071554 AATGAAACAGTCCTTCCTCGCGG - Intronic
931908456 2:66868613-66868635 AAGGAGGGAGACTCTCCTGGGGG + Intergenic
932739611 2:74281679-74281701 CTTGGAGGAGTCACTCCTGGAGG - Intronic
937041429 2:118823771-118823793 GTTGAAGGAGTCCCTTCTGGTGG + Intergenic
938742831 2:134248864-134248886 AATGAAGCAGTTCCTCCAGGTGG - Intronic
942860890 2:180610545-180610567 AATGAAGGAGTTTATCCTAGAGG - Intergenic
948039131 2:234885366-234885388 AATGAATGTGGCCCTCCTGCTGG - Intergenic
948925366 2:241092970-241092992 AAGGAAGGAGGCCCTCTTTGTGG - Exonic
949077935 2:242073281-242073303 AATGAAGAAGGCCCTGCTGCAGG + Intergenic
1170854873 20:20042731-20042753 GATGAAGGAGTCCTTGCTGTGGG - Intronic
1171796251 20:29568759-29568781 AATCAAGGAGTACTTCCTGGAGG + Intergenic
1171851986 20:30315408-30315430 AATCAAGGAGTACTTCCTGGAGG - Intergenic
1174344340 20:49918840-49918862 AATGAAGGATAGCCTCCAGGAGG + Intergenic
1175388853 20:58613926-58613948 AATCAAAGAGTCCTCCCTGGAGG - Intergenic
1175492593 20:59389320-59389342 CAGGAAGGAGCCTCTCCTGGAGG - Intergenic
1175818398 20:61895666-61895688 AAGGGAAGGGTCCCTCCTGGTGG - Intronic
1176910767 21:14561924-14561946 AAGGAAGGAGTCTCTCCTAGAGG + Intronic
1177849785 21:26332839-26332861 AAGGAAGGAGTCTCTCCTAGAGG - Intergenic
1180015096 21:45076507-45076529 AAAAAAGGAGGCCCTCCTGCAGG + Intronic
1182013233 22:27017982-27018004 AATGAAGCAGTTGCTCCTGATGG - Intergenic
1182062453 22:27407709-27407731 AATGAAAGATGCCTTCCTGGGGG - Intergenic
1184289180 22:43489225-43489247 AAAGAAGCAGCCCCTCCTGGAGG - Intronic
950100437 3:10353321-10353343 AATCAAGGAGGACTTCCTGGGGG + Intronic
952401616 3:32968672-32968694 AAAGAAGGAGCCCCTCCTCTAGG + Intergenic
954553651 3:51502219-51502241 AATGAAGCAGTGCCATCTGGTGG - Intergenic
954756063 3:52840642-52840664 AATGAAGAAGGCCCTGCTGGGGG - Intronic
956799472 3:72743897-72743919 AATGAAGGGTGACCTCCTGGAGG + Intergenic
960811779 3:121633143-121633165 GATGGAGGAGTCCCAACTGGAGG + Exonic
961436975 3:126925977-126925999 AATGGACGAGACCATCCTGGAGG + Intronic
961870163 3:129981651-129981673 AATGAAGGAAGCCTCCCTGGGGG + Intergenic
962313713 3:134344744-134344766 GATGAGGAAGTCCCTCCAGGTGG - Intergenic
963863071 3:150330642-150330664 AATGAAGGCTTCGTTCCTGGGGG - Intergenic
966055119 3:175677615-175677637 GATGAAGGAGTCCCTGGAGGGGG - Intronic
966882435 3:184357922-184357944 AATGAAGGAGTCCCTCCTGGTGG - Intronic
967187072 3:186953386-186953408 AAGGAAGGTGTCCTGCCTGGAGG - Intronic
969422362 4:7104773-7104795 AATCCAGGAATCCTTCCTGGGGG - Intergenic
970975876 4:22042297-22042319 AATGAAGGTTAGCCTCCTGGTGG + Intergenic
971374967 4:26049367-26049389 AAAGAAGGTTTCCCTCCTGAAGG + Intergenic
975657961 4:76660341-76660363 AATGAATGAGCCCCTCATAGAGG - Intronic
982026890 4:151259915-151259937 AGGGAAGGAGCCCTTCCTGGGGG - Intronic
985634796 5:1030735-1030757 AAAGTAGGCCTCCCTCCTGGGGG - Intronic
989418051 5:41203785-41203807 AATGAAGGAGTTTGACCTGGAGG - Intronic
992617734 5:78561500-78561522 CATGAGGGAGTCCCACCTTGTGG + Intronic
995191864 5:109326438-109326460 AATGAAGAAGTCCTTCCATGTGG + Intergenic
995835429 5:116395673-116395695 AAAGAATGAATACCTCCTGGAGG - Intronic
996518007 5:124394976-124394998 AGTGAAGGAGTGCTTGCTGGTGG - Intergenic
996673426 5:126147273-126147295 AAGGAAGGAATGCCTCCTGTTGG + Intergenic
996841859 5:127855322-127855344 AATGAATGAGTTGCTCCTTGTGG - Intergenic
997234988 5:132267557-132267579 AGTCAAGGAGTGCTTCCTGGAGG + Intronic
998328158 5:141300794-141300816 ACTGAAAGAGACCCTGCTGGTGG + Intergenic
999768210 5:154756187-154756209 AAGGAGGGAGACCCACCTGGGGG - Intronic
1002197898 5:177511150-177511172 AATGGAGGGCTCCCTCCAGGTGG + Intronic
1004535562 6:16497657-16497679 AATGGACGAGTCCAGCCTGGTGG + Intronic
1009271902 6:61624574-61624596 AATGAAGTAGTTCCTCTTGTTGG - Intergenic
1011714674 6:90092901-90092923 TAGGAAGTAATCCCTCCTGGAGG + Intronic
1013318486 6:108963902-108963924 AGTGAAAGAGTCCCAGCTGGTGG - Intronic
1016894974 6:149042578-149042600 AAGGAAGGAGTCATTCATGGTGG + Intronic
1017590219 6:155971179-155971201 AATGACTGTGTCCCTCCTTGTGG - Intergenic
1019508022 7:1403250-1403272 AATCCAGGAGTTCTTCCTGGAGG + Intergenic
1019780263 7:2935636-2935658 AATGAAGGAATGCCTCCTCCAGG - Intronic
1020371696 7:7439134-7439156 ACTGATGGAGTCCCTGCTGGAGG - Intronic
1020958467 7:14772784-14772806 AATGGATGATTTCCTCCTGGTGG - Intronic
1022616796 7:31940089-31940111 AATGAATCAGTCTCTCCAGGTGG - Intronic
1022818665 7:33937576-33937598 AAGGAAGGGGGCTCTCCTGGAGG + Intronic
1022985057 7:35645234-35645256 AATGAACCAGTCCCTGCTGATGG - Intronic
1023941069 7:44768670-44768692 ATTAAAGGACTCCCTCTTGGTGG + Exonic
1023993862 7:45146722-45146744 AAGTAAGGAGTCCCTGCAGGGGG + Intergenic
1024582292 7:50809855-50809877 CCTGCAGGTGTCCCTCCTGGAGG - Intergenic
1024603733 7:51008660-51008682 GCTGATGTAGTCCCTCCTGGGGG + Intergenic
1024716775 7:52088259-52088281 AGTGAAGGGGTCCCTCCCAGGGG - Intergenic
1026570650 7:71526888-71526910 AATGAAGGTGGACTTCCTGGAGG - Intronic
1028751686 7:94390379-94390401 AATCAAGGAGGGCTTCCTGGAGG - Intergenic
1029594914 7:101532586-101532608 AATCAAGGAGGACGTCCTGGAGG - Intronic
1030344068 7:108413538-108413560 AATCAAGGAGGGCTTCCTGGAGG - Intronic
1033330959 7:140416603-140416625 AATGAAGAAGCCCTTCCTTGGGG + Intronic
1035343098 7:158177086-158177108 AATGCAGGCGTCCCTCCTCTTGG + Intronic
1037354099 8:17998911-17998933 AGCAAAGGAGTCTCTCCTGGTGG + Intronic
1040557966 8:48497810-48497832 AAGGATGGAGTCTCACCTGGGGG + Intergenic
1040899520 8:52403514-52403536 CAGGAAGGACTCCTTCCTGGGGG - Intronic
1045268748 8:100643947-100643969 AATCAAGGAGGACTTCCTGGAGG + Intronic
1045492750 8:102682712-102682734 AGTAAAGGAGTCCCCACTGGGGG - Intergenic
1047891086 8:129311318-129311340 ATGGGAGGAGTCCCTCCTGTGGG - Intergenic
1048009870 8:130446850-130446872 AATGAGGGAGTGACTGCTGGGGG - Intergenic
1048281055 8:133106026-133106048 GATGGAGGAGACCCTCCTGTTGG + Intronic
1049241671 8:141540485-141540507 GATCAAGGTGTCCCTCCTGGGGG + Intergenic
1049469150 8:142767648-142767670 AACCAAGGAGGCCTTCCTGGAGG - Intronic
1049758051 8:144319513-144319535 AAGGAACCAGTCCCTACTGGTGG + Intronic
1053167375 9:35854091-35854113 GACCAAGGAGTCCCTCCTGCAGG + Exonic
1055781407 9:79825288-79825310 AATGAAGTGGTCTCTCCTGCTGG - Intergenic
1056500076 9:87200047-87200069 AAGGATGGAGCCCCTCATGGTGG + Intergenic
1058476375 9:105337902-105337924 AGTTAAGAAGACCCTCCTGGTGG + Intronic
1059357238 9:113709464-113709486 AATCAAGGAGGACTTCCTGGAGG + Intergenic
1059424055 9:114209812-114209834 AGTCAAGGAATTCCTCCTGGAGG + Intronic
1060026380 9:120175604-120175626 AATGAAGGAGGGCTTCTTGGAGG + Intergenic
1060445372 9:123682291-123682313 AATGAAGCAGTGCCTCCCGGGGG + Intronic
1060929915 9:127482852-127482874 AATCAAGGAGGCCTTCCTGGAGG + Intronic
1060999444 9:127894815-127894837 GCTGAAGGAGGCCTTCCTGGAGG - Intronic
1061499280 9:130992931-130992953 AATCAAGTAGTGCCTCCTGTAGG + Intergenic
1061869875 9:133514981-133515003 AAGGAAGGAGTGCAGCCTGGAGG - Intronic
1062027158 9:134345918-134345940 AATCAAGGAGGGCTTCCTGGAGG - Intronic
1062042979 9:134412582-134412604 GCGGAACGAGTCCCTCCTGGTGG - Intronic
1062187053 9:135223779-135223801 AATGAAGGAGTCACCCCAGGGGG + Intergenic
1062629420 9:137457135-137457157 AATCAAGGAGTGCTTCCTGGAGG - Intronic
1186204763 X:7189874-7189896 AATGAAGGAGGGCTTCCTTGTGG + Intergenic
1187984711 X:24797658-24797680 AATGAATGAGTTCCTTCTTGAGG + Intronic
1188769926 X:34140742-34140764 AAGGAAGGAGACCCACATGGAGG + Intergenic
1188797215 X:34481683-34481705 AGGGGAGGAGTACCTCCTGGGGG - Intergenic
1190781900 X:53604789-53604811 ACTGAAGGAGACCCTCTTGAAGG + Exonic
1190874932 X:54453068-54453090 AATGTAGGATTTCCTCCTAGTGG - Intronic
1192285455 X:69730301-69730323 AATCAGGGAATCCATCCTGGAGG + Intronic
1195229424 X:102831153-102831175 AGTGAAGGAGTCCTACCTGAGGG - Intergenic
1197481739 X:126995175-126995197 AAGGAAGGAGTCTTTTCTGGAGG - Intergenic
1200940003 Y:8771371-8771393 AAAGAAGGAGACCTCCCTGGAGG - Intergenic
1202148345 Y:21822880-21822902 AGTGAAGGAGACCCCCATGGGGG + Intergenic