ID: 966885146

View in Genome Browser
Species Human (GRCh38)
Location 3:184373346-184373368
Sequence CAGTCCCCCTAGAAGACCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 111}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966885146_966885151 27 Left 966885146 3:184373346-184373368 CCTCAGGTCTTCTAGGGGGACTG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 966885151 3:184373396-184373418 CCCTTGACTGGGGACTTACCTGG 0: 1
1: 0
2: 1
3: 10
4: 112
966885146_966885147 15 Left 966885146 3:184373346-184373368 CCTCAGGTCTTCTAGGGGGACTG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 966885147 3:184373384-184373406 GTTTCTACAGATCCCTTGACTGG 0: 1
1: 0
2: 0
3: 5
4: 71
966885146_966885149 17 Left 966885146 3:184373346-184373368 CCTCAGGTCTTCTAGGGGGACTG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 966885149 3:184373386-184373408 TTCTACAGATCCCTTGACTGGGG 0: 1
1: 0
2: 2
3: 13
4: 152
966885146_966885148 16 Left 966885146 3:184373346-184373368 CCTCAGGTCTTCTAGGGGGACTG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 966885148 3:184373385-184373407 TTTCTACAGATCCCTTGACTGGG 0: 1
1: 0
2: 1
3: 13
4: 152
966885146_966885153 28 Left 966885146 3:184373346-184373368 CCTCAGGTCTTCTAGGGGGACTG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 966885153 3:184373397-184373419 CCTTGACTGGGGACTTACCTGGG 0: 1
1: 0
2: 0
3: 5
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966885146 Original CRISPR CAGTCCCCCTAGAAGACCTG AGG (reversed) Intronic
902879726 1:19363530-19363552 CCTTCCCCCCAGAAGTCCTGTGG - Intronic
905266283 1:36756369-36756391 CAGTGCCCTGAGAAGACTTGAGG - Intergenic
905548637 1:38818646-38818668 CAGTCCCCCTAGACGAGAGGTGG + Intergenic
908845470 1:68320262-68320284 CAGTCCTCCGGGAAGACCTGAGG - Intergenic
911024287 1:93420762-93420784 CATTCCTCCTGGAAGACCTAGGG + Intergenic
914745552 1:150498585-150498607 CAGTCCCCCCAGACCACCAGAGG - Exonic
920322186 1:205132651-205132673 TAGTCCCTCAAGAAGACCTCAGG - Intergenic
920732744 1:208503270-208503292 GAGACCCCCTCGAAGACCTCTGG + Intergenic
922830123 1:228548459-228548481 CTGTCCCATTAGAACACCTGGGG + Intergenic
1067684709 10:48459338-48459360 CAGACCCCGCAGAAGGCCTGGGG + Intronic
1069231943 10:66021339-66021361 CAATCCTCCTATAAGACATGAGG - Intronic
1076895047 10:133306960-133306982 CCCTCCCCCCAGAAGACCTTTGG + Intronic
1076921729 10:133457798-133457820 CAGGACCCCTAGATGGCCTGCGG - Intergenic
1077163323 11:1123515-1123537 CAGTCCCCCTTTAGGACATGCGG + Intergenic
1078627720 11:12972897-12972919 CAGGCCCTCTGGAAGAGCTGTGG - Intergenic
1080296665 11:30737736-30737758 CAGAGCTCCTAGATGACCTGCGG + Intergenic
1083279072 11:61614262-61614284 CAGTCCCACTGGCAGACCAGGGG + Intergenic
1084581971 11:70029755-70029777 CACTCCCTCTAGAGGCCCTGGGG + Intergenic
1084958426 11:72703573-72703595 CAGTCCAGCTAGAAGCCCGGTGG - Intronic
1091155428 11:133367366-133367388 CAGTCTCCCTTGATGAGCTGAGG - Intronic
1091928512 12:4375339-4375361 CAGTCCCCCTAGAAAACATCCGG + Intronic
1100984436 12:100190807-100190829 CAGGGCCCGCAGAAGACCTGTGG + Intergenic
1103154033 12:118667904-118667926 CAGTCCCTCAAGGAGAGCTGAGG - Intergenic
1105706662 13:22971579-22971601 CAGTCCCCCTCAGAGCCCTGAGG + Intergenic
1108083031 13:46756951-46756973 CAGTGCCCCTCAAAGACCTAAGG - Intergenic
1111728200 13:92039984-92040006 CAGTCCCCTTGGCAGAGCTGTGG - Intronic
1113451826 13:110415717-110415739 CAGTCACCCTGGAAGACAGGCGG + Intronic
1113958463 13:114112291-114112313 CAGGCCCCCTAGAAGACTCCGGG - Intronic
1115515914 14:34184818-34184840 CAGTCAAGCTAGAAGTCCTGGGG + Intronic
1116504147 14:45657613-45657635 CAGACAACCTAGATGACCTGGGG - Intergenic
1117454260 14:55881966-55881988 CTGTCACCCTCGAAGACCAGTGG - Intergenic
1121711810 14:96044069-96044091 CAGTACCCCTGCAAGAGCTGGGG + Intronic
1122830671 14:104394097-104394119 CAGTCACCCCAGGAGCCCTGCGG + Intergenic
1123888189 15:24748744-24748766 GAGTCCCCAGAGAAGCCCTGGGG + Intergenic
1125720198 15:41841666-41841688 CAGTCCCCCGAGAAGGCCTAAGG - Intronic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1128261138 15:66233839-66233861 CACTCTCCCCAGAAGACCTTTGG - Intronic
1129154316 15:73708351-73708373 CATTCCCCCCAGAGGCCCTGTGG + Exonic
1130899939 15:88199616-88199638 CAGTCTCCCTAGAAGAGGGGCGG - Intronic
1131553799 15:93379662-93379684 CAGTCCCCCCAAAAGTGCTGGGG - Intergenic
1132747727 16:1443939-1443961 CCGTCACCCTGGAAGACCTGGGG - Exonic
1138008090 16:53355796-53355818 CAGTCAGCCTAGAAGACCAGGGG + Intergenic
1139674562 16:68514415-68514437 CAGGCCCCCAAGAAGACCATAGG - Intergenic
1142514260 17:416743-416765 CAGTCTCTCTAGCAGACATGTGG - Intronic
1142703702 17:1680679-1680701 CATTTCTCCTAGAAGAGCTGAGG + Intronic
1142811337 17:2396940-2396962 CAGGCGCCCCAGAAAACCTGAGG + Intronic
1143573338 17:7775173-7775195 GTGTCCGCCTAGAAGTCCTGGGG - Intronic
1146858894 17:36278901-36278923 CAGTCATCCTAAAAGACCTATGG + Intronic
1147089216 17:38082986-38083008 CAGTCATCCTAAAAGACCTATGG + Intergenic
1148135833 17:45291035-45291057 CACTCCCTCTAGGAGAGCTGTGG + Intronic
1152641096 17:81449589-81449611 CAGTGACCCCAGGAGACCTGGGG + Intronic
1156448372 18:37253320-37253342 CAGCCCTCCTGGAAGAACTGGGG + Intronic
1160075064 18:75666993-75667015 GAGTTCCCCAAGAAGCCCTGGGG - Intergenic
1163456109 19:17406578-17406600 CAGGCCTCCCAGAAGGCCTGGGG + Intronic
1166941953 19:46372571-46372593 CAATCCCCGAAGAAGCCCTGGGG - Intronic
1167331751 19:48860400-48860422 CTGACACCTTAGAAGACCTGCGG - Exonic
926044167 2:9697523-9697545 CTGCCCCCATAGCAGACCTGAGG - Intergenic
926047117 2:9717889-9717911 CAGTCTCCCCAGAGGAGCTGGGG - Intergenic
926645787 2:15288500-15288522 CAGGTCCCCTAGCAGGCCTGAGG - Intronic
927153945 2:20211233-20211255 AAGACCCCCTACAGGACCTGGGG - Intronic
928377231 2:30785463-30785485 CAGTCCCCCCAGTAGAGCTCAGG + Intronic
932749215 2:74360779-74360801 CAGTCTTCCCATAAGACCTGGGG - Intronic
936049756 2:109213960-109213982 CAGTCCCTGCAAAAGACCTGTGG + Intronic
936089108 2:109489481-109489503 AAGTCCACTTAGAAGAGCTGGGG + Intronic
937039660 2:118811065-118811087 CAGGCCACTTAGAAGGCCTGGGG - Intergenic
945209594 2:207368496-207368518 CAGCCCCTCTAGAACACCTGGGG + Intergenic
945901754 2:215546053-215546075 GAGCCCCTCTAGATGACCTGGGG + Intergenic
948646920 2:239411153-239411175 CAGTCACCCTAGAAGCAATGAGG - Intergenic
1172039653 20:32034941-32034963 CACTACCCCTAGAAGTCCTTGGG - Intergenic
1174149804 20:48478052-48478074 CAGGCCCCCTCGAAGTCCTGTGG - Intergenic
1174441605 20:50560017-50560039 CAGCCTCCCTAGAGGCCCTGAGG - Intronic
1174518660 20:51113151-51113173 CAGTCCCCCTGGAAGCTCCGGGG + Intergenic
1175961657 20:62640381-62640403 CAGACCCCCTTGATGGCCTGCGG + Intergenic
1176289551 21:5036899-5036921 CCGTCCCCCTGGAGGACATGGGG + Intronic
1178389917 21:32189747-32189769 CAGTCCTCCTAGATCACCTCAGG + Intergenic
1179867679 21:44226688-44226710 CCGTCCCCCTGGAGGACATGGGG - Intronic
1180604579 22:17047487-17047509 CAGCCACCCTAGGAGACATGGGG - Intergenic
1181594595 22:23906205-23906227 CACTCCCCCTTGGAGACCTCGGG - Intergenic
1182584913 22:31339381-31339403 CAGGCTCCCCAGAAAACCTGGGG - Intronic
1184008361 22:41727878-41727900 CAGTCCCCCATAAAAACCTGGGG - Intronic
951301223 3:20999533-20999555 CATTCCCCCGAAAAGACCAGAGG + Intergenic
951584063 3:24197206-24197228 GAGTCCTCCTAGCAGACCAGTGG - Intronic
953027080 3:39151629-39151651 CAGTCCCCCCAAAACACTTGGGG + Intronic
954814506 3:53270132-53270154 GACTCACCCTAGAAGGCCTGGGG + Intergenic
956259243 3:67319278-67319300 CAGTTCACCAAGAAGACATGAGG - Intergenic
961517280 3:127445813-127445835 CAGTCCTCCTGGAACACCGGAGG - Intergenic
965405175 3:168259457-168259479 CAGTCCCCTTAGAAGACTGAAGG - Intergenic
966885146 3:184373346-184373368 CAGTCCCCCTAGAAGACCTGAGG - Intronic
968899231 4:3423137-3423159 CAGCCCCCCTACAAGCCCGGGGG + Intronic
968930201 4:3574914-3574936 CAGTCCCCTTAGAAGATCAAGGG - Intergenic
980837624 4:138216447-138216469 CAGTCCCCCTTGTGGCCCTGGGG - Intronic
986591747 5:9377811-9377833 CTGTCCACTGAGAAGACCTGTGG + Intronic
994316578 5:98339818-98339840 CAATCCGCCTAGAACACTTGCGG - Intergenic
995138830 5:108710354-108710376 CACTCCCGCTAGAAGATCTAGGG + Intergenic
997530506 5:134578811-134578833 AAAGCCCCCAAGAAGACCTGGGG + Exonic
1003898261 6:10628712-10628734 GAGTCCCCTTACAAGACCTCTGG + Exonic
1014688876 6:124536448-124536470 GAGACCCCCTAGAACATCTGTGG - Intronic
1015836348 6:137424386-137424408 CTGTCTACCTAGAAGACTTGAGG + Intergenic
1019550069 7:1597760-1597782 CAGACCCCCTGGAAGCTCTGAGG - Intergenic
1021434389 7:20597830-20597852 CTGTGGCCCTAGATGACCTGGGG + Intergenic
1022354476 7:29599846-29599868 CAGTCCCCATAGAAGCACTGTGG + Intergenic
1032425557 7:131819843-131819865 CAGTGCCCATGGAGGACCTGGGG - Intergenic
1032439654 7:131932676-131932698 CTGTCCCCCAAGAGGGCCTGAGG - Intergenic
1034833118 7:154327094-154327116 CAGACCCCCCAAATGACCTGTGG - Intronic
1035363582 7:158329950-158329972 GAGTCGCCATACAAGACCTGAGG - Intronic
1037142886 8:15539797-15539819 CAGCCCCACTGGAAGGCCTGAGG - Intronic
1039856291 8:41417196-41417218 CTTTCCCCCCAAAAGACCTGTGG + Intergenic
1042485910 8:69345502-69345524 CAGTCTCCCTAGAAGACAGCAGG + Intergenic
1043744248 8:83853821-83853843 CAGTCCTCAGAGAAGACCTAGGG + Intergenic
1044293922 8:90505053-90505075 CAGTCTCCCTAGACCACTTGTGG + Intergenic
1048648579 8:136449700-136449722 CCCTCTCCCTAGAAGACCCGTGG - Intergenic
1049231062 8:141481848-141481870 CAGCCCCCCAGGAAGCCCTGAGG + Intergenic
1054459897 9:65456999-65457021 CAGTCCCCTTAGAAGATCAAGGG + Intergenic
1056929268 9:90861185-90861207 GAGATCCCCTGGAAGACCTGTGG - Intronic
1060344526 9:122804552-122804574 CAGTCCCCTTGGAAGAGCTTAGG + Intronic
1060529252 9:124338904-124338926 CAGTCCCCTTAAAGGACATGTGG + Intronic
1190263562 X:48814727-48814749 CAGTCGCCCTCGAGGTCCTGGGG + Exonic
1191229458 X:58082582-58082604 CACTCCCCTTAGAATGCCTGAGG - Intergenic
1191242831 X:58202814-58202836 CTCTCCCACTAGAATACCTGGGG - Intergenic
1195740553 X:108060904-108060926 CAGTCCCTCTAGATCACCAGGGG - Intronic