ID: 966885340

View in Genome Browser
Species Human (GRCh38)
Location 3:184374712-184374734
Sequence GAGGCTTAAATGATGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966885335_966885340 3 Left 966885335 3:184374686-184374708 CCTTTTCGTAGGAAGTGCTAGGG 0: 1
1: 0
2: 0
3: 7
4: 59
Right 966885340 3:184374712-184374734 GAGGCTTAAATGATGGAAGCAGG 0: 1
1: 0
2: 2
3: 9
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966885340 Original CRISPR GAGGCTTAAATGATGGAAGC AGG Intronic
902670414 1:17969374-17969396 GAGGCCTTTCTGATGGAAGCTGG + Intergenic
906168435 1:43705143-43705165 GGGATTTTAATGATGGAAGCAGG + Exonic
907176942 1:52532955-52532977 GATGGTTGAATGATTGAAGCGGG - Intronic
909078218 1:71078532-71078554 GAGGCCAAGATGATGAAAGCTGG - Exonic
909762124 1:79303076-79303098 GAGGCTAGAATGAGGGAACCAGG - Intergenic
912138948 1:106697525-106697547 GATGATTCAATCATGGAAGCTGG + Intergenic
912200805 1:107455449-107455471 GAGGGTTGGATGCTGGAAGCAGG + Intronic
912932641 1:113979001-113979023 GAGGCTTGAAGGGAGGAAGCAGG - Intergenic
913369672 1:118084009-118084031 GAGGTTTCAATGGTGGCAGCAGG + Intronic
915766064 1:158364067-158364089 GAGCCTGAAATAATGAAAGCTGG + Intergenic
916404707 1:164486649-164486671 GAGGCCTTTATCATGGAAGCTGG - Intergenic
917540483 1:175908220-175908242 GAGGCTTTAAGGATGTAAGAGGG + Intergenic
919150933 1:193697486-193697508 AAGGATTAAATTATGGAGGCTGG - Intergenic
920275913 1:204804145-204804167 GGGGCTGCAATGATGGAAGAAGG + Intergenic
923176750 1:231474332-231474354 GAGTCTTACATGACTGAAGCAGG + Intergenic
923788404 1:237090383-237090405 GAGGATTACATGAGGGAGGCAGG + Intronic
924149512 1:241114190-241114212 GAGGCAAAAATTAGGGAAGCTGG - Intronic
1063139749 10:3245515-3245537 GATGCTTGAATGGGGGAAGCTGG + Intergenic
1067070097 10:43124892-43124914 GATGCTGCAATGCTGGAAGCAGG + Exonic
1067694021 10:48522714-48522736 GAGGCTTCATTCTTGGAAGCAGG - Intronic
1071571787 10:86701172-86701194 GAGGCCTAGATGAAGGCAGCGGG - Intronic
1072413548 10:95228363-95228385 GAGGCTTAAATGAGGCAACATGG - Intronic
1072490843 10:95904719-95904741 GAGGGTTAAATGATGAAATAAGG + Intronic
1072603440 10:96955018-96955040 GAAGCTTACAGGATGGAACCAGG + Exonic
1073023123 10:100463425-100463447 AAGGACTAAATGATGGGAGCGGG + Intronic
1075341103 10:121647472-121647494 GAGGATGGAAGGATGGAAGCTGG - Intergenic
1075816946 10:125271742-125271764 TAGGCGGAAATCATGGAAGCTGG + Intergenic
1076425516 10:130364679-130364701 GAGGCTGGAATGATGGAGGAAGG + Intergenic
1079049960 11:17145463-17145485 GAAACTTAAATCATGGAAGAAGG - Intronic
1080886194 11:36370264-36370286 GAGACTTAAATGATGAAAAGAGG - Intronic
1083583477 11:63839648-63839670 GAGGCTTGCAGGATGGCAGCAGG - Intronic
1083728768 11:64642362-64642384 GGGGCTGAGATGATGGGAGCTGG + Intronic
1084902347 11:72319014-72319036 GAGCCTGAAGGGATGGAAGCTGG + Intronic
1092024472 12:5229247-5229269 GAGGGTGAAATCATGGAAGAGGG + Intergenic
1093092462 12:14937024-14937046 GAGGATAAAATGATGGCATCTGG + Intronic
1094753952 12:33444305-33444327 TAGGTTTAGAAGATGGAAGCTGG - Intergenic
1095250308 12:39971483-39971505 GATTCTGAAATGATGGAAACAGG - Intronic
1095917491 12:47494886-47494908 GTGGCTGAAATTATGAAAGCAGG + Intergenic
1097259355 12:57707433-57707455 GAGTCTCACATGGTGGAAGCAGG + Intronic
1098512221 12:71330025-71330047 GAAACTAAAATGATGAAAGCAGG + Intronic
1099463091 12:82947938-82947960 GCGGCTTCAGTCATGGAAGCAGG - Intronic
1100482797 12:94995410-94995432 TAGGCTATAATGATGGAAGTGGG + Intronic
1100701840 12:97157176-97157198 GAGGATTAAATAATGGCAGCTGG - Intergenic
1102977025 12:117214142-117214164 GGGGATGAAATAATGGAAGCTGG - Exonic
1103006282 12:117422894-117422916 GAGGCTTGAGTGAAGGCAGCAGG + Intronic
1103325203 12:120116008-120116030 GAGGTTTAAATGAGGTAAGTCGG - Intronic
1104328917 12:127826068-127826090 GAGGCTGAAAGAATGAAAGCAGG - Intergenic
1105584797 13:21733968-21733990 GAAGCTTAACTGAGGGAAGCTGG - Intergenic
1105790975 13:23798741-23798763 GTGTCTTACATGATGGCAGCAGG - Intronic
1107689239 13:42935349-42935371 CAGACATATATGATGGAAGCAGG - Intronic
1109835279 13:67849181-67849203 GATGATTGAATCATGGAAGCAGG - Intergenic
1111860898 13:93704412-93704434 GAGAGTTAAATGATTAAAGCAGG + Intronic
1111874174 13:93872629-93872651 AATGCTTAAATGATGGAAGCTGG - Intronic
1113331230 13:109329802-109329824 AAGGCTGAAATGATGGATTCAGG - Intergenic
1115112708 14:29842848-29842870 GAGGGTTAAATGTGGGGAGCGGG + Intronic
1115165857 14:30448177-30448199 CAGTCTTAAATCTTGGAAGCAGG - Intergenic
1115418819 14:33168681-33168703 GAGACTGAAATGAAGGAATCAGG - Intronic
1115778049 14:36737875-36737897 TAGGCTTAAATTCTGGAAGCAGG - Intronic
1118269911 14:64333302-64333324 GAGTCTTAAAAGAGGCAAGCAGG - Intronic
1121572474 14:94957334-94957356 GAGGTTCAAATGATGTCAGCTGG - Intergenic
1123633137 15:22275485-22275507 GTGGATGAAACGATGGAAGCAGG - Intergenic
1124157845 15:27243555-27243577 AATGCAAAAATGATGGAAGCTGG + Intronic
1134361200 16:13532706-13532728 GAAACTGAAATGTTGGAAGCAGG - Intergenic
1137812840 16:51369303-51369325 GGGGCTTAAATGATGTCAACAGG + Intergenic
1139518489 16:67465825-67465847 GAGACTTAAGTGAGGGAAGTAGG + Intronic
1140420909 16:74817982-74818004 GAGACTGAAATGCTGGAAGATGG - Intergenic
1144786596 17:17835781-17835803 GATGCTCCAAAGATGGAAGCCGG + Intronic
1145863628 17:28226943-28226965 GAGGCTGGGATGGTGGAAGCTGG + Intergenic
1147927313 17:43953772-43953794 GAGGCTGGGATGGTGGAAGCTGG - Intronic
1153538228 18:6126388-6126410 GAAGCTGAAATGATGAAATCTGG - Intronic
1156217091 18:35010612-35010634 GAGAATTAAATGATGGAATAAGG + Intronic
1156865558 18:41885361-41885383 GAGGCTGAAAAGATGGCAACAGG - Intergenic
1159114127 18:64093736-64093758 GAGTTTTAAATGATGAGAGCTGG + Intergenic
1161914100 19:7216020-7216042 GTGGCTAAGAAGATGGAAGCAGG + Intronic
1162037313 19:7948314-7948336 GAAGGTGAAATGATGGCAGCTGG + Intergenic
1163212947 19:15854877-15854899 GAAGCTGAAAGGATGGAGGCAGG + Intergenic
1163213111 19:15856475-15856497 GAAGCTGAAATGATGGAGGCGGG - Intergenic
1163829443 19:19540761-19540783 GATGCTCAAATGAGGGCAGCGGG - Intronic
1164380313 19:27730956-27730978 GAGGATTTCATGATGGAAACTGG - Intergenic
1164977524 19:32584482-32584504 GAGTCTTAAAACATGGAATCTGG + Intronic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
925229128 2:2216077-2216099 GAAGCTTAAATGATAGGAGGTGG - Intronic
926071590 2:9897994-9898016 GAGGCTGAGATGATGGTAGCTGG - Intronic
928830364 2:35475439-35475461 GAGGGTAAAATGAGAGAAGCAGG + Intergenic
932833664 2:75013917-75013939 TGGGGTTAAGTGATGGAAGCAGG + Intergenic
933342926 2:81045882-81045904 ATGGCTTAAATGATGAAAACAGG - Intergenic
939857739 2:147380799-147380821 GATGCTTAAATGATAGATACAGG - Intergenic
942139087 2:172959357-172959379 GGGGCTTAAAATATGGAAGAGGG - Intronic
944534871 2:200698779-200698801 CAGGCTTAAAAGAAGGCAGCTGG + Intergenic
947087057 2:226465350-226465372 GAAGCTTTAATGAAGGAAGAAGG - Intergenic
1171155182 20:22865459-22865481 CAGGCTTAAAGCATGAAAGCAGG + Intergenic
1172452401 20:35036184-35036206 GAAGGTTAAATGATGGAGTCAGG - Intronic
1172617227 20:36297376-36297398 GAGGCTAAAAGAATGTAAGCAGG - Intergenic
1173972054 20:47160760-47160782 GAGGCTTCAAGGATGAAATCTGG - Intronic
1175098229 20:56559014-56559036 GAGGCCTAAATCAAGGGAGCAGG - Intergenic
1176589288 21:8627118-8627140 GAGGCTGAAATTCTGAAAGCAGG + Intergenic
1180272115 22:10604115-10604137 GAGGCTGAAATTCTGAAAGCAGG + Intergenic
1185063948 22:48621338-48621360 GTGGATGAAATGATGGAAGCAGG - Intronic
949138020 3:594645-594667 GAGGCTGAAATTCTGAAAGCAGG - Intergenic
950741408 3:15055059-15055081 GAGTCTCACATGGTGGAAGCAGG + Intronic
955337860 3:58101910-58101932 AAAGGTTAAATGCTGGAAGCAGG + Intronic
955737516 3:62055339-62055361 AAGGCTTAAATCATTGAGGCTGG + Intronic
955925129 3:63996853-63996875 GAGGCTTTAAGGAAGGAAGCAGG + Intronic
956359746 3:68435095-68435117 GGGTGTTAAATGATGGAAGCAGG + Intronic
959849143 3:111067815-111067837 GAGGCCTTAATCATGGAAGAAGG - Intergenic
960111951 3:113853857-113853879 GAGGCTTAAATGATGGGGGCGGG + Intronic
960256960 3:115520867-115520889 GAGGCAAAAATTAGGGAAGCTGG - Intergenic
960593577 3:119388519-119388541 GAGGCTGAGAGGCTGGAAGCGGG + Intronic
961231727 3:125318877-125318899 GAAGAATAAATCATGGAAGCGGG - Intronic
966885340 3:184374712-184374734 GAGGCTTAAATGATGGAAGCAGG + Intronic
967777409 3:193398776-193398798 GAGGCTTAAATGAGAGAACAAGG + Intergenic
968488194 4:875112-875134 GGGACTTAAATGCTGGAGGCAGG - Intronic
969347035 4:6576148-6576170 GGGGCTGAAATGAGGAAAGCTGG - Intronic
970245695 4:14059986-14060008 GTGTCTTACATGATGGAAGTAGG - Intergenic
972563108 4:40246143-40246165 GAGTCTTAAATCACGGATGCGGG + Exonic
973963686 4:56138122-56138144 GAGATTTAAATGATTGAAACAGG + Intergenic
974544375 4:63281136-63281158 GAGGCTGAAATGTGGGAAGGAGG + Intergenic
976391666 4:84511928-84511950 CAGGCTTCAATGATGCTAGCAGG + Intergenic
978471921 4:109077604-109077626 GGGGCTAAAATGTTTGAAGCTGG - Intronic
981606827 4:146548541-146548563 CAAGCTTACATGATGGCAGCTGG - Intergenic
982763586 4:159317471-159317493 GAGGCTGGGCTGATGGAAGCAGG + Intronic
985342038 4:188964864-188964886 GATGATTAAATAATGGAGGCAGG + Intergenic
986755966 5:10836777-10836799 GAGGCTTAAACAATGGAAATTGG - Intergenic
990172376 5:53067507-53067529 GAAACTCAAAGGATGGAAGCAGG - Intronic
990531400 5:56676931-56676953 GACTCTTATATGATGGAGGCTGG + Intergenic
991022664 5:61996610-61996632 GAGGATTACAGCATGGAAGCAGG + Intergenic
991227680 5:64292120-64292142 ATGGCTGAATTGATGGAAGCAGG - Intronic
993317561 5:86429810-86429832 AAGGCTTAAATCCTGGATGCTGG - Intergenic
994120909 5:96111526-96111548 GAGTCTTGAAGGATGGAGGCTGG - Intergenic
994622871 5:102183888-102183910 GGTGATTAAATCATGGAAGCTGG + Intergenic
994745834 5:103677178-103677200 GAAGGCTAAATGAGGGAAGCAGG - Intergenic
996590272 5:125139010-125139032 CAGGCAGACATGATGGAAGCCGG - Intergenic
999711248 5:154320490-154320512 GAGGCTTGCTTGATTGAAGCAGG - Intronic
1000106312 5:158062348-158062370 GAAACTTAAATGATGGTAACAGG + Intergenic
1000422164 5:161050496-161050518 GAAACAAAAATGATGGAAGCAGG + Intergenic
1001398494 5:171433156-171433178 GGGGCTTCAATGGTGGGAGCTGG + Intronic
1003200932 6:3959699-3959721 GAGGCTTAAAGGATGGATCTGGG + Intergenic
1003318863 6:5035328-5035350 GAGGCTTAAAGGATGGATCTGGG - Intergenic
1004040183 6:11967616-11967638 GAGGATTGAAAGATCGAAGCAGG - Intergenic
1004520573 6:16357760-16357782 GAGGAATGATTGATGGAAGCTGG + Intronic
1006491942 6:34395105-34395127 GAGGCTTAACTAAAGGAGGCTGG + Intronic
1007761538 6:44136175-44136197 GAGGCATATTTGAGGGAAGCAGG + Intronic
1007971939 6:46060746-46060768 GAAGCTTTCATGAAGGAAGCAGG - Intronic
1008565919 6:52768095-52768117 GAGGCAAAAATTAGGGAAGCTGG - Intergenic
1008570109 6:52808435-52808457 GAGGCAAAAATTAGGGAAGCTGG - Intergenic
1008660873 6:53666151-53666173 GATGTTTAATTGTTGGAAGCAGG + Intergenic
1009671932 6:66765138-66765160 GAGGTTTAAATAATGAAATCTGG + Intergenic
1010275810 6:73967197-73967219 GATGATTGAATGATGGAGGCGGG + Intergenic
1010875927 6:81105631-81105653 AAGGCTTTAAAGATGGAATCAGG - Intergenic
1011466836 6:87666992-87667014 GAGGCTTTAATTAAGGAAACTGG - Intronic
1011810717 6:91129151-91129173 GAAGCTTAAATCATGGCAGAAGG - Intergenic
1012499710 6:99875131-99875153 GAGGCTGCAATGAGGGAAGTGGG + Intergenic
1014507186 6:122273748-122273770 GAGGCTAGAATGATGTAAGATGG - Intergenic
1014576890 6:123084391-123084413 GAGTAATAAATGATAGAAGCAGG + Intergenic
1018172110 6:161151627-161151649 GAGGATTAAATGAGAAAAGCTGG - Intronic
1019125698 6:169838941-169838963 GAGGGTGAAACGATGGATGCCGG + Intergenic
1019476975 7:1249000-1249022 GAGGCTTAGGGGAGGGAAGCAGG - Intergenic
1019529776 7:1497553-1497575 GAGGATTAATTAACGGAAGCTGG + Intronic
1024195020 7:47050587-47050609 GAGGGTTGAATGAGGGAAGAGGG - Intergenic
1026208500 7:68280291-68280313 GAGGCTTTGATGTTGGGAGCAGG - Intergenic
1026543644 7:71302641-71302663 TAGGCTGAATTGATGAAAGCTGG + Intronic
1026855823 7:73754038-73754060 GAGGCTGACCTGATTGAAGCAGG - Intergenic
1028737714 7:94236285-94236307 TAGGCTTTAAAGATGGAAGTAGG + Intergenic
1029592864 7:101518872-101518894 GATGCTTGGATGAAGGAAGCTGG - Intronic
1030102468 7:105958354-105958376 GGTGCTTGAATGATGGAACCTGG + Intronic
1030173983 7:106631773-106631795 GAGATTGGAATGATGGAAGCAGG - Intergenic
1031241928 7:119256758-119256780 GAGGTTTAAATGATGGGAAATGG - Intergenic
1032383299 7:131505222-131505244 GAGGATTCATTGATAGAAGCAGG - Intronic
1032484776 7:132277208-132277230 GTGGCTTAAGTGGGGGAAGCTGG + Intronic
1034831389 7:154311172-154311194 TAGCCTTAAATCATGGAAGTAGG + Intronic
1037755567 8:21707899-21707921 GAGGGTTAAATGATAAAAGATGG - Intronic
1037966491 8:23138074-23138096 GAGGTTTCACTGCTGGAAGCAGG - Intronic
1037973310 8:23190784-23190806 GACCCTGAAATGCTGGAAGCAGG + Exonic
1039383120 8:37104318-37104340 GAGGCTTAAATATTGGAAAGGGG - Intergenic
1039490876 8:37946681-37946703 AATGATGAAATGATGGAAGCTGG + Intergenic
1040384964 8:46908768-46908790 GAGACTTAAATCATGGCAGAAGG - Intergenic
1040452424 8:47561586-47561608 GAGGCAAAAAGGATGCAAGCTGG - Intronic
1041334991 8:56772121-56772143 GAGAATTAAAGGGTGGAAGCAGG + Intergenic
1041592736 8:59608399-59608421 GAAACTAAAATGATGGAAGAAGG + Intergenic
1042052158 8:64722823-64722845 GAGGCTTAAATGAAGTGAACAGG - Intronic
1042448581 8:68918603-68918625 GATGTTTAAATGTTGGAGGCAGG + Intergenic
1043094291 8:75946849-75946871 GAGGCTTTAATGGTGGAGGAAGG + Intergenic
1043793532 8:84505128-84505150 GATGCTGAAAAGATGGAGGCAGG - Intronic
1046447402 8:114340844-114340866 GAGACTCACATGCTGGAAGCTGG - Intergenic
1047812469 8:128425484-128425506 GAGGCTTGTATGATGGAAAATGG - Intergenic
1049793509 8:144484548-144484570 GATGCCTAAATGAAAGAAGCTGG - Intronic
1050672565 9:8014349-8014371 GATGCTGGAATCATGGAAGCAGG + Intergenic
1056818240 9:89817253-89817275 GAAGCTTAAATAAGGGGAGCAGG + Intergenic
1058889961 9:109353083-109353105 GGGGCTTAAATGATACAAGTAGG + Intergenic
1058954465 9:109932380-109932402 GAGCCATCCATGATGGAAGCTGG + Intronic
1059139156 9:111835704-111835726 GAGAGTTAACTGATGGAATCAGG - Intergenic
1059191484 9:112331918-112331940 TTGACTTAAATAATGGAAGCAGG - Intronic
1059766827 9:117391524-117391546 GATGATTGAATCATGGAAGCAGG - Intronic
1061492592 9:130954330-130954352 AAGGCTGAAATGAGGGAGGCAGG - Intergenic
1203785971 EBV:127755-127777 GAGGCTTTAATGTTGGACTCAGG - Intergenic
1187067137 X:15852149-15852171 GAGGCTGAAATGATAAAGGCAGG - Intronic
1188451945 X:30316651-30316673 AAGGCCTGAATGAGGGAAGCAGG + Intergenic
1189225169 X:39406747-39406769 GAGGGATACATGAGGGAAGCAGG - Intergenic
1191014284 X:55792325-55792347 GAGGCTGAAAAGTTGGAACCTGG + Intergenic
1194742643 X:97593216-97593238 GAGGCTGAAATAATGAAATCAGG + Intronic
1194871538 X:99138540-99138562 CAGGCTTCATTGATGGTAGCAGG + Intergenic
1197397536 X:125945504-125945526 GAGTCTTACATGTTGTAAGCAGG + Intergenic
1198668156 X:139047023-139047045 GAGGCTTGAATGATTGAACCAGG - Intronic