ID: 966891429

View in Genome Browser
Species Human (GRCh38)
Location 3:184410147-184410169
Sequence CACTGTGGCTGGAGTGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4696
Summary {0: 1, 1: 14, 2: 127, 3: 1461, 4: 3093}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966891429 Original CRISPR CACTGTGGCTGGAGTGCAGT GGG (reversed) Intronic
Too many off-targets to display for this crispr