ID: 966892236

View in Genome Browser
Species Human (GRCh38)
Location 3:184415962-184415984
Sequence CATCGTAAAGGCTCTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966892236_966892242 23 Left 966892236 3:184415962-184415984 CCATCCTCAGAGCCTTTACGATG 0: 1
1: 0
2: 0
3: 16
4: 152
Right 966892242 3:184416008-184416030 TCCGCCCTGACGTTTCCGCATGG 0: 1
1: 0
2: 0
3: 4
4: 24
966892236_966892239 -5 Left 966892236 3:184415962-184415984 CCATCCTCAGAGCCTTTACGATG 0: 1
1: 0
2: 0
3: 16
4: 152
Right 966892239 3:184415980-184416002 CGATGACTGTTCCGTCTGCCTGG 0: 1
1: 0
2: 2
3: 19
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966892236 Original CRISPR CATCGTAAAGGCTCTGAGGA TGG (reversed) Intronic
900518073 1:3092623-3092645 CATCCTCAGGGCTCTGTGGAGGG + Intronic
901514040 1:9733296-9733318 CATCATGAATGCTCTGAGGTTGG + Intronic
903794689 1:25919899-25919921 CATCCTAAAAACTCTGCGGAAGG - Intergenic
903853688 1:26322950-26322972 CAGTGCAAAGGCCCTGAGGAAGG - Intronic
904239608 1:29135202-29135224 CAGTGTCAAGGCTCTGAGGAGGG + Intergenic
906322776 1:44827231-44827253 TACCGCAATGGCTCTGAGGATGG - Exonic
906805924 1:48778398-48778420 GATTGTAAAGGTTGTGAGGATGG - Intronic
907026458 1:51124947-51124969 AATCTTAAAGGGTCTGTGGAAGG + Intronic
908651551 1:66338419-66338441 CATCCTAGAGGCTGTGAGTATGG - Intronic
909502083 1:76345867-76345889 CAGTGCAAAGGCCCTGAGGAAGG - Intronic
914241915 1:145858389-145858411 CATCCTGGAGGCTCAGAGGAAGG - Intronic
918103063 1:181393410-181393432 CGTCTTCAAGGCTTTGAGGATGG + Intergenic
918546076 1:185685440-185685462 CATTGTCAAGGCACTGATGATGG - Intergenic
921380237 1:214517111-214517133 CATTGTAAAGGCTTAGAGGTAGG - Intronic
922318729 1:224465503-224465525 CAGCATAAAAGCTATGAGGAGGG - Intronic
923636364 1:235701163-235701185 CATCACAAAGGTTCTGAGGTGGG + Intronic
1063512538 10:6660109-6660131 CATCCTAGAAGCTCTGAAGAAGG - Intergenic
1064325175 10:14343733-14343755 CAGTGCAAAGGCTCTGAGGCAGG - Intronic
1071094480 10:81957333-81957355 CAATATAAAGGCTTTGAGGAGGG - Intronic
1073029985 10:100518275-100518297 ATTTGTAAAGGCTCTAAGGAAGG - Intronic
1077066361 11:642702-642724 CATTGTAGAGTCTCAGAGGAAGG + Intergenic
1077888601 11:6403501-6403523 CATGGAGAAGGCTTTGAGGATGG - Exonic
1078761540 11:14255703-14255725 CATAGAAAGGACTCTGAGGATGG - Exonic
1082763315 11:57147107-57147129 CTTCTTAAAGGCACTGAGGGAGG - Intergenic
1084557498 11:69883690-69883712 CATCGGAGGGGCTCTGAGGCAGG + Intergenic
1084893666 11:72250157-72250179 GATCATAAAGGCCCTGGGGAAGG + Intergenic
1085319398 11:75564797-75564819 CACCTTCAAGGCTCCGAGGAGGG + Intronic
1085469732 11:76749871-76749893 CATGGTAAAGGCTCTAAGGTGGG - Intergenic
1085612060 11:77959547-77959569 GATCGTAAGGACTCAGAGGAAGG - Intronic
1085696226 11:78707035-78707057 CATCCACAAGGCTCTGTGGAAGG + Intronic
1088593919 11:111425733-111425755 CATCGAAATGGATCTGAGGGCGG + Intronic
1089676329 11:120092492-120092514 CAGAGCAAAGGCTCTGAGAAGGG + Intergenic
1090392098 11:126395441-126395463 AATCGCAAAGGCCCAGAGGAGGG + Intronic
1092118643 12:6027693-6027715 CATCTTAGAGGCTCTGAGAGAGG - Intronic
1093271724 12:17070796-17070818 CAAAGTAAATGCTCTAAGGAAGG + Intergenic
1095657655 12:44689183-44689205 CATGGAAAAGGCCCAGAGGATGG - Intronic
1096711010 12:53455958-53455980 CATAGCAAAGGCTTTGAAGATGG - Exonic
1097626211 12:62003406-62003428 CAGTGCAAAGGCTCTGAGGTGGG - Intronic
1101139722 12:101782844-101782866 CATTGCAAAGGCCCTGAGGCAGG - Intronic
1110270494 13:73584194-73584216 CAGCATAAAGGCCCTGAGGTAGG + Intergenic
1111934559 13:94546104-94546126 CATCTCAAAGGCACAGAGGAAGG - Intergenic
1113596714 13:111538924-111538946 CATCGCAAAGACTCTAATGACGG - Intergenic
1114058510 14:18998221-18998243 CATAGCTAAGGCTCTTAGGATGG + Intronic
1114104036 14:19403533-19403555 CATAGCTAAGGCTCTTAGGATGG - Intronic
1116048611 14:39776226-39776248 CATATTAAAGGCTCTGAGAAGGG + Intergenic
1118715734 14:68558488-68558510 CCTCCTAAAGGCTGTGGGGAAGG + Intronic
1119706239 14:76784348-76784370 CATCGTCAGGCCTCTGAGAAGGG - Intergenic
1122828907 14:104386012-104386034 CACTGGAAGGGCTCTGAGGACGG + Intergenic
1125361921 15:38873419-38873441 CAGCTAAAAGACTCTGAGGAAGG + Intergenic
1133534789 16:6691429-6691451 GATGGTAAAGGTACTGAGGAAGG - Intronic
1134524658 16:14934324-14934346 TATCGTGAAGGCTCTGAGCCTGG - Intronic
1134712247 16:16332811-16332833 TATCGTGAAGGCTCTGAGCCTGG - Intergenic
1134954582 16:18375883-18375905 TATCGTGAAGGCTCTGAGCCTGG + Intergenic
1140677763 16:77350331-77350353 CCTGGTAAAGGCTCTGGGGCTGG - Intronic
1144707826 17:17381004-17381026 CTTGGCAAAGGCCCTGAGGAAGG - Intergenic
1145241921 17:21245178-21245200 CAGTGCAAAGGCTCTGAGGCAGG + Intronic
1146927341 17:36754178-36754200 CAGCACAAAGGCCCTGAGGAAGG + Intergenic
1147639807 17:41989439-41989461 TTTCGTACAGGCTCTCAGGATGG - Exonic
1148032408 17:44630411-44630433 CATAATAAAGACTTTGAGGAGGG - Intergenic
1150219138 17:63486282-63486304 TGTCGTAAAGGCCCTTAGGAAGG - Intronic
1150594273 17:66590498-66590520 CCTCGTGCACGCTCTGAGGACGG - Intronic
1150634853 17:66905706-66905728 CATGGGAAAGGCTCTGAGGTGGG + Intergenic
1151150170 17:72078087-72078109 CAACCTAAAGGATCAGAGGAAGG - Intergenic
1162819375 19:13213239-13213261 CAGTGCAAAGGCTCTGAGGCTGG - Intronic
1162853507 19:13450290-13450312 CAGTGCAAAGGCTCTGAGGCTGG - Intronic
1163581037 19:18138892-18138914 CAGGGCAAAGGCTCTGAGGTGGG - Intronic
1163959161 19:20671135-20671157 CATGGTGAAGTTTCTGAGGATGG - Intronic
1165283756 19:34820067-34820089 CACTGTAAAGGCTCAGAGGAAGG + Intergenic
1166109999 19:40616077-40616099 CAGTGCAAAGGCTCTGAGGCAGG + Intronic
1167797769 19:51720984-51721006 CATCTTAAAGGCTTAGAGCAGGG - Intronic
926281155 2:11447626-11447648 CATCCAGAAGGCCCTGAGGAAGG - Exonic
926812977 2:16772829-16772851 CAGCGCAAAGGCTCTGAGCAGGG - Intergenic
927477649 2:23426098-23426120 CATGGGAAAGGCTCTTGGGAGGG + Intronic
930542701 2:52727280-52727302 CATCATATAAGCTTTGAGGAAGG + Intergenic
931746795 2:65298131-65298153 CATCGCAAAGGCATTGAGGGTGG + Intergenic
932720934 2:74138677-74138699 CCACGTAAAGGCTCTGAGCAGGG + Intronic
932780704 2:74556781-74556803 GATCATAAAGGCCCTGGGGAGGG - Exonic
936394394 2:112110572-112110594 CATCATAAAAGCTCTCAGAATGG - Intronic
936475837 2:112839047-112839069 CCGCATAAAGACTCTGAGGAAGG - Intergenic
938282692 2:130075997-130076019 CATAGCTAAGGCTCTTAGGATGG - Intronic
938333325 2:130464567-130464589 CATAGCTAAGGCTCTTAGGATGG - Intronic
938356488 2:130656104-130656126 CATAGCTAAGGCTCTTAGGATGG + Intronic
938432921 2:131262910-131262932 CATAGCTAAGGCTCTTAGGATGG + Intronic
940031840 2:149271950-149271972 CACCATAAAGGCCCTGAGGTAGG - Intergenic
947743970 2:232498138-232498160 CATCCCATGGGCTCTGAGGAGGG - Intergenic
947879093 2:233489415-233489437 CACCGTCCAGGCTCTGAGGTGGG + Exonic
1169937945 20:10904897-10904919 CATTGTGAAGGTTCTGAGCATGG - Intergenic
1170894312 20:20400106-20400128 CCTTGGAATGGCTCTGAGGAAGG + Intronic
1170982841 20:21230926-21230948 CAGCTGAAAGGCTCTGAGCACGG - Intronic
1173385209 20:42581106-42581128 CATTGCAAAGGCCCTGAGGCAGG - Intronic
1173950904 20:46992706-46992728 CATGGTGAAGGCTTTGAGGGTGG + Intronic
1174676844 20:52366197-52366219 TACAGTAAAGGCTCTGAGGAGGG - Intergenic
1177832038 21:26149911-26149933 CAGTGTAAAGGCTGTGAGGTGGG - Intronic
1177935739 21:27343236-27343258 CTTCATAATGGCTCTGAGGTGGG + Intergenic
1177998777 21:28134539-28134561 AATCATGAAGGTTCTGAGGAAGG + Intergenic
1178693867 21:34775891-34775913 CATTGTAAGGGCTTTGAGGATGG + Intergenic
1180476997 22:15720840-15720862 CATAGCTAAGGCTCTTAGGATGG + Intronic
1182448693 22:30405220-30405242 CTTCGTAAAGTCTCTAAGGATGG + Intronic
950399702 3:12760457-12760479 CAGGGCAAAGGCCCTGAGGAGGG - Intronic
950640863 3:14347173-14347195 CAGTGTAAAGGCCCTGAGGTGGG + Intergenic
960456537 3:117879543-117879565 GATCTAAAAGGCTATGAGGATGG + Intergenic
966892236 3:184415962-184415984 CATCGTAAAGGCTCTGAGGATGG - Intronic
967481366 3:189977094-189977116 CATCGTAAAGTCTCTGCTGCAGG - Intronic
968136045 3:196220205-196220227 GCTCGTGAAGGCTCTGAGGCTGG + Intronic
969237650 4:5877314-5877336 CATCGTAAAGGTTCTGTGCTGGG + Intronic
972633243 4:40859845-40859867 CAGTGCAAAGGCTCTGAGGTGGG - Intronic
975270677 4:72428990-72429012 CATGGAAAAGTCTCTGAGGTTGG - Intronic
976455773 4:85245714-85245736 CATCTAAAAGGCTTTCAGGATGG + Intergenic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
979611097 4:122689727-122689749 CATTGTAAAGGTCCTGGGGAGGG - Intergenic
986589577 5:9354766-9354788 CATGGTAGAGTCTGTGAGGAAGG + Intronic
990376515 5:55176254-55176276 CATTGAAAAGGGTCTGACGAAGG - Intergenic
994278691 5:97871873-97871895 CATGGGAAAGGCTCTGAGGCAGG + Intergenic
995837210 5:116410759-116410781 CAAGGTAGAGGCTCTGTGGAGGG - Intronic
997214571 5:132100139-132100161 CAGCGCAAAGGCTCTGAGGCTGG - Intergenic
998391792 5:141791809-141791831 CAGTGCAAAGGCTCTGAGGTGGG + Intergenic
998597812 5:143552284-143552306 AATCCTGAGGGCTCTGAGGAAGG - Intergenic
1001748682 5:174111317-174111339 CATTGTAAAGGTTTGGAGGAGGG + Intronic
1003408404 6:5841600-5841622 CATGGAAAAAGCTCTGAGGCAGG - Intergenic
1007718873 6:43873579-43873601 AAGCGCAAAGGCTCTGAGGCAGG + Intergenic
1007834813 6:44666310-44666332 CATCTGCAAGGCTTTGAGGATGG + Intergenic
1008147703 6:47911645-47911667 CATGGAAAGGGCTCTGAGGATGG + Intronic
1008872353 6:56287569-56287591 CATGGTAAAGGCGAAGAGGAAGG - Intronic
1012376156 6:98563940-98563962 CATTGTCAAGGCCCTGAGGAAGG - Intergenic
1014483980 6:121976303-121976325 CTTTCTAGAGGCTCTGAGGATGG - Intergenic
1015074501 6:129139180-129139202 CAGAGTAAAGGCTCTGAGTCTGG - Intronic
1015184355 6:130396894-130396916 CATCCTACTGGTTCTGAGGAGGG - Intronic
1015863197 6:137701889-137701911 CATGGTAAATGCACTGATGAGGG - Intergenic
1016389613 6:143561585-143561607 CATAGTGAAGTCTCTGGGGAGGG + Intronic
1019354915 7:573428-573450 TCCCGGAAAGGCTCTGAGGAGGG - Intronic
1021115110 7:16738658-16738680 CATCCAAAAGGCTATCAGGATGG - Intergenic
1023500665 7:40845816-40845838 GATCTTAAAGACTCTGGGGAAGG + Intronic
1024710925 7:52013723-52013745 CATCTGAAAGGCTCTGAGCATGG + Intergenic
1025247893 7:57331201-57331223 CAGCGCAAAGGCCCTGAGGCAGG - Intergenic
1026476945 7:70744491-70744513 CCTCGTCAAGGCACTGTGGAAGG - Intronic
1029036540 7:97528307-97528329 CATCTTCAAGGCTCTGAGAGGGG + Intergenic
1030268346 7:107643933-107643955 TATAGTAAAATCTCTGAGGAAGG + Intergenic
1033048161 7:137980953-137980975 CATCGTTAAGGGTCTTTGGAGGG - Intronic
1033830286 7:145243078-145243100 AATTGCAAAGGCTCTGAGGTAGG - Intergenic
1034373248 7:150619814-150619836 CATCTCAAAGGCACAGAGGAAGG + Intergenic
1034940565 7:155227813-155227835 CAATGAAAAGGCCCTGAGGAGGG + Intergenic
1035304998 7:157926389-157926411 CATAGTAGATGCTCTGAGAAAGG - Intronic
1035774043 8:2173707-2173729 CATGGGGAAGCCTCTGAGGATGG + Intergenic
1037751772 8:21686912-21686934 CACTGGAAAGGCTCTGAGCAGGG + Intergenic
1041609544 8:59828718-59828740 CATCTTAAAGCCTCTGAAAATGG - Intergenic
1042666238 8:71209584-71209606 CTTCCTACAGGCTCTGAAGATGG - Intronic
1042776460 8:72437357-72437379 CATTGTTAAGGCTCTGAGACTGG - Intergenic
1043796602 8:84549574-84549596 CTTTGCAAAAGCTCTGAGGAAGG + Intronic
1043818213 8:84829569-84829591 AATTTTAAAGGCACTGAGGAGGG - Intronic
1044390591 8:91645932-91645954 AATGGTAAGGGATCTGAGGAGGG - Intergenic
1044934487 8:97279587-97279609 CAGTGCAAAGGCTCTGAGGCAGG - Intergenic
1045905853 8:107343604-107343626 CATCTTTAAGGCCATGAGGAAGG + Intronic
1045996487 8:108367695-108367717 CTTCGTATATGCTGTGAGGATGG + Intronic
1048012156 8:130466616-130466638 CATCTTAAAGGCTTTTAAGAAGG - Intergenic
1050494248 9:6223893-6223915 GATCATAGATGCTCTGAGGATGG - Intronic
1058504593 9:105655350-105655372 CAGTGAAAAGGCTCTGAGGAAGG + Intergenic
1186488382 X:9951907-9951929 CATCTGGAAGGCTCTTAGGAAGG - Intergenic
1186608038 X:11111634-11111656 CCTCGCTAAGGCTCTGGGGATGG + Intronic
1190234599 X:48605943-48605965 CAGCCTAAAGGCACTGAGGCTGG + Exonic
1190453025 X:50599604-50599626 ATTCTGAAAGGCTCTGAGGAGGG - Intronic
1192151307 X:68714352-68714374 CAGCATCAAGGCTCTGAAGAGGG - Intronic
1192186380 X:68949433-68949455 CATCCTGAAGCCACTGAGGAGGG - Intergenic
1192223543 X:69213400-69213422 CAATGCAAAGGCTCTGAGGCAGG + Intergenic
1194769055 X:97877994-97878016 CTCCGTAATGGCTCTAAGGAAGG - Intergenic
1194817586 X:98463195-98463217 CATGGTAGAGGCTATGAGTAAGG - Intergenic
1196501334 X:116386690-116386712 CAACATAAAGGCAATGAGGATGG - Intergenic
1198710056 X:139491648-139491670 CCTCCTAAGGGCTGTGAGGAAGG + Intergenic
1198953321 X:142098076-142098098 AATGGTAAAAGCTCTGAGGCAGG + Intergenic
1199271067 X:145883196-145883218 CAGTGTAAAGACTCTGAGGTGGG - Intergenic