ID: 966892465

View in Genome Browser
Species Human (GRCh38)
Location 3:184417344-184417366
Sequence CCCTGTCGCCCAAGGCCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 201}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966892465 Original CRISPR CCCTGTCGCCCAAGGCCCAG AGG Intronic
900221457 1:1511610-1511632 CCCTCCCGCCCAAGACCCCGGGG - Intergenic
901203089 1:7477693-7477715 TCCTGTCGCCCAGTCCCCAGAGG - Intronic
901771298 1:11531650-11531672 CCCTGACGCCCACTGCCCCGTGG - Exonic
901842555 1:11963333-11963355 CTCTCTCACCCAAGGCCCAGAGG - Intronic
903101642 1:21035445-21035467 CCCTGTCACCACAGGCTCAGGGG + Intronic
903277829 1:22232982-22233004 CCCTGTCCCCCAAGGGCTGGGGG + Intergenic
904536339 1:31201993-31202015 CCCTGGCTCCCCAGGCCCAGCGG - Intronic
904599573 1:31666036-31666058 CCCAGGCCCCCCAGGCCCAGCGG - Exonic
904858044 1:33514753-33514775 CCCTCTCCCTCCAGGCCCAGGGG + Exonic
905884692 1:41485290-41485312 CCCTGTCACCCCAGGGCCTGGGG + Intergenic
906034173 1:42740451-42740473 CCCTGTGGGGAAAGGCCCAGAGG - Intergenic
906518294 1:46452477-46452499 CCCTGCCTCCCATGGTCCAGAGG + Intergenic
906671777 1:47661142-47661164 CCCTAGCCCCGAAGGCCCAGGGG - Intergenic
906816844 1:48888169-48888191 TCCTGGCCCCCAAAGCCCAGAGG + Intronic
912430157 1:109624619-109624641 CCCTGTCCCCCAGGGCCCCAGGG - Intronic
912641043 1:111346468-111346490 CCTTGGAGCCCAAAGCCCAGGGG - Exonic
912739273 1:112178431-112178453 CCCTGTCTACCAAAGCCCATGGG - Intergenic
913609253 1:120494233-120494255 CCTTGAAGCCCAAGGCACAGAGG - Intergenic
913986198 1:143568443-143568465 CCTTGAAGCCCAAGGCACAGAGG + Intergenic
914204575 1:145516217-145516239 CCTTGAAGCCCAAGGCACAGGGG + Intergenic
914370982 1:147024012-147024034 CCTTGAAGCCCAAGGCACAGAGG - Intergenic
914483699 1:148089405-148089427 CCTTGAAGCCCAAGGCACAGGGG + Intergenic
914581939 1:149027606-149027628 CCTTGAAGCCCAAGGCACAGAGG + Exonic
915298895 1:154941061-154941083 CCCTCTTGCCCAAGGCCCACAGG + Intergenic
915895694 1:159809272-159809294 GCCTGACGCCCAGGGCCCTGGGG - Intronic
919314041 1:195948556-195948578 CCCTGTCGCTGCAGGCTCAGGGG - Intergenic
920119195 1:203643060-203643082 CCCCGTAGCGAAAGGCCCAGAGG + Intronic
1063158693 10:3403385-3403407 CCCAGTCCCCAGAGGCCCAGAGG - Intergenic
1064143076 10:12806523-12806545 CCCTGCTGGCCAGGGCCCAGAGG - Intronic
1065637692 10:27746802-27746824 CGCTCTCGCCGAAGGCCCTGTGG + Intergenic
1065828879 10:29596614-29596636 CCCTCTAGCCCAATGCCCAGTGG - Intronic
1067469780 10:46528025-46528047 CCCTATCGCCCATCACCCAGTGG - Intergenic
1068763074 10:60733611-60733633 TCCAGTCGGCCAGGGCCCAGGGG + Intergenic
1071471760 10:85988530-85988552 CCTAGTCCCCCTAGGCCCAGGGG - Intronic
1074058499 10:109943598-109943620 GCCTGTCTCTGAAGGCCCAGGGG - Intronic
1074535315 10:114324813-114324835 CCCTCTCCCCCAAAGCACAGGGG - Intronic
1075106243 10:119542126-119542148 CCCCGACGCCCCAGGCCCAGGGG + Intronic
1076067795 10:127463082-127463104 CCCAGTTGGCCAAGGTCCAGGGG + Intergenic
1076392111 10:130110834-130110856 CCCTTCCGCACAAGGCCCTGGGG + Intergenic
1077106902 11:846089-846111 CCCTGGCCCCCCAGGCCCACGGG - Intronic
1077174557 11:1182800-1182822 CCATGTCGACCACGGCCCCGGGG + Intronic
1077174772 11:1183919-1183941 CCATGTCGACCACGGCCCCGGGG + Intronic
1077855905 11:6124611-6124633 CCCTTTAGCCCTAGTCCCAGGGG - Intergenic
1078140520 11:8689143-8689165 CACGGCCGCCCAAGGACCAGGGG - Exonic
1080745708 11:35106764-35106786 ACCAGTCTCCCAGGGCCCAGAGG - Intergenic
1083431822 11:62617173-62617195 TCCTCACGCCCAAAGCCCAGCGG - Exonic
1083967425 11:66051363-66051385 CTCTGTCTCCAAAGGCCAAGGGG + Intronic
1084118608 11:67056263-67056285 CCCTGGTGCCCAAGGGCCCGGGG - Intergenic
1088813413 11:113406366-113406388 CCCTGGCACCCCAGGGCCAGGGG - Intergenic
1088919554 11:114251223-114251245 TCCTGTCCTCCAAGTCCCAGGGG + Intergenic
1089175726 11:116547648-116547670 CCCTCTCTCCCAAAGCCCAGAGG + Intergenic
1089373135 11:117975666-117975688 CCCTGTCCCCCAGGCTCCAGGGG - Intergenic
1092108941 12:5945399-5945421 CCCGGGCGCCCAGGGCGCAGCGG - Intronic
1093186058 12:16021175-16021197 CCCTGCCATCAAAGGCCCAGAGG + Intronic
1094743365 12:33314803-33314825 CCCTGTCACCACAGGCCCTGAGG - Intergenic
1094824030 12:34253564-34253586 CTCTGTCGCCCAAAGGGCAGTGG + Intergenic
1096349884 12:50888515-50888537 CTCTGTCGCCCAAGCTGCAGTGG - Intergenic
1097014355 12:55974522-55974544 ACCTGTCGCCCGAGCCCCGGGGG + Intronic
1101381231 12:104215784-104215806 CCATGTCGCACAAGGCCCTGTGG - Exonic
1102027018 12:109719453-109719475 CCCTGTCGCCCGTGTCCCAGTGG + Intronic
1103063100 12:117874936-117874958 CCCTCTAACCCCAGGCCCAGGGG - Intronic
1104194732 12:126524266-126524288 GCCAGTCCCACAAGGCCCAGTGG - Intergenic
1104241380 12:126993404-126993426 GCCTGTGGCCCAAGGACCGGGGG - Intergenic
1104650257 12:130526045-130526067 CCCTTGGTCCCAAGGCCCAGAGG + Intronic
1106024993 13:25947992-25948014 CCCTGGTGCCCAATGCCCATTGG - Intronic
1106942220 13:34791850-34791872 ACCTGTGGCCCAAGGCAGAGGGG + Intergenic
1109166311 13:59039749-59039771 CCCTGTGGGCCTAGGCCTAGAGG - Intergenic
1110810603 13:79807676-79807698 CCTTGACACCCAAAGCCCAGAGG - Intergenic
1112337566 13:98527618-98527640 CCCAGTCGTTCAAGGCACAGGGG - Intronic
1118339043 14:64879670-64879692 GCCTGACGCGCAGGGCCCAGAGG - Intronic
1121195527 14:92068297-92068319 CCCTGTCAGCAAAGGCCAAGTGG - Intronic
1121440302 14:93944690-93944712 CTCTGTCCCCCAAGGCTCAGAGG - Intronic
1121733821 14:96204651-96204673 CCCTGGCCCCCAGGGCTCAGAGG + Intergenic
1122093447 14:99354587-99354609 TCCTGTGGCCCAGGGGCCAGAGG + Intergenic
1122806885 14:104264341-104264363 CCCTGACGGCTCAGGCCCAGTGG - Intergenic
1125435984 15:39645743-39645765 CCCTGTCCCTGAAGGCTCAGGGG + Intronic
1129245078 15:74274377-74274399 CTCTGTCCCCCAAGGCCCCTAGG - Intronic
1129601357 15:77000380-77000402 ACCTGTCTACCATGGCCCAGGGG + Intronic
1129887441 15:79048381-79048403 CCCTGGCGGCCAAGCTCCAGAGG - Intronic
1131114396 15:89785087-89785109 ACCTGTCGCCCAGTGCCCTGGGG - Exonic
1131981978 15:98003252-98003274 CACGTTCTCCCAAGGCCCAGAGG + Intergenic
1132675072 16:1118136-1118158 CCCTGTAGCCCCAGCCCCCGGGG - Intergenic
1133116992 16:3583034-3583056 CCCTCACGCCCACGGGCCAGAGG + Intronic
1136635117 16:31516220-31516242 CCCTGTCACCCAGGGTACAGAGG - Intergenic
1139011208 16:62636750-62636772 CTCTGTCGTCCAGTGCCCAGTGG + Intergenic
1142427965 16:90010874-90010896 CCCTTTGGCCCTAGGCCCTGTGG + Intronic
1146086722 17:29837544-29837566 CCCTGTGGCCCATGTCCCCGAGG + Intronic
1147150393 17:38510668-38510690 CGCTGTCGCCCGAGACCCGGCGG + Exonic
1147661086 17:42117483-42117505 CACTGACGCCCAAGGCCAACCGG - Exonic
1151235828 17:72719298-72719320 CCCTGCCTCCCGAGGCCCCGTGG + Intronic
1152725218 17:81941766-81941788 CACAGTCCCCCAAGGCCCTGGGG + Exonic
1152730339 17:81966927-81966949 CCCTGGCGCTCAAGGCCCTGGGG - Intergenic
1152804474 17:82348560-82348582 CCCTGCAGCCCCAGGCCCTGGGG - Intergenic
1156144527 18:34159502-34159524 CCCTGTCCCCCACCACCCAGGGG - Intronic
1157566163 18:48680536-48680558 CCCTGTCGACGGATGCCCAGAGG + Intronic
1158581493 18:58688140-58688162 CCCTGTCGCACAAGGCTTTGTGG + Intronic
1159960195 18:74549745-74549767 CCCTCTCACCACAGGCCCAGAGG + Intronic
1160516245 18:79480680-79480702 CCCGGTTGCCCCAGCCCCAGCGG + Intronic
1160944978 19:1637387-1637409 CCCGCTCCCCCAAGGCCCTGGGG + Intronic
1161840091 19:6674875-6674897 CCCAGTCCCCAAAGGACCAGAGG + Intergenic
1162836269 19:13320198-13320220 CCCTGTCCCCCAAGGTCCCAAGG - Intronic
1163745432 19:19043780-19043802 CCCTTTGGCCCACGGACCAGTGG + Intronic
1163851806 19:19668699-19668721 TCCTGTCGCTCAAGCCCCAGGGG + Intergenic
1166074346 19:40404991-40405013 CCCTGTCCCCCCAATCCCAGAGG - Intronic
1167491057 19:49792804-49792826 CCATGGCGCCCGAGGCCCCGTGG + Intronic
924963798 2:57638-57660 CCCTGTCCCCACAGGCTCAGGGG + Intergenic
926310254 2:11669811-11669833 CCAGGTCGCCGAAGACCCAGGGG + Exonic
926526911 2:13992317-13992339 CCCTCTCACCACAGGCCCAGAGG - Intergenic
930490069 2:52058359-52058381 CCCTGTCATCACAGGCCCAGAGG + Intergenic
931014960 2:57966200-57966222 CCTTGCCTCCCAAGGCCCATGGG + Intronic
932000285 2:67878669-67878691 TCCTGTCTCCCAAGGGCTAGTGG + Intergenic
932698922 2:73980034-73980056 CCCTGTCAACCAAGGCTCAGGGG + Intergenic
933119865 2:78523099-78523121 CCATGTCGCCCAAGGACCTAGGG + Intergenic
935171581 2:100614606-100614628 CCCTGGGGCCCAAGGCCAAAAGG - Intergenic
936089678 2:109492955-109492977 CCCAGTCCCCCAAGGGCCTGGGG - Intronic
936152140 2:110027757-110027779 ACCTGCCGCACAAGGCCCAGAGG + Intergenic
936192538 2:110343656-110343678 ACCTGCCGCACAAGGCCCAGAGG - Intergenic
938798542 2:134738944-134738966 CACTGCCTCCCAAGGACCAGAGG - Intergenic
940188532 2:151013850-151013872 CCCTGTGGGGCCAGGCCCAGAGG - Intronic
941754529 2:169170765-169170787 TCCTGTGTCCCAAGCCCCAGAGG + Intronic
941917499 2:170822199-170822221 CCCAGTCTCCCAAGCCCCAAAGG - Intronic
944289916 2:197993584-197993606 CCTTGTCCCCTCAGGCCCAGGGG - Intronic
944662221 2:201930635-201930657 CCCTTTGGCCCAGAGCCCAGTGG - Intergenic
945254229 2:207790651-207790673 GCCTGAGGCCCAAGGCCTAGAGG - Intergenic
945304077 2:208241985-208242007 CTCTGTGGCCCAAGGTACAGAGG - Exonic
947612388 2:231531986-231532008 TCCTTTCTCCCAAGGCCCTGAGG - Intergenic
948897420 2:240933919-240933941 ACCCGTGGCCCAAGGCCAAGTGG - Intronic
949026942 2:241770717-241770739 CCCAGTCCCCAGAGGCCCAGCGG - Intergenic
1170330852 20:15208977-15208999 CCCTGTCATCAAAGGTCCAGTGG - Intronic
1170989200 20:21286707-21286729 CTCTGTCGCCCAGGGTGCAGTGG - Intergenic
1172227804 20:33316902-33316924 CGCTGCTGCCCCAGGCCCAGGGG + Intergenic
1175086328 20:56462134-56462156 CCATGTCCTCCAAGTCCCAGGGG + Intergenic
1175290369 20:57871184-57871206 CCCTGTTGCCCCAGACACAGTGG + Intergenic
1175975749 20:62709603-62709625 CGGCGTCGCCGAAGGCCCAGGGG - Exonic
1177861257 21:26457305-26457327 CGCTGTCACCCCAGGCCAAGGGG - Intergenic
1178826872 21:36024625-36024647 CCCTGTCTCTCAAGGCTGAGAGG + Intergenic
1179551242 21:42145390-42145412 CCCAGGAGCCCAAGGCCCACTGG - Intergenic
1180736959 22:18024438-18024460 CCCCCTCGCCCAGGGCCCAGGGG + Exonic
1181559930 22:23694118-23694140 CCTTGACTCCCACGGCCCAGTGG + Intronic
1181938758 22:26458411-26458433 CCCCGTCGCCCCAGGCCCCTTGG + Intronic
1182034094 22:27183955-27183977 CCCAGTCTCCCTGGGCCCAGGGG + Intergenic
1182357418 22:29728564-29728586 GCCTGCAGCCCAGGGCCCAGAGG - Intronic
1184176784 22:42793481-42793503 CCCTGCAGCCCAAGACCAAGGGG + Intergenic
1184616520 22:45641605-45641627 CCCTGTCTTCCCAGGGCCAGCGG - Intergenic
1184757095 22:46522961-46522983 CGCTGTCGGCCAAGGCCCCAGGG - Intronic
1185074847 22:48677653-48677675 CCCTGAGCGCCAAGGCCCAGAGG + Intronic
1185186150 22:49401690-49401712 CACTGTCCACCAAGCCCCAGTGG + Intergenic
950335196 3:12187658-12187680 CTCTGGAGCCCAAGGCCCACAGG - Intronic
952947095 3:38485532-38485554 CCCTGTGCCCCAACACCCAGAGG - Exonic
953772300 3:45787163-45787185 CCCTGTTCCCCAAGCCTCAGAGG - Intronic
954661910 3:52230915-52230937 CCCTGCAGCCTGAGGCCCAGCGG - Exonic
959923070 3:111891202-111891224 GTCTGTGGCCCATGGCCCAGGGG - Intronic
961025651 3:123553720-123553742 CCATGTCCCCCAAGTCCCATGGG - Intronic
961269660 3:125679776-125679798 ACCTGTGGCCCATGGACCAGGGG - Intergenic
961562626 3:127741044-127741066 CACTGTGGCTGAAGGCCCAGTGG - Intronic
961821378 3:129577367-129577389 CCCAGGCGCCCACGGCCCAGGGG + Intronic
963011335 3:140773192-140773214 CTCTCACCCCCAAGGCCCAGAGG - Intergenic
964188216 3:153972749-153972771 TGCTGTCGCCCAAGCACCAGGGG - Intergenic
964790930 3:160452807-160452829 TCCTCACGCCCAAAGCCCAGCGG + Intronic
966892465 3:184417344-184417366 CCCTGTCGCCCAAGGCCCAGAGG + Intronic
967988833 3:195116095-195116117 TCCTGTCACCCAAGGCAGAGGGG + Intronic
968891094 4:3368919-3368941 CCCTCTGGCCCAGAGCCCAGGGG + Intronic
968983919 4:3865286-3865308 TCCTGCAGCCCATGGCCCAGAGG + Intergenic
971394530 4:26216019-26216041 CCCTATCGCCAAAGACCCCGGGG + Intronic
974012790 4:56623000-56623022 CCGTGTGGACCAGGGCCCAGAGG - Intergenic
975584740 4:75939219-75939241 CCCTGTCGCCCCAGCCCTGGTGG + Intronic
977614652 4:99074713-99074735 CCCTCCCCCCCAAGTCCCAGGGG + Intronic
978403009 4:108350383-108350405 GCCTGGCGCCCACAGCCCAGAGG - Intergenic
980922776 4:139103397-139103419 CCCTGTTTCCCGAGGCCCAGAGG - Intronic
981574318 4:146188390-146188412 CCCTGCCCCCCAAGTCCTAGGGG - Intronic
983337548 4:166416058-166416080 CCCTGACGTCACAGGCCCAGAGG - Intergenic
983393879 4:167168808-167168830 CCCTCCCGCCACAGGCCCAGAGG + Intronic
983863235 4:172734391-172734413 CACTGCAGCCCCAGGCCCAGTGG + Intronic
984238829 4:177193449-177193471 CCCTGTCGCCCAGGGCAATGAGG - Intergenic
985546902 5:514449-514471 CCCTGCCCCCCGAGGCCCATCGG + Intronic
989595180 5:43150064-43150086 CCCTGTCCCCCTAGTCCCACAGG + Intronic
990023643 5:51159618-51159640 CCCTGTCCCCAGAGGCTCAGGGG + Intergenic
1001546854 5:172575576-172575598 CCGAGTGGCCCAAGGCCCACTGG - Intergenic
1002065934 5:176651645-176651667 CCTTCTCACCCCAGGCCCAGAGG - Exonic
1002335051 5:178471772-178471794 CCCTGTAGCCCAGAGCCCACTGG + Intronic
1002962057 6:1924465-1924487 CCCTGTCTCCCAAGAGCAAGGGG + Intronic
1003874405 6:10423381-10423403 ACCTGTCGCCTAAGGCCGAGAGG - Intergenic
1005692027 6:28315804-28315826 CAGAGTCGCTCAAGGCCCAGGGG + Intergenic
1006096391 6:31659286-31659308 CCATGTAGCCAGAGGCCCAGCGG + Exonic
1014817404 6:125951128-125951150 CCCTGTCTCCCAAGTCTCTGTGG + Intergenic
1017228580 6:152047889-152047911 CCCTGTGACCCCAGGCACAGTGG - Intronic
1018907421 6:168083645-168083667 CCCTGTCTCCCAAGGGGCAGAGG - Intergenic
1020016892 7:4836438-4836460 CGCTGCCGCCCAGGGCCCCGAGG - Exonic
1022102297 7:27175698-27175720 ACCTGTAGCCCACGGGCCAGGGG - Intronic
1022236510 7:28466996-28467018 CCCTGTCCCTCCAGGCTCAGAGG - Intronic
1023592140 7:41791839-41791861 CCCTGTTGCCCAGGGTGCAGTGG + Intergenic
1023872345 7:44269751-44269773 CCCTCTCGCCCAAGGGCCTCTGG + Intronic
1023940943 7:44768069-44768091 CACTGGAGCCAAAGGCCCAGGGG - Exonic
1024249060 7:47492550-47492572 GCCTGTGCCTCAAGGCCCAGTGG + Intronic
1026567865 7:71504353-71504375 CTCTGTCGCCCAGGGTGCAGCGG - Intronic
1026874118 7:73869946-73869968 CCCTGCTGCCCCAGGCCCAGTGG + Intergenic
1027377865 7:77572300-77572322 CCATGTTGCCCAGGGCCCAGTGG + Intronic
1029112992 7:98223034-98223056 CCTTGTCGCTGACGGCCCAGAGG + Exonic
1029513002 7:101008483-101008505 CCCTGTCTCCCAAAACCCTGAGG - Intronic
1032410445 7:131690316-131690338 CCCTGCTGCCCTAGGGCCAGAGG - Intergenic
1033511647 7:142065483-142065505 CCCTGTCGGCAAAGGCCCTGGGG - Intronic
1035031720 7:155865305-155865327 CCTGGTTGCCCATGGCCCAGAGG + Intergenic
1040560830 8:48522034-48522056 CCCTGACAACCAAGGCCCAGAGG - Intergenic
1044494965 8:92866397-92866419 CTCTGTCACCCTAGGCCCACTGG - Intergenic
1047436409 8:124838918-124838940 CCATGGCAACCAAGGCCCAGTGG + Intergenic
1053158963 9:35800444-35800466 CCAGGTCTCCCATGGCCCAGAGG - Exonic
1055753833 9:79535690-79535712 CCAAGTCGCCCAAGTCCCACAGG - Intergenic
1055909017 9:81326473-81326495 CCCTGGGGCCCAAGCCACAGTGG - Intergenic
1058275651 9:103038191-103038213 CCCTGTCCCCCAACACCCACAGG + Intergenic
1059395731 9:114032920-114032942 CACTGATGCCCAAGGCTCAGAGG - Intronic
1059433121 9:114261497-114261519 CCCTGTCTCCCCAGCCCCACAGG - Intronic
1059434041 9:114265891-114265913 TCCAGTCGCCCAAGGCCACGGGG + Intronic
1060583452 9:124771341-124771363 CGCTGCCGCGCAAGGCCCTGCGG + Intergenic
1060741897 9:126104249-126104271 CTGTGTCCCCCAGGGCCCAGGGG - Intergenic
1060817903 9:126645024-126645046 CCCTGTCCCACCTGGCCCAGCGG + Intronic
1061250822 9:129425367-129425389 CCCTGTGAGCAAAGGCCCAGGGG - Intergenic
1061549893 9:131328143-131328165 GCCTGTCGTCCCAGGCACAGAGG - Intergenic
1061649961 9:132039675-132039697 CCCTGTGTCCCAAGGACGAGTGG + Intronic
1062495253 9:136828436-136828458 TCCTATGGCCCAAGGCCCAGGGG + Intronic
1190444179 X:50506548-50506570 CCCTGGGTCCCAAGGACCAGTGG - Intergenic
1191025467 X:55908738-55908760 CCCCGTCGGCCCAGGCCCCGGGG + Intergenic
1193116451 X:77780364-77780386 CCCTGTCGCCCAGGCTGCAGTGG + Intronic
1194079195 X:89436668-89436690 CTCTGTCGCCCAAGCTGCAGTGG - Intergenic
1195670633 X:107466763-107466785 CCCCTTGCCCCAAGGCCCAGTGG - Intergenic
1195803179 X:108735177-108735199 CCCCGTCGCCGATGGCCCTGAGG + Exonic
1200053927 X:153448869-153448891 CCCTGCCCCCCAAGCCCCAGGGG + Intronic
1200055286 X:153456922-153456944 GGCTGTTGCCCAAGGCCCCGGGG - Intronic