ID: 966895104

View in Genome Browser
Species Human (GRCh38)
Location 3:184439078-184439100
Sequence AAGGAGAAGGAGAAGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8450
Summary {0: 25, 1: 106, 2: 378, 3: 1647, 4: 6294}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966895098_966895104 17 Left 966895098 3:184439038-184439060 CCATCTCAAAAAGAAGAAGAAGA 0: 13
1: 65
2: 765
3: 9705
4: 106664
Right 966895104 3:184439078-184439100 AAGGAGAAGGAGAAGGAGAAAGG 0: 25
1: 106
2: 378
3: 1647
4: 6294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966895104 Original CRISPR AAGGAGAAGGAGAAGGAGAA AGG Intronic
Too many off-targets to display for this crispr