ID: 966895108 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:184439084-184439106 |
| Sequence | AAGGAGAAGGAGAAAGGGGG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 4340 | |||
| Summary | {0: 1, 1: 4, 2: 63, 3: 554, 4: 3718} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 966895098_966895108 | 23 | Left | 966895098 | 3:184439038-184439060 | CCATCTCAAAAAGAAGAAGAAGA | 0: 13 1: 65 2: 765 3: 9705 4: 106664 |
||
| Right | 966895108 | 3:184439084-184439106 | AAGGAGAAGGAGAAAGGGGGAGG | 0: 1 1: 4 2: 63 3: 554 4: 3718 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 966895108 | Original CRISPR | AAGGAGAAGGAGAAAGGGGG AGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||