ID: 966895108

View in Genome Browser
Species Human (GRCh38)
Location 3:184439084-184439106
Sequence AAGGAGAAGGAGAAAGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4340
Summary {0: 1, 1: 4, 2: 63, 3: 554, 4: 3718}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966895098_966895108 23 Left 966895098 3:184439038-184439060 CCATCTCAAAAAGAAGAAGAAGA 0: 13
1: 65
2: 765
3: 9705
4: 106664
Right 966895108 3:184439084-184439106 AAGGAGAAGGAGAAAGGGGGAGG 0: 1
1: 4
2: 63
3: 554
4: 3718

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966895108 Original CRISPR AAGGAGAAGGAGAAAGGGGG AGG Intronic
Too many off-targets to display for this crispr